Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 85%

 1012837268 Xl3.1-IMAGE:5154731.5.5 - 194 ESTs
                                                                       ....-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:5154731.5.5                                                                 CGCTGTGCTTCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAAAGAAAGAAGAAGAAGAAGAATCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAATCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCATAGCTCAGAGTTTGATGTACATTTTTAAATACATCTGTGTGAGACCTAATACTGCCATACATTGCGCCCTTTTCTTTCAGTATTGCCAGGTTACCAGGCTTTACCATACAGCTTTCTTTAACTGAAAAAGATATCTGCCAGCATCTTATCTTTTCTAAAGGGTAATCTATAAATCTTATTGATTAGCAACCTGATTTTTATTTTTTTTTAATATTGTACCCTAAAACCAAAAGAGGTACATTTCTGCTATCCACAGTGAAATTTCTTATTAACTTAAGGCAAACGGTTATTTATTTATGTATTTTTGTTTCTCTAAGTACAACTTGCTCAGTGGTGGTTTCCCATCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCATACACAACATTTATCTCCGTAATTATGGTGTGCAGTGATGGAAGCCACACACAACCTTAATCTCAGTAATTATCTTTTTTTCTGTGCTGTTTTCCATCTTTTTTTTTTTCCGTTCTCATTAAGCCCCAAACAATCATTGATGCTGTCACAAAGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATA
                                                  Xl3.1-CHK-1012722618                                                                       GCTTCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAAAGAAAGAAGAAGAAGAAGAATCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAATCCAxTxxxxCxTCxxCTCCTGTTGATGCCGTTTCTTTCTGGAGTCATAGCTxxxxxxxTGATGTACATTTTTAAATACATCTGTGTGAGACCTAATACTGCCATACATTGCGCCCTTTTCTTTCAGTATTGCCAGGTTACCAGGCTTTACCATACAGCTTTCTTTAACTGAAAAAGATATCTGCCAGCATCTTxTCTTTxCTAAAGGGTAATCTATAAATCTTATTGATTAGCAACCTGATTTTTATTTTTTTTTAATATTGTACCCTAAAACCAAAAGAGGTACATTTCTGCTATCCACAGTGAAATTTCTTATTAACTTAAGGCAAACGGTTATTTATTTATGTATTTTTGTTTCTCTAAGTACAACTTGCTCAGTGGTGGTTTCCCATCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCATACACAACATTTATCTCCGxxxxxxTGGTGTGCAGTGATGGAAGCCACACACAACCTTAATCTCAGTAATTATCTTTTTTTCTGTGCTGTTTTCCATCTTTTTxxxxTTCCGTTCxxAxxAAxCxxxxxxxxxTCATTGATGCTGTCACAAAGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAC
                                                      consensus depths                                                                      4    12    13    30    16    47    24    55    30    62    39    67    43    70    43    71    43    71    43    71    43    71    43    71    44    72    44    72    42    72    44    72    43    72    45    73    46    74    41    74    44    74    43    74    43    75    43    74    43    75    42    75    42    75    44    78    44    78    42    77    42    77    42    77    42    77    42    77    42    77    42    77    42    77    41    78    43    77    40    76    39    76    63    75    64    76    61    75    60    75    63    75    57    74    56    74    56    72    54    72    50    69    52    69    51    68    48    65    47    65    47    64    42    62    38    59    34    57    34    53    32    48    26    41    24    38    24    36    23    36    22    35    23    34    21    33    18    30    18    30    19    29    19    28    18    27    18    26    18    24    19    23    18    21    18    21    19    21    18    19    17    19    14    18    15    18    16    19    15    20    15    21    16    21    15    21    10    20    10    20    10    21    10    19    10    19     9    19    10    19    10    21    10    21    10    21    10    21    10    20    10    19     9    18     8    16     8    16     8    18     8    18    14    16    16    17     8    16    15    16    15    16    16    16    13    16    16    17    17    17    16    17    14    17    14    16     7    15     7    15     7    15     7    15     6    12     6    11     6    11     6    11     6    12     6    12     6    12     6    13     7    13     7    13     7    13     7    13     7    14     7    14     7    14     7    14     7    14     7    14     7    14     6    15     6    15     5    16     5    18     4    17     4    16     7    17     3    20     3    19     6    20     9    27    10    28    11    29    11    31    12    32    16    32    20    37    22    39    21    40    24    41    29    45    29    45    28    45    28    46    28    46    28    47    25    47    30    48    30    49    28    50    31    51    33    53    34    53    36    57    34    58    33    56    35    58    35    58    34    57    37    60    35    62    36    63    35    64    35    64    37    66    36    66    38    66    37    65    37    69    37    70    34    67    32    67    36    66    34    65    35    65    34    64    36    66    35    66    34    66    36    66    35    65    34    65    31    63    30    63    31    63    33    63    29    61    26    61    26    61    26    61    27    59    25    55    20    48    14    37    12    30     7    19
  5   1   2      ests                            Xl3.1-IMAGE:5154731.5                                                                          TCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAAAGAAAGAAGAAGAAGAAGAATCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAATCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCATAGCTCAGTTGATGATGTACATTTTTAAATACATCTGTGTGAGACCTAATACTGCCATACATTGCGCCCTTTTCTTTCAGTATTGCCAGGTTATCAGGCTTTACCATACAGCTTTCTTTAACTGAAAAAGATATCTGCCAGCATCTTCTCTTTTCTTAAGGTAAATCTATAAATCTTATTGATTAGCAACCTGATTTTTATTTTTTTTTAATATTGTACCCTAAAACCAAAAGAGGTACATTTCTGCTATCCACAGTGAAATTTCTTATTAACTTAAGGCAAACGGTTATTTATTTATGTATTTTTGTTTCTCTAAGTACAACTTGCTCAGTGGTGGTTTCCCATGTATTTTTGTTCACAGTGTGCCTACTTGCTCAGTGGCTTTGGTGTGCAGTGATGGAAGCCATACACAACATTTATCTCCGTAACATTGGTGTGCAGTGATGGAAGCCACACACAACCTTAATCTCAGTAATTATCTTTTTTTCTGTGCTGTTTTCCATCTTTTTTTT
  5   1   2      ests                               Xl3.1-XL411b05ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGTCATTGATGCTGTCACAAAGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAACATC
  5   1   2      ests                            Xl3.1-IMAGE:6874226.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACATCATTTACAGGTTATTATTTCCACTGAAAATCCAAGAAACTTTTTTTGACAGGACTGTGGAAGAATCATTCTACATTTTTCCAAGTGTTAATGGAAAACTGAAGGGAAAGTATTAATGGAAACTAAGTATTTCTCAAACGTGTATCTTACAGAGTTGTTGGGAGACTAGCGTGCAGGGTGGCACCATAATGAACACATGTAGATTAAGGCATTTGTACATTAAAGCAGAGTTTACCATTACTACACATCCATTTAATACCAGGTTTATGGTAGTCTATCCAAGATGGAACTACAGATCTCAGAATCTCAGAATTTTTTTAACAAAGATGATGCTGGAAGATAATGGTAGTTCCCCCACCGTTTCTGGCACCACATAAGTACAAAATGCATTGTGTTGGCCCTCTCTGGTTGACCCAGTGCTACATTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTTGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAA
                                                                   VAR                                                                             GTGATTCCTCCTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                     GCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAATCATCATCATCATCACAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGTGTACACCAAGCCACTAAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGATGAAGAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAATATATTGGATACAGGAAGTGACTCTGGCTATGAAGGTAGCTCTTCACCCTTTAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGATTCATTCAGTACTGAACTTTTTCCTCAGCTTCTCCTCAGTGCCCATATGGACCAGTCCATCTGTCCCTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGATTTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTGATAAATCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAAGGTAAAATTGTTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATATAAATCTTATTGATTGGAAACCTGTTTTTATTTTTTTTACTGTTGTACCCCAAAAGCACAAGAGGTACATTTCTTCAATCCAATGGTGAAATTTCTTATTTCGATAAGAAGCAAGGCAAACGGTTATTTATTTATTTATGTATTTTTGTTTTTCTAAGTACAACTTGCTCAGTGGTAGTTTCCCTTCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAATCTATGTCTATGTATTGATGCTGTCACATAGTCTATACAGGTCTGTATGAAAGATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAGGTTATTATTTCCACTGAAAATCCAAGAAACTTTTTTTGACAGGACTGTGGAAGAATCATTCTACATTTTTCCAAGTGTTAATGGAAAACTGAAGGGAAAGTATTAATGGAAACTAAGTATTTCTCAAACGTGTATCTTAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAGTTGTTGGGAGACTAGCGTGCAGGGTGGCACCATAATGAACACATGTAGATTAAGGCATTTGTACATTAAAGCAGAGTTTACCATTACTACACATCCATTTAATACCAGGTTTATGGTAGTCTATCCAAGATGGAACTACAGATCTCAGAATC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCAGAATTTTTTTAACAAAGATGATGCTGGAAGATAATGGTAGTTCCCCCACCGTTTCTGGCACCACATAAGTACAAAATGCATTGTGTTGGCCCTCTCTGGTTGACCCAGTGCTACATTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTTGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -A-----A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T-------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------G-G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -G-------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------A-G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----C-----G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------A
                                               BLH ATG      63     132                                                                 
                                               BLH MIN      27      45                                                                 
                                               BLH OVR      63     107                                                                 
                                               EST CLI     -10      49                                                                 
                                               ORF LNG      63       5                                                                 
  5   1   2      ests                            Xl3.1-IMAGE:5154731.5                                                                          TCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAAAGAAAGAAGAAGAAGAAGAATCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAATCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCATAGCTCAGTTGATGATGTACATTTTTAAATACATCTGTGTGAGACCTAATACTGCCATACATTGCGCCCTTTTCTTTCAGTATTGCCAGGTTATCAGGCTTTACCATACAGCTTTCTTTAACTGAAAAAGATATCTGCCAGCATCTTCTCTTTTCTTAAGGTAAATCTATAAATCTTATTGATTAGCAACCTGATTTTTATTTTTTTTTAATATTGTACCCTAAAACCAAAAGAGGTACATTTCTGCTATCCACAGTGAAATTTCTTATTAACTTAAGGCAAACGGTTATTTATTTATGTATTTTTGTTTCTCTAAGTACAACTTGCTCAGTGGTGGTTTCCCATGTATTTTTGTTCACAGTGTGCCTACTTGCTCAGTGGCTTTGGTGTGCAGTGATGGAAGCCATACACAACATTTATCTCCGTAACATTGGTGTGCAGTGATGGAAGCCACACACAACCTTAATCTCAGTAATTATCTTTTTTTCTGTGCTGTTTTCCATCTTTTTTTT
                                                  Xl3.1-CHK-1012685515                                                                                TTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAAAGAAAGAAGAAGAAGAAGAATCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAATCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCATAxxxxxxTTGATGATGTACATTTTTAAATACATCTGTGTGAGACCTAATACTGCCATACATTGCGCCCTTTTCTTTCAGTATTGCCAGGTTACCAGGCTTTACCATACAGCTTTCTTTAACTGAAAAAGATATCTGCCAGCATCTTCTCTTTxCTxAAGGxxAATCTATAAATCTTATTGATTAGCAACCTGATTTTTATTTTTTTTTAATATTGTACCCTAAAACCAAAAGAGGTACATTTCTGCTATCCACAGTGAAATTTCTTATTAACTTAAGGCAAACGGTTATTTATTTATGTATTTTTGTTTCTCTAAGTACAACTTGCTCAGTGGTGGTTTCCCATxTxTxTTTGTTxxxxxxGTGCCTAxxxxxTCAGTGGxxxTxGTGTGCAGTGATGGAAGCCATACACAACATTTATCTxCxxxxCATTGGTGTGCAGTGATGGAAGCCACACACAACCTTAATCTCAGTAATTATCTTTTTTTCTGTGCTGTTTTCCATCTTTTTTTTTTTTTA
  5   1   2       bld DMZ  5g3  in                         xl260h17.5p GACACGCCGGGTAGATATGAATGGGTCGCTGAGGCAGAGCCCAAAATAATTCCTACCCGGCTAACGCTGTGCTTCCTCCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGAAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGA
  5   1   2       bld Ga12 5g3  in                         XL170d08.5p                                         TCCCCCGGGCTGNGGAATTCGGCCGAGGGTGCTTCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGAAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGAC
  5   1   2       bld Brn1 5g3  in                    IMAGE:6951255.5p                                                 TCCGGAATTCCCGGGATGCTGTGCTTCCTCCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTTGGGCCTTTCTGGAAAGCCTGGACTCAAACTTGTTGCCTGGCCTATGAAAGGAACACTTGCTTGGAAAGCCCCAGATGAAAGAGCCTCAAGGGGGAGAAAAAAATCCAAATATCCCATAATCCCTCCCTCCCCCATTCTTTCTTCCCGGTGGGGGGGAccccccccATTCAAGCCACAAGCCTTGGGAACCCCCTCATTTTAATTGGAAAATTGGAATTCTCCGAAATTCTCAAATCTCCACCGGGC
  5   1   2       bld Kid  5g                         IMAGE:7009344.5p                                                  AAAATACTGAAGTACCCGGCTAACGCTGTGATTCCTCCTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTTGTGGGCCNTTCTGGAAAGCTGGACTCAGACTTTGTGCTTTGCC
  5   1   2      seed Emb1 5g                         IMAGE:5154731.5p                                                      CCACGCGTCCGCGCTGTGCTTCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGAGAAGAATCAGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATT
  5   1   2       bld Int2 5g                         IMAGE:8821759.5p                                                       GTTGGATGGTAGGGTggggggggTCCAGGCCCTTGTTTTCGTCCCCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCTGACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGCCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAGAGCTCAGGGAGAGAATCAGATTCCATATCCTCCTTCCCCATCTTCTCCTGGTGGGGGACCCCATCAGCCAAGCTGGGACGCCATTTATTGAACTGATCCGGATTCGATCACCGTGTACCCCAAGCCACTAAGCACGAAGAAGACTCTGCGCAGGGTGTTGGAAACCCAGCCAAGTAGCTAAATGGAAGGAAGCATCTTCAGCCTTACCTGCCAAGATGTGAACTGTGGTA
  5   1   2       bld Int2 5g                         IMAGE:8821760.5p                                                           TATTTATAAATGAAGGAACGGATTTTATTTTTATTCGTCCCCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAGAGCTCATGGGAGAAGAATCAGATTCCATATCCTCCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTTATGAACTGATCCGGATTCGGATCACGTGTACACCAAGGCCACCTAAGCACAGAAGGAGACTCTGGCGCAGGTGTGTTGAGAACCAGCATAGGTAGTTCAATTGGAGAAGCAATCTTTCCAGTCCTACTGGCGAAAGAATGAACCTGTGAACT
  5   1   2       bld DMZ  5g3  in                         xl236k03.5p                                                            GTAACGCTGATGCTTCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCA
  5   1   2       bld Ga18 5g   in                      xlk150e07ex.5p                                                             GCTAACGNTNNNNNCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGNCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGANCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGNCTCAGACTTGTTGCTTNCCTATGAANGAGCACTTGCTGNNNNNNAGATGAAGA
  5   1   2       bld Ga15 5g3  in                       XL443l07ex.5p                                                                CGCTGTGCTTCCTTCTTCCTCCCTGTCCCCCGNTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGAGAAGAAATCAGATTCCATATCCTCCTCCCCATCTTCTCCTGTGG
  5   1   2       bld Emb1 5g                         IMAGE:5156020.5p                                                                 ccacgcgtccgcccacgcgtccgcccacgcgtccgcccaATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGAGAAGAATCAGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCCGCATAGTAGTTAAAAATGGGAGGAAGCANTCTTTTCAGCCCTACCTGCGGAAGATGACCCTGGACCTGTGGTGAAAAN
  5   1   2       bld FaB  5g                         IMAGE:8071699.5p                                                                 CGCTGTGCTTCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGNAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCC
  5   1   2       bld Te2N 5g                         IMAGE:7204496.5p                                                                  GCTGTGCTTCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCACGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAaaggaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTNCAGGGAGAAGAATCAGATTCCATATCCTCCCTCCCATCTTCTCCCTGTGGGACCCATCAGCCAAGCTGGACGCCATTTATGAAACTGATCGATTCCATCACGTGTACACAAAGCCACTAGCCACAGAGGAAAACTTCGTCCCCAGGTGGTTGAAAAACAGCCAATATTAAGTT
  5   1   2       bld Emb9 5g                         IMAGE:7975357.5p                                                                  GCTGTGCTTCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGATCCTGACAGTGTCTACATGGATCCTGACAGCCCTGAAACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAAACTTGTTGCTGCCTATTAATGAGCATTGCTGGTACCCAGATTAATACTCAAGGAAA
  5   1   2       bld DMZ  5g                              xl332e05.5p                                                                   GGCTAACGCTGTGATTCCTCCTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTGAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGAT
  5   1   2       bld DMZ  5g3  in                         xl296g17.5p                                                                   GGCTAACGCTGTGATTCCTCCTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTT
  5   1   2       bld Ga15 5g3  in                       XL517n10ex.5p                                                                    GCTAACGCTGTGATTCCTCCTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTGAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCAGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGG
  5   1   2       bld Ga12 5g3  in                         XL196k10.5p                                                                      GGCTTCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTA
  5   1   2       bld Ga18 5g                            xlk58g10ex.5p                                                                      CTAACNNTGTGATTCCTCCTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGNNAAAAAGCGCTGAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGNCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGNCAGGCCGGAGACCGGNTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGNCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGNAAGCCTGGNCTCAGACTTGT
  5   1   2       bld Neu7 5g3  in                         XL033p08.5p                                                                       GCTTCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGTTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGT
  5   1   2       chi Tbd7 5g3  in                         XL080l12.5p                                                                       GCACGAGGATTCCTCCTCCCTGTCTCCCAATCTGCCCCACGGNATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGG
  5   1   2       bld Tbd7 5g3  in                         XL094k12.5p                                                                       CTTCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGNATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAACGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCACGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAaaggaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCC
  5   1   2       bld Ga12 5g   in                         XL213c13.5p                                                                        CGAGGCTTCTTCCTCCCTGTCCCCCGTCTCCCATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACC
  5   1   2       chi Emb1                            IMAGE:3401214.5p                                                                          TCCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTG
  5   1   2       bld Gas2 5g                              4.1-4-C7.5p                                                                          CTTGAATTTTTCACGAGCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCGGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAAC
  5   1   2       bld Li1  5g                         IMAGE:5130110.5p                                                                           CTGTGATTCCTCCTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAAAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCG
  5   1   2       bld Ga15 5x3  in                       XL486h06ex.5p                                                                           CTGTGATTCCTCCTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAAGGCCATTAATGAACTGATCCGAT
  5   1   2       bld Ga18 5g3  in                      xlk133o20ex.5p                                                                           CCTTCTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCNGGAGGAAAAAAGCGCTTAGANNNNNNTTAAAAAAACNG
  5   1   2       bld DMZ  5g                              xl321m10.5p                                                                           CTGTGATTCCTCCTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTGAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTC
  5   1   2       bld DMZ  5g3  in                         xl291c23.5p                                                                            TGTGATTCCTCCTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGAT
  5   1   2       bld Ga18 5g                             xlk6a08ex.5p                                                                              GTGATTCCTCCTCCCTGTCTCCCAATCTGCCCCACGNATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACANAGACTCACCCACCTCACCCCGGNGNAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCNGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGNGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGNCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGNCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGNNCCAGATGTCTCCGAACCTGANAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTNAGTCTNATCTCTTGTNGGGCCTTCTGGAAAGCNTNNACTCAGNNTTGTTNCTTTGNCTATGAAGGAGCACTTGCT
  5   1   2       bld Tbd7 5g3  in                         XL105p24.5p                                                                               GCCTCCTCCCTGTCTCCCAATNCTGCCCCACGGNATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGNAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAA
  5   1   2       bld Tbd7 5g3  in                         XL090m14.5p                                                                               GTTCCTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCACGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAaaggaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAA
  5   1   2       bld Brn1 5x3                        IMAGE:6954077.5p                                                                               ATTCCTCCTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCGTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTTCATATCCTCCTCCCCATCTTCTCCTGTGGGGGACCCCATCCGCCCAAACCTGGAGGCCCTTTAATGAACCTTGATCCCATTTCGAATCCCGTTGTAACACCAAAGCCCCCC
  5   1   2       bld Neu7      in                         XL018f02.5p                                                                                CCCTGTNCCCCCGTNCTCCCAATNCTACCCCACAGNATACCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGTTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGAGAAGAATCAGA
  5   1   2       bld Int2 5x                         IMAGE:8528359.5p                                                                                 cttcaccctgtcccccgtctcccaatctaccccacagatcccctgcaccccTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACCGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaaggaagaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTTGCTATGAAGGAGCACTTGCTGGAGCCCAGATGAGAGCTCAGGGGAGAGATCAGATTCATATCCTCTCCCATCTCTCTGTGGGACCCTCAGCCAGCGGAGCATTATGACTGTCGATCATCCTGTACCCAGCACTACACAAGAGATCTCCAGGTGCAGCCCTATATTATAGAGACTT
  5   1   2       bld Neu7 5g3  in                         XL046j05.5p                                                                                  CTCCCTGTCCCCCGTCTCCCAATCTACCCCACAGNATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACAC
  5   1   2       bld Ga12 5g                              XL145a03.5p                                                                                  GCTCCTCCCTGTCTCCCAATCTGCCCCACGGNATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAG
  5   1   2       bld Neu7 5g                              XL030o05.5p                                                                                     CCTGTCCCCCGTCTCCCAATCTACCCCACAGNATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGTTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGTCTGATCTCTTGTTGGGCCTTCTGGAA
  5   1   2       bld Neu7 5g3  in                         XL012c18.5p                                                                                     GCTGTCCCCCGTCTCCCAATNCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCTACCTTAGCTCGGAGGaaaaagcgcttagaagaaaattaaaaaacagagtagcagcacagactgctcgggacagaaaaaaaaGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAAAGAAAGAAGA
  5   1   2       bld Emb1 5g                         IMAGE:6637380.5p                                                                                     TCCTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGTCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGGAAGACTCTGCGGCAAAGTGTTGAGACCAGTATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGTGATGATGGCCTGACCTGTGTTGAAACAGGAACCACAAGAAGATGGCCTAGTCCCCATCCTCGGGAATGCAAAGCCTTTTTGCCCCTGGTTCTGGAAAACAACCCTTGGAAAA
  5   1   2       bld Ga12 5g3  in                         XL204f12.5p                                                                                      CCTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAAT
  5   1   2       bld DMZ  5g3  in                         xl316d18.5p                                                                                      CTCCCTGGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGC
  5   1   2       bld DMZ  5g3  in                         xl258m04.5p                                                                                      CTCCCTGGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAA
  5   1   2       bld Emb3 5g3  in                    IMAGE:3400292.5p                                                                                       CTGTCCCCCGTCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTG
  5   1   2       bld DMZ  5g3  in                         xl282i09.5p                                                                                       CTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGA
  5   1   2       bld Ga15 5g3  in                       XL479d20ex.5p                                                                                        TCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTGAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCAGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAG
  5   1   2       bld Gas5      in                    IMAGE:3750013.5p                                                                                           GGAATTCCTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGC
  5   1   2       bld Em10 5g                         IMAGE:7978992.5p                                                                                            TCCCAATCTGCCCCACGGATTCCCGTGCACCCCTGTGGAAATGGTGGTCGTGGGAGCCCGCAAAGTGATCTTTATGTCCGGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCGTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATGAAAAAACAGAGGAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTTTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGGAAGCCAGATGAAGAGATCAAGGGAGA
  5   1   2       bld DMZ  5g                              xl299c17.5p                                                                                             GTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTGAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAG
  5   1   2       bld Sp1  5g                         IMAGE:5511180.5p                                                                                                 CCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTGAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGANAGCCTGGACTCAGACTTGTTGCTTTGCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCANGGGAGACGAATCTGATTCCATATCCTNCCTCCCATCTCTCTGTGGGGACCCATCAGCAGCTGGGAGCATTATG
  5   1   2       bld Ga18 5g3  in                      xlk126d11ex.5p                                                                                                 TCTCCCAATCTACCCCACAGATCCCCTGCACCACTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCACGGCTTGTTGACTGAAAACCAGGAGCTACGNCAAAGATTGGGCCTTAGCACCCTGGAGTTAaaggaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGANCGGGNTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGNCTCAGACTTGTTNCTTNNCTATGAAGGAGCACTTGCTNGNAANNCCAGATGAAGAGNTCAAGGGAGA
  5   1   2       bld DMZ  5g   in                         xl231h02.5p                                                                                                 CCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTGAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAG
  5   1   2       bld DMZ  5g3  in                         xl291d08.5p                                                                                                  CTCCCAATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGAT
  5   1   2       bld DMZ  5g                              xl301j14.5p                                                                                                    ATCTGCCCCACGGTATTCNCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTGAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACT
  5   1   2       bld Li1  5g                         IMAGE:3398111.5p                                                                                                       AATCTACCCCACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGAAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCACGGCTTGTTGACTGAAAACCANGAGCTACGCCAAAGATTGGGCCTTANCACCCTGGAGTTAAAGGAA
  5   1   2       bld DMZ  5g3  in                         xl319p19.5p                                                                                                               CACAGAATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGC
  5   1   2       bld DMZ  5g                              xl289n02.5p                                                                                                               CGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTGAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGA
  5   1   2       bld Em10 5g                         IMAGE:8318700.5p                                                                                                                CACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAAGCCAGATGAAGAGCTCAAGGTAGAAGAATCAGATTC
  5   1   2       bld DMZ  5g3  in                         xl322l19.5p                                                                                                                CACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCT
  5   1   2       bld DMZ  5g3  in                         xl268c17.5p                                                                                                                CACAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGAGA
  5   1   2       bld Neu7 5g3  in                         XL014b17.5p                                                                                                                 GCAGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCA
  5   1   2       bld Ga12 5g   in                         XL193l04.5p                                                                                                                   AGATCCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTANAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCT
  5   1   2       bld Neu7 5g                              XL009c06.5p                                                                                                                       CCCCTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAG
  5   1   2       bld DMZ  5g3  in                         xl307h12.5p                                                                                                                          CTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAA
  5   1   2       bld DMZ  5g3  in                         xl322m21.5p                                                                                                                          CTGCACCCCTTCATNTTGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGA
  5   1   2       bld DMZ  5g3  in                         xl225d06.5p                                                                                                                          CTGCACCCCTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGA
  5   1   2       bld Emb4 5g                         IMAGE:4970823.5p                                                                                                                              ACCCCTTGGAAATGGTGGTCGTGGGAGTCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCATCAGCCAGCTGGGAGCATTATGACTGATCGATCGATCCTGTACACAGCACTAGCACA
  5   1   2       bld DMZ  5g3  in                         xl329g12.5p                                                                                                                                  CTTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTANCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGAGAAGAATCAGATTCCATATCCTCCTCCCCATCTTCTCCTGT
  3   1   2       bld Gas5      in                    IMAGE:3750013.3p                                                                                                                                   TTCAACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCTGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGATTAGAAA
  5   1   2       bld DMZ       in                         xl329k15.5p                                                                                                                                                   GAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTC
  5   1   2       chi Egg6      in                    IMAGE:4412674.5p                                                                                                                                                                                                           TCCTATTGCACACCCTGGAGCAGGCGGGGCAGGGCCAGACCCCAACGAGATTGATCTTCCCCCCAATGAGAGACAGAAACTCACCCACCTGACATCCGTAAAGAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCACAACAGACTGCACGGGCACAGGGAAAAAAGCCAAAACGGATGAACTTGAACAGCAAGGGATAGATTCAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCACTATCTTAAGAGACAAATCTGACGGCTTGGTGGATGAAAACCAGGAGCTACTCCAAAGATTGGGCCTTAGCACCCTG
  5   1   2       bld DMZ                                  xl280d24.5p                                                                                                                                                                                                                                                                      GCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaagaagaagaagaagGATAAAAATGAGGAGGAGCGGGGGAAGAAGGAGAGAATGGTGAATCTGACACTGGAGATGATCTATCTGCTGACTGGAGAGCACTACATCCCTAGGAAGAAGTCAGATGATGGGGGGGCCCTGCATGCCCCTGGCTCCGTCATACAGAAGGAAAATAACAAGAATGACAAGAAGATCCTGGAACTCATGTCCAACATCATCCAGCTGCTGACTGGAGAGGTTGCCATAAGGACTCATCATGTTTCCATCTATTTTTCCTTGGACGAGTGGGACTATATAAAAGGAAACAAGGACCTTTATGAGGAAGGGATAAAGGAGGAGCCCCAGCAATTCAGCCCACTGGACTGTGAATATGAAGATATGAGCGATATTACAGCTGATCTGGGAGGAACATTATATTATAATAATGAGCC
  5   1   2       bld Spl                             IMAGE:8460501.5p                                                                                                                                                                                                                                                                                         CAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGAGAAGAATCAGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACTGTGTGAACAGGACCACAGAAGATGACTAGTCCCATCCTCGATGCAAGCTTTTGCCTGTCTGAACACCTGAAATCTCTACATATGATCAGAGTGCTCG
  5   1   2       chi Panc                            IMAGE:8735260.5p                                                                                                                                                                                                                                                                                                     CTCACCCCGGAGGAAAAAGCGCTGAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCAGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGGATGTTCCTCCGAACCTGACCGTGGTCTTACATTGGATCCCTGAACAGCCCTGACACATTTCAGAACTCTGAATTCTGATTTTCTTGGTTGGGGCCCTTCTGGGAAAACCTGGGAACTCAACCTTTTTGCTTGGCTTTTAGAAGGGCGCCTTTCCGGGAGACCCCAAATTTAAAAAATCTAGGGGAAAACAAACCCAAATCCCAAACCCCTCTCAATTTTTTTggggggggCACCCCCTCCCCCACGCGTGTGAGGCCTTTATAGAGAGGGGTTCCCATTTGATTACGTGGTTCCCCAGCGCCCAAACACACAAGGGAAAAACTCTCTGCCCCAATGTGTGTACACCTCTTATTTTATATAGGGAGAGAGCCTTCTTTCGTCAATTGTGATAGTAGCGCCCACCGTGTGTGACGCAGCGCCACACGAGAGGTCGCTTCTCTCTCCAGAGAGAGACGGTTGCTCGCGCTGGGAGACACCTAGAGATAATAATTAGTAAG
  5   1   2       bld Panc                            IMAGE:8736607.5p                                                                                                                                                                                                                                                                                                                  AAAAAGCGCTGAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCACGGGACAGGAAAAAAGCCAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCAGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAAGTGTTGAGACCAGTATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGTGATGATGGCCTGACCTGTGTGAAACAGACCACAGAGATGGCCTAGTCCCATCTCGGATGCAAGCTTTTGCCTGTTCTGAAACCACTGAAATCAATTTATTGATCAGACTGACTCTGCTATGAAGTAACTCCTCACCTTATGGAC
  5   1   2       bld Ga15      in                       XL459h22ex.5p                                                                                                                                                                                                                                                                                                                                         GCTAACGCTGTGATTCCTCCTCCCTGTCTCCCAATCTGCCCCACGGATTCCCTGCACCCCTTGGAAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGCGAGCAGGCCGACGCCTTGGGATCCCTAATGTTACCCGTAAGCAGCCCGGGCAGTCCAGAGTCGGCCAGCAATGAGCAGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAAAAAGCGCTGAGAAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAAGTGTTGAGACCAGTATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGTGATGATGGCCTGACCTGTGTGAAACAGGAA
  5   1   2       bld DMZ       in                         xl240n07.5p                                                                                                                                                                                                                                                                                                                                                             GACTGCACGGGACAGGAAAAAAGCNAAAATGGGTGAACTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAANCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACCTTGNCCCTCTGCAGCAGG
  5   1   2       bld Em10                            IMAGE:8322269.5p                                                                                                                                                                                                                                                                                                                                                                                                GTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGAGAAGAATCAGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCCATCCTCGGAATG
  5   1   2       bld Neu7      in                         XL006o19.5p                                                                                                                                                                                                                                                                                                                                                                                                 GCTTGAACAGCAAGTGATAGATTTAGAAATTGAGAATGAGAAACTTTTGCTCGAAAACCAGATCTTAAGAGACAAATCTCACGGCTTGTTGGCTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCC
  5   1   2       bld Panc                            IMAGE:8738172.5p                                                                                                                                                                                                                                                                                                                                                                                                     CTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGAGAAGAATCAGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGCTATGTGGTGTTCTTCACCCTTCGTGACCTGTCCTCTCTCTACTCTGACGGGTTTGGAGACTCGTTCAGTACGAACTTTCCCCCAGCTTCTTCCTCAGTGCCCAATATTGGACCA
  5   1   2       bld Tbd7      in                         XL065g02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACAATCTACGGCTTGTTGGCTGAAAACNGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGAAAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAAGTGTTGAGACCAGTATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGTGATGATG
  5   1   2       bld Ga15      in                       XL411b05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCTAAGCACCCTGGCAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCANACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGAGAAGAATCAGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCANTGCCCATATGGACCAATCCATTTGTCCTTCA
  5   1   2       bld Ga15      in                       XL410b05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCTAAGCACCCTGGAGTTAaagaaagaagaagaagaagaaTCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGAGAAGAATCAGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAA
  5   1   2       bld Ga18                              xlk163i19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAAGAatcatcatcatcatcaCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGNNNNNNAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGNCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAAGTGTTGAGACCAGTATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGTGATGATGGCCTGANCTGTGTGAANNAGGAACCACAAGAAGATGGCCTAGTCCCCATCCTCGGAATGCANNNNNTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCAAATATATTGGATACAGGAAGTGACTCTGGCTATGAAGGTAGCTCTTCACCCTTTAGTGACCTGTCCTCTCCTCTGAACTCTGANCNGGTTTGGGAAGATTCATTCAGTACTGAACTTTTTCCTCAGCTTCTCCTCAGTGCCCATATGGACCAGTCCATCTGTCCCTCATCTNC
  3   1   2       bld Ga12 5g3  in                         XL204f12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGAATCAGTCCAGAAAAGATAAAGTCAGNCCGGAGACCGGGTCAGCTGAGTCCGCAGCACTCAGACTACGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTNTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAAGTGTTGAGACCAGTATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGTGATGATGGCCTGACCTGTGTGAAACAGGAACCACAAGAAGATGGCCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCAAATATATTGGATACAGGAAGTGACTCTGGCTATGAAGGTAGCTCTTCACCCTTTAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGATTCATTCAGTACTGAACTTTTTCCTCAGCTTCTCCTCAGTGCCCATATGGACCAGTCCATCTGTCCCTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGATTTTGATGATGTACAT
  3   1   2       bld DMZ  5g3  in                         xl322l19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTCAGGCCGGAGACNGGNTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGAGAAGAATCAGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAATCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCATAGCTCAGAGTT
  5   1   2       bld Emb4                            IMAGE:4959419.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGttttttttCGAGACGATCACGCGTACACCAAGC
  3   1   2       bld Ga12 5g3  in                         XL196k10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTCAGACTTGTTGCTNGCCTATGAAGGAGCACTTGCTGGAAGCCCAGANGAAGAGCTCAAGGGAGAAGAATCAGATTCCATATCCTCCTCCCCATNTTNTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCATCTAACATATNGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTGCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAATCCATTTGTACTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCATAGCTCAGAGTTTGATGTACATTTTAAATACATC
  5   1   2       bld Ga15                               XL436m01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCAGACTTGTTGCTTGCCTATGAAGGAGCACCTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAAGTGTTGAGACCAGTATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGTGATGATGGCCTGACCTGTGTGAAACAGGAACCACAAGAAGATGGCCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCAAATATATTGGATACAGGAAGTGACTCTGGCTATGAAGGTAGCTCTTCACCCTTTAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGATTCATTCAGTACTGAACTTTTTCCTCAGCTTCTCCTCAGTGCCCATATGGACCAGTCCATCTGTCCCTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGATTTTGATGATGTACATTTTTAAATACATCTGTGTGAGACCTAATACTGCCATACATTGCGCCCTTTTCTTTCAGTATTGCCAGGTTACCAGGCTTTACCAAACAGCTTTCTTTANCTGAAACCGATATCTGCCAGCATCTTCTCTTTGCTAAAGGGGTAATCTATANATCTTATTGATTANCAACCTGAtttttattttttttt
  5   1   2       bld DMZ                                  xl310b13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAAGTGTTGAGACCAGTATAGTAGTT
  3   1   2       bld DMZ       in                         xl240n07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGCCCAGATGAAGAGATCAAGGGAGACGAATCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAAGTGTTGAGACCAGTATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGTGATGATGGCCTGACCTGTGTGAAACAGGAACCACAAGAAGATGGCCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCAAATATATTGGATACAGGAAGTGACTCTGGCTATGAAGGTAGCTCTTCACCCTTTAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGATTCATTCAGTACTGAACTTTTTCCTCGAGCTTCTCCTCGAGTG
  5   1   2       bld Tbd7      in                         XL074b17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCNGATGAAGAGCTAAGGGAGAAGAATAGATTCCTATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAATCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCATAGCTCAGAGTTTGATGTACATTTTTAAATACATCTGTGATAAATCTAATACTGCCGTGCATTGCACCCTTTTCTTTCAGTATTGCCAAGTTATCAGGCTTTACCATACAGCTTTCTTTAACTGAAAAAGAT
  5   1   2       bld Ga12      in                         XL215n10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAATCCATTTGTACTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCATAGCTCAGAGTTTGATGTACATTTTTAAATACATCTGTGATAAATCTAATACTGCCGTGCATTGCACCCTTTTCTTTCAGTATTGCCAGGTTATCAGGCTTTACCATACAGCTTTCTTTAACTGAAAAAGATATCTGCCAATGTCTTATCTTTTCTT
  3   1   2       bld Ga12 5g3  in                         XL170d08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TNTCCTGTGGGGACCCCATCAGCCAAGCTGGACGCCATTAATGAANTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGCGCAAGGTGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGCGAAGATGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAATCCATTTGTACTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCATAGCTCAGAGTTTGATGTACATTTTTAAATACATCTGTGATAAATCTAATACTGCCGTGCATTGCACCCTTTTCTTTCAGTATTGCCAGGTTATCAGGCTTTACCATACAGCTTTCTTTAACTGAAAAAGATATCTGCCAATGTCTTATCTTTTCTTAAGGTAAAATTGTTCTGTGATTCAGGAAGGGTCAGCTTAGAGCACAATA
  5   1   2       bld Emb3      in                    IMAGE:3400208.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAGACTCTGGCAAAGTGTTGAGACCAGTATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACCTGTGATGATGGCCTGACCTGTGTGAAACAGGAACCACAAGAAGATGGCCTANTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTAAAAAATCAAATATATT
  5   1   2       bld Tbd7                                 XL084m02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCATCTTTAGCCCTACCTGTGATGATGGCCTGACCTGTGTGAAACAGGAACCACAAGAAGATGGCCTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCAAATATATTGGATACAGGAAGTGACTCTGGCTATGAAGGTAGCTCTTCACCCTTTAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGATTCATTCAGTACTGAACTTTTTCCTCAGCTTCTCCTCAGTGCCCATATGGACCAGTCCATCTGTCCCTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGATTTTGATGATGTACATTTTTAAATACATCTGTGTGAGACCTAATACTGCCATACATTGCGCCCTTTTCTTTCAGTATTGCCAGGTTACCAGGCTTTACCAAACAGCTTTCTTTAGCTGAAACCGATATCTGCCAGCATCTTCTCTTTTCTAAAGGGTAATCTATAAATCTTATTGATTAGCAACCTGAttttttttttttA
  5   1   2       bld Panc                            IMAGE:8738947.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAGTCCCCATCCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAATCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCATAGCTCAGAGTTTGATGTACATTTTTAAATACATCTGTGATAAATCTAATACTGCCGTGCATTGCACCCTTTTCTTTCAGTATTGCCAGGTTATCAGGCTTTACCATACAGCTTTCTTTAACTGAAAAAGATATCTGCCAACGTCTTATCTTTTCTTAAGGTAAAATTGTTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATATAAATCTTATTGATTGGAAACCTGtttttattttttttACTGTTGTACCCCAAAAGCACAAGAGGTACATTTCTTCAATCCAATGGTGAAATTTCTTATTTCGATAAGAAGCAAGGCAAACGgttatttatttatttatgtatttttgtttttCTAAGTACAACTTGCTCAGTGGTAGTTTCCCTTCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCATTGGTGTGCAGTGATGGAAGCCACACACAACCTTAATCTCAGTAATTATCTTTTTTCTGTGCTGTTTTCCATCtttttttttttttagaaaaaaaaaCAAATCTAGGTCATGATGCTGTCACAAAGTATTATACAGTCTATGAAAGATTCATGCTCATTAACCCAAACAAAGGATTCATTCCACCGGC
  5   1   2       bld Tail                            IMAGE:8545534.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAANNCCATTTGATNNGNGANGAGTACTAATAATATTCGNCCNNCAACCTTGAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGCTCTTCACCCTTCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAATCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCATAGCTCAGAGTTTGATGTACATTTTTAAATACATCTGTGATAAATCTAATACTGCCGTGCATTGCACCCTTTTCTTTCAGTGTTGCCAGGTTATCAGGCTTTACCATACAGCTTTCTTTAACTGAAAAAGATATCTGCCAACGTCTTATCTTTTCTTAAGGTAAAATTGTTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATATAAATCTTATTGATTGGAAACCTGtttttatttttttttttttACTGTTGTACCCCAAAAGCACAAGAGGTACATTTCTTCAATCCAATGGTGAAATTTCTTATTTCGATAAGAAGCAAGGCAAACGgttatttatttatttatttatgtatttttgtttttCTAAATACAACTTGCTCAGTGGTAGTTTCCCTTCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCATTGGTGTGCAGTGATGGAAGCCACACACAACCTTTATCTCAGTAATTATCTT
  5   1   2       bld Egg1                               PBX0157B01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTCGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCAAATATATTGGATACAGGAAGTGACTCTGGCTATGAAGGTAGCTCTTCACCCTTTAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGATTCATTCAGTACTGAACTTTTTCCTCAGCTTCTCCTCAGTGCCCATATGGACCAGTCCATCTGTCCCTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGATTTTGATGATGTACATTTTTAAATACATCTGTGTGAGACCTAATACTGCCATACATTGCGCCCTTTTCTTTCAGTATTGCCAGGTTACCAGGCTTTACCAAACAGCTTTCTTTAGCTGAAACCGATATCTGCCAGCATCTTCTCTTTGCTAAAGGGTAATCTATAAATCTTATTGATTAGCAACCTGAtttttattttttttttAATATT
  5   1   2       bld Egg5      in                    IMAGE:3431766.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGAATGCAAAGCTTTTTGCCCTGTTCTGAAAACAACCTTGAAAAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTCAGTGACCTGTCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAATCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCATAGCTCAGAGTTTGATGTACATTNTTAAATACATCTGTGATAAATCTAATACTGCCGTGCATTGCACCCTTTTCTTTCAGTATTGCCAGGTTATCAGGCTNTACCATACAGCTNTCTTTAACTGAAAAAGATATCTGCCAACGTCTTATCTTT
  5   1   2       bld Tad2                            IMAGE:6932308.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAATCATCTAACATATTGGATACAGGAAGTGACTCTGGCTATGAAGGGTGTTCTTCACCCTTCAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGACTCGTTCAGTACCGAACTTTTCCCCCAGCTTCTCCTCAGTGCCCATATGGACCAATCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCATAGCTCAGAGTTTGATGTACATTTTTAAATACATCTGTGATAAATCTAATACTGCCGTGCATTGCACCCTTTTCTTTCAGTATTGCCAAGTCATCAGGCTTTACCATACAGCTTTCTTTAACTGAAAAAGATATCTGCCAACGTCTTATCTTTTCTTAAGGTAAAATTGTTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATATAAATCTTATTGATTGGAAACCTGtttttattttttttACTGTTGTACCCCAAAAGCACAAGAGGTACATTTCTTCAATCCAATGGTGAAATTTCTTATTTCGATAAGAAGCAAGGCAAACGgttatttatttatttatgtatttttgtttttCTAAGTACAACTTGCTCAGTGGTAGTTTCCCTTCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCATTGGTGTGCAGTGATGGAAGCCACACACACCCTAATCTCAGTAATTATCtttttttttctgtgctggttttccatctttttttttttttttaagaaaaaaaaacaaaaTCTAGGGTCATTGGATGCCTGTCCCAAAGTATTATACCCGTTCTAATGAAAGAATTCAATGCCTCATTAAACCCCCAAAACAAA
  5   1   2       bld Emb1                            IMAGE:5157063.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGTGACTCTGGCTATGAAGGTAGCTCTTCACCCTTTAGTGACCTGTCCTCTCCTCTGAACTCTGACCGGGTTTGGGAAGATTCATTCAGTACTGAACTTTTTCCTCAGCTTCTCCTCAGTGCCCATATGGACCAGTCCATCTGTCCCTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGATTTTGATGATGTACATTTTTAAATACATCTGTGTGAGACCTAATACTGCCATACATTGCGCCCTTTTCTTTCAGTATTGCCAGGTTACCAGGCTTTACCAAACAGCTTTCTTTAGCTGAAACCGATATCTGCCAGCATCTTCTCTTTGCTAAAGGGTAATCTATAAATCTTATTGATTAGCAACCTGAtttttatttttttttAATATTGTACCCTAAAACCAAAAGAGGTACATTTCTGCTATCCACAGTGAAATTTCTTATTAACTTAAGGCAAACGGTTATTTATTTATGTATTTTTGTTTCTCTAAGTACAACTTGCTCAGTGGTGGTTTCCCATCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCATACACAACATTTATCTCCGTAATTAttttttttttATATACAAGAAAAACAAATCTATGTCTATGTATTGATGCTGTCACATAGTCTATACAGGTCTGTATGAAAGATTCCGTTCTCCTTAAGCCCCAAACAAAAGGTTTTCATTTCCCCAGCTTAAACTTTGTTTTTCCACTTCTTAGAAAAATCATTTTACAGGGGTATTTTCCCACTGGAAAAATCCCAAAGAAAACtttttttttCGGACAGGGAACTCGGTGGAAAGAAATCCATTTCCAACACTCTTTTTCCCACAGGGGTTCAAAGTGGGGAAAAAACCC
  5   1   2       bld Ga15                               XL412j04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCGGGTTTGGGAAGATTCATTCAGTACTGAACTTTTTCCTCAGCTTCTCCTCAGTGCCCATATGGACCAGTCCATCTGTCCCTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGATTTTGATGATGTACATTTTTAAATACATCTGTGTGAGACCTAATACTGCCATACATTGCGCCCTTTTCTTTCAGTATTGCCAGGTTACCAGGCTTTACCAAACAGCTTTCTTTAGCTGAAACCGATATCTGCCAGCATCTTCTCTTTGCTAAAGGGTAATCTATAAATCTTATTGATTAGCAACCTGAtttttatttttttttAATATTGTACCCTAAAACCAAAAGAGGTACATTTCTGCTATCCACAGTGAAATTTCTTATTAACTTAAGGCAAACGGTTATTTATTTATGTATTTTTGTTTCTCTAAGTACAACTTGCTCAGTGGTGGTTTCCCATCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACCGCTTTGGTGTGCAGTGATGGAAGCCATACACAACATTTATCTCCGTAATTAttttttttttATATAGAANAAAAACAAATCTATGTCTATGNATTGANGCNGTC
  5   1   2       bld Ga15                               XL414j21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCGGGTTTGGGAAGATTCATTCAGTACTGAACTTTTTCCTCAGCTTCTCCTCAGTGCCCATATGGACCAGTCCATCTGTCCCTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGATTTTGATGATGTACATTTTTAAATACATCTGTGTGAGACCTAATACTGCCATACATTGCGCCCTTTTCTTTCAGTATTGCCAGGTTACCAGGCTTTACCAAACAGCTTTCTTTAGCTGAAACCGATATCTGCCAGCATCTTCTCTTTGCTAAAGGGTAATCTATAAATCTTATTGATTAGCAACCTGAtttttatttttttttAATATTGTACCCTAAAACCAAAAGAGGTACATTTCTGCTATCCACAGTGAAATTTCTTATTAACTTAAGGCAAACGGTTATTTATTTATGTATTTTTGTTTCTCTAAGTACAACTTGCTCAGTGGTGGTTTCCCATCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACCGCTTTGGTGTGCAGTGATGGAAGCCATACACAACATTTATCTCCGTAATTAttttttttttatatanaaaaaaaaCAAATCTATGNCNATGNATNGANGCNGNCNCATAGNCNATACNGGNCNGNATGAAANATTCCGTTCNCA
  5   1   2       bld Tad2                            IMAGE:6876638.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGTTTCTTTCTGGAGTCACAGCTCAGATTTTGATGATGTACATTTTTAAATACATCTGTGTGAGACCTAATACTGCCATACATTGCGCCCTTTTCTTTCAGTATTGCCAGGTTACCAGGCTTTACCAAACAGCTTTCTTTAGCTGAAACCGATATCTGCCAGCATCTTCTCTTTGCTAAAGGGTAATCTATAAATCTTATTGATTAGCAACCTGAtttttatttttttttAATATTGTACCCTAAAACCAAAAGAGGTACATTTCTGCTATCCACAGTGAAATTTCTTATTAACTTAAGGCAAACGGTTATTTATTTATGTATTTTTGTTTCTCTAAGTACAACTTGCTCAGTGGTGGTTTCCCATCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCATACACAACATTTATCTCCGTAATTAttttttttttATATAGAAGAAAAACAAATCTATGTCTATGTATTGATGCTGTCACATAGTCTATACAGGTCTGTATGAAAGATTCCGTTCTCATTAAGCCCCAAACAAAAGGTTTCATTCCACAGCTTAAACTTGTTTTCCATTCTTAGAACATCATTTACAGGTTATTTTCACTGAAAATCCAAGAAACTTTTTTTGACAGGACTGTGGGAAGAATCATTCTACATTTTTCCAAGTGTTAATGGGAAACCTGAAGGGAAAGATTTAATGGAAAACTAAGTAATTTCTTCAAACATGTAAGCTTAC
  5   1   2       bld Spl       in                    IMAGE:8463736.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GANCATCGATAGNATTCGTCCCCGAGTTTGATGTACATTTTTAAATACATCTGTGATAAATCTAATACTGCCGTGCATTGCACCNCTTTTCTTTCAGTATTGCCAAGTTATCAGGCTTTACCATACAGCTTTCTTTAACTGAAAAAGATATCTGCCAACGTCTTATCTTTTCTTAAGGTAAAATTGTTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATATAAATCTTATTGATTGGAAACCTGtttttattttttttACTGTTGTACCCCAAAAGCACAAGAGGTACATTTCTTCAATCCAATGGTGAAATTTCTTATTTCGATAAGAAGCAAGGCAAACGgttatttatttatttatgtatttttgtttttCTAAGTACAACTTGCTCAGTGGTAGTTTCCCTTCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCATTGGTGTGCAGTGATGGAAGCCACACACAACCTTAATCTCAGTAATTATCTTTTTTTCTGTGCTGTTTTCCATCtttttttttttttaagaaaaaaaaaCAAATCTAGGTCATTGATGCTGTCACAAAGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGTCCGTGGGAGAAAGAATATGTGG
  5   1   2       bld Tad2      in                    IMAGE:6874226.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGTACATTTTTAAATACATCTGTGTGAGACCTAATACTGCCATACATTGCGCCCTTTTCTTTCAGTATTGCCAGGTTACCAGGCTTTACCAAACAGCTTTCTTTAGCTGAAACCGATATCTGCCAGCATCTTCTCTTTGCTAAAGGGTAATCTATAAATCTTATTGATTAGCAACCTGAtttttatttttttttAATATTGTACCCTAAAACCAAAAGAGGTACATTTCTGCTATCCACAGTGAAATTTCTTATTAACTTAAGGCAAACGGTTATTTATTTATGTATTTTTGTTTCTCTAAGTACAACTTGCTCAGTGGTGGTTTCCCATCTGTAATTAGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCATACACAACATTTATCTCCGTAATTATTCtttttttttATATAGAAGAAAACCAAATCTATGTCTATGTATTGATGCTGTCACATAGTCTATACAGGTCTGTATGAAAGATTCCGTTCTCATTAAGCCCCAAACAAAAGGTTTCATTCCACAGCTTAAACTTGTTTTCCATTCTTAGAACATCATTTACAGGTTATTTCCACTGAAAATCCAAAAAACttttttttGACAGGACTGTGGGAAAAATCATTCTACATTTTTCCAAGTGTTAATGGAAAACTGAAGGGGAAAGTATTAATGGGAAACTAAGTATTTCTCAAACATGTAGCCTTACAAAGTTGGTTGG
  5   1   2       chi Tad1                            IMAGE:6940009.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTATCAGGCTTTACCATACAGCTTTCTTTAACTGAAAAAGATATCTGCCAACGTCTTATCTTTTCTTAAGGTAAAATTGTTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATATAAATCTTATTGATTGGAAACCTGtttttattttttttACTGTTGTACCCCAAAAGCACAAGAGGTACATTTCTTCAATCCAATGGTGAAATTTCTTATTTCGATAAGAAGCAAGGCAAACGgttatttatttatttatgtatttttgtttttCTAAGTACAACTTGCTCAGTGGTAGTTTCCCTTCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCATTGGTGTGCAGTGATGGGAGCCACACACAACCTTAATCTCAGTAATTATCtttttttctgtgctgttttccatcttttttttttttaagaaaaaaaaaCAAATCTAGGTCATTGATGCTGTCACAAAGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCCGTGGGAGAAAGATTATGTGGGGAGAAAGATTCTACATTTTTGCCCAAGTGGTTGGTGGGAAATGAAAACCTGAAGGGGGAAAAGTATTAATTGGGGAATGGAAGGTATTTTCTCCATACATTGGTACCCTTGGCAAAAAATTGGTTTAGGA
  5   1   2       bld Lu1       in                    IMAGE:4674092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACCGATATCTGCCAGCATCTTCTCTTTTCTAAAGGGTAATCTATAAATCTTATTGATTAGCAACCTGAttttttttttttttAATATTGTACCCCAAAACCAAAAGAGGTACATTTCTGCTATCCACAGTGAAATTTCTTATTAACTTAAGGCAAACGGTTATTTATTTATGTATTTTTGTTTCTCTAAGTACAACTTGCTCAGTGGTGGTTTCCCATCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCATACACAACATTTATCTCCGTAATTATTTTTGTACGGTTTTCCATCAAAATAttttttttttttATAGAAGAAAAACAAATCTATGTCTATGTATTGATGCTGTCACATAGTCTATACAGGTCTGTATGAAAGATTCCGTTCTCATTAAGCCCCAAACAAAGGTTTCATTCCACAGCTTAAACTTGTTTTCCATTCTTATAACATCATTTACAGGTTATTTCCACTGAAAATCCAA
  5   1   2       bld Tbd7      in                         XL068h17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGTACCCCAAAAGCACAAGAGGTACATTTCTTCAATCCAATGGTGAAATTTCTTATTTCGATAAGAAGCAAGGCAAACGgttatttatttatttatgtatttttgtttttCTAAGTACAACTTGCTCAGTGGTAGTTTCCCTTCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCATTGGTGTGCAGTGATGGAAGCCACACACAACCTTAATCTCAGTAATTATCTTTTTTTCTGTGCTGTTTTCCATCtttttttttttttaaaaaaaaaaCAAAT
  5   1   2       bld Ga15                               XL460k06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTATGTATTTTTGTTTTTCTAAGTACAACTTGCTCAGTGGTAGTTTCCCTTCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCATTGGTGTGCAGTGATGGAAGCCACACACAACCTTAATCTCAGTAATTATCTTTTTTTCTGTGCTGTTTTCCATCttttttttttttttaaaaaaaaaa
  5   1   2      ests                               Xl3.1-XL411b05ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGTCATTGATGCTGTCACAAAGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAACATC
                                                  Xl3.1-CHK-1012686523                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGATGCTGTCACAAAGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAACATCCTTGTG
  3   1   2       bld Brn1 5g3  in                    IMAGE:6951255.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGGAAAGCCCACCCCCCCACCCTTTAATCTCCAGGTAATTTATCCTTTTTTTCGGGGGCCTTTTTCCATCTTTTTTTTTTTTTTAAGAAAAAAAAACAAAATTTAGGTCATTGATGCTGTCACAAAGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGTCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTGC
  3   1   2       bld Spl       in                    IMAGE:8463736.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATGTTGCAGATGAGCACCCACCTAATTCAGTATATCTTTTCTGGCTGTTCCATCTTTTTTTTTAGAAAAAAAACAATCTAGTCATGATGCGTCACAAGTTATACCAGTCTTGAAAGATCATNGCTCATTACCCCAACANNAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGTCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATCTCTATCTCCATCAACTTAGACAGCAACGACACCCGATCTCGTTTT
  3   1   2       bld Ga18 5g3  in                      xlk126d11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATNTTTTTTTTTTTTTTnnnGAAAAAAAAAACAAATCTAGGTCANNANGCNGNCACAAAGTATATNCCAGTCTATGAAAGATTCNNNNNTCATTANCCCCCAAACAAAGGNTTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATNATTNATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTCGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCACAGGGGGAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCNCCATTTTTATTTTAGAAGTTAAGAAANNNNNNCNCCATTTAAT
  3   1   2       bld Ga15      in                       XL410b05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTNTTNTTTTTNAAGGAAAAAAAAACAAATNTAGGTCATTGATGCTGTCACAAAGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATCATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATT
  3   1   2       bld DMZ  5g3  in                         xl225d06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTTTTTTTTAGAAAAAAAANCAATCTAGGTCATTGATGCTGTCACAAAGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGTCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTTATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTANCTGTGTAAATGAGATGATTANATATATTTCCACCATTTTTATTTTAGAGGNTAAGAAATTTGCTTTCTCCANTTNATATTA
  5  -1   2       bld Sp1                             IMAGE:5507022.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             NTGTTCATCtttttttttAGNAAAAAAACAATCTAGTCATGATGTGTCACAAGTAATACCATCTATAAAGATCAATGCTCATAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGTCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTTATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTACTATTAACAGCANCGCCACAGCACAT
  3   1   2       bld Ga15      in                       XL411b05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TNAAGAAAAAAAAACAAATCTAGGTCATTGANGCTGTCACAAAGTATATNCCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATCATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCAT
  3   1   2       bld DMZ  5g3  in                         xl329g12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAAAANCAAATCTAGGTCATTGATGCTGTCACAAAGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTCGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTACAGAACCACAGTATCCNGCAGATCATGAGCTTGTATTCTAA
  3   1   2       bld DMZ  5g3  in                         xl319p19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTCATTGATGCTGTCACAAAGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAANGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTCGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTNGTATTCCACAAATGTCCTNGTATATAACTTCTACCCGCAGGGGGAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTAGCTGTGTAAATGAGNTGATTANANATATATCCACCATTTNTATTTTAGAAGNTAAGAAATTTGCTTTCTCCANT
  3  -1   2       bld Ga12      in                         XL215n10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGATGCTGTCACAAAGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAGCATCATTTATAGGTTATTTCCAGATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTCGTGGAAATGAAAACTGAAGGGAAAGTATTAATGTAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGNTAA
  3  -1   2       bld Ga12                                 XL168f14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGATGCTGTCACAAAGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAGCATCATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTCGTGGAAATGAAAACTGAAGGGAAAGTATTAATGTAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAA
  3   1   2       bld DMZ  5g3  in                         xl291d08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGTCACAANGTATATACCAGTCTATGNAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGTCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTTATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCNGCAGATCAGACTTGTATTTTAAATCTAACTGCGTAAATGCGATGATNATANATATTTCCACCANTNTTANTNTAGNGGTTAAGAAATNTGCTTCTCCA
  3   1   2       bld DMZ  5x3  out                        xl300p22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTCACAANGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGTCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTTATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATCTACTGNGTAAATGCGATGATTATATATACTTCCACCATTNTTATTTTAGNGGTTAAGAAATTTGCTTCTCCATT
  3   1   2       bld DMZ  5g3  in                         xl260h17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCACAAAGGTATATACCAGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGTCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTNTCTGTTAAAGATTTTCAGTNGTATTCCACAAATGTCCTTGTATATAACTTCTNCCCACAGGGGGAGAAANGTAAAGANCCACAGTATCCTGCAGATCAGACTTGTATTTTAAATCNTAACTGCGTAAATGCGATGATAATANANCTTTCCACCATNGTTANTNTAGCAGGTTAAGAAA
  3   1   2       bld Ga18 5g3  in                      xlk133o20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAGTATATNNNAGNCNNTGANAGNNNNNNANGCTNATTNNNCCCCAAACAAAGGATTCATTNCCACCNGCTTAAACGTGTNTNCCNATTCATATNACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCANCTTTTTGACGGGTCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTTATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTANCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTNCTTTCTCCATTTAATATNAANNTAC
  3   1   2       bld DMZ  5g3  in                         xl307h12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCACAAAGTATATACCGGTCTATGAAAGATTCAATGCTCATTAACCCCCAAACAAAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGTCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTTATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTNTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGAC
  3   1   2       bld Te2N                            IMAGE:7202217.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGTATTACCAGTCTATGANGATCAATGCTCATTACCGCCAAACAAAGGATTCATTCCACCGCTCAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCAAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATCATTCTACATTTTGCCAAGTGTTCGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCCCATACATGTAGCTTGCAGAGTTGTAGCAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATCTTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTATTTAAAGGTCTTTAGATCGGCCTGATTTTGCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCGATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTCGAGGTTAAGAAATTGCTCTCTCCATCACATGTACAGCACACTCCCCGATGATCTTT
  3   1   2       bld DMZ  5g3  in                         xl322m21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCAATGNTCCNTAAACCCCCAAACCAAGGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGTCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAANCACAGACTTCTATTTCTGNGATTAGATGTGGTTATTCTTTTTCTAGNTAAGATGGTGCNGGAAGATANNTCCGGTGCCACATAAGTGCAAAATGCATTGTGTTGG
  5  -1   2       bld Sp1                             IMAGE:5512427.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  NAAGGATTCATTCCACCGCTAAAACGTGTTTGCCATTCATATAACATATTTATAGGGTANTTTCCAATGATAGAATCCAAGCAACTTTTTGACGGAGCCGTGGGAGAAAGATTATGTGGGAGAATCATTCTACATTTTGCCAAGTGTTCGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCCCATACATGTAGCTTGCAGAGTTGTAGCAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATCTTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTATTTAAAGGTCTTTAGATCGGCCTGATTTTGCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCGATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATa
  3   1   2      seed Tbd7      in                         XL074b17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGGATTCATTCCACCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGTCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCNCCATTTAATATTTAAACACTACTACGCCATTAAAG
  3   1   2       bld DMZ  5g3  in                         xl236k03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGCTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGTCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTTGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGNAANGAAGTATTTNTCNTCCATGTAGCNTGCAGAGTTGTTAGGAGAGTAGCANNCAGNNNGGCATCANAATG
  3  -1   2       bld Ga12 5g   in                         XL193l04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGCTTAAACGTGTTTGCCATTCATATAGCATCATTTATAGGGTATTTCCGTGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGNGTTCGTGGAAATGAAAACTGAAGGGAAAGTATTAATGNAAATGAAGNATTTCTCATACATGTAGCTTGCAGAGCTGNTAGGAGAGTAGCATTCNNNGTGGCATCATAATGTACNAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAANATATTTCTGGTGCCACATAAGTACAAAATGCNTTGNGTTGGCCATCTCTGGNTAACTCATTGCCACATTTTTTTAATTCCGTGTTAATCTNTANACTTTCCCATTAT
  3   1   2       bld Ga18      in                       xlk60j06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTCGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCACAGGGGGAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCNCCATTTTTATTTTAGAAGTTAAGAAATTTNCTTCTCCATTTAANAT
  5   1   2       bld Ga18      in                       xlk60j06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTAAACGTGTTTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTCGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGNTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAAGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGNNNANaaaaacaaaaaaaaaa
  3   1   2       bld Tbd7 5g3  in                         XL090m14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTGCCATTCATATAACATCATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTCGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTAGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTG
  3   1   2       bld Neu7 5g3  in                         XL012c18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGCCATTCATATAACATAATTTATAGGTTATTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTCGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTANCTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGANAAATGTACAGAACCACAGTATCCTNCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGGATTATATANNTTTCCACCATTTTTATTTTAGAAGTTAACAAATTTGCTTNCGCCATTT
  5   1   2       bld Skin                            IMAGE:8643900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTATTTCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTCGTGGAAATGAAAACTGAAGGGAAAGTATTAATGTAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTTTAGATTCGGCCTGATTTTGCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCGATTACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAC
  3   1   2       bld DMZ  5g3  in                         xl268c17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTCCAATGATAGAATCCGAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTCGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAAGTTAAGAAATTTGCNTCTCCATTAATATTAAA
  3  -1   2       bld Ga12 5g   in                         XL213c13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGATAGAATCCNAGCAACTTTTTGACGGGGCCGTGGGAGAAAGATTATGTGGGAGAATGATTCTACATTTTGCCAAGTGTTCGNGGAAATGAAAACTGAAGGGAAAGTATTAATGTAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAANATATTTCTGGTGCCACATAANNACAAAATGCATTGTGTTGGCCATCTCTGGTNAACTCATTGCCACATTTTT
  3   1   2       bld Ga15 5g3  in                       XL443l07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGGGAGAAAGGATTANNGTGGGAGAATGATTGTACATTTTGCCAAGTGTTTGNGGAAATGAAAACTGAAGGGAAAGTATTAATGGNAATGAAGTATTTNTTCATACANGTAGCTNGGCAGAGTTGGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTGTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGNTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAA
  3  -1   2       bld Ga18 5g   in                      xlk150e07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTGGNAGAATGATTCTACNTTTTGCCAAGNGTTCGNGGAAATGAAAACTGAAGGGAAAGNATNNANNNAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCNTAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACANAAGTNCAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACANTTTTTTAATTCCGNTTAATCTATAGACTTTCCCATTAGNNAAACGGNCTNNAGNTTCGGNCNGANTNTGCNGAAANAAAGAAACANTNNTGTTT
  3   1   2       bld DMZ                                 rxl326h01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCCAAGTGTTNGTGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTNGGAGAGTAGCATTCAGTGTGGCNTCNTAATGTNCA
  3   1   2       bld Tbd7 5g3  in                         XL094k12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGAAATGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTANCTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGANAAATGTACAGAACCACAGTATCCTNCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGNGATGATTATATANNTTTCCACCATTTTTATTTTAGCAGGTTAACAAANTTGCTTNCGCCATTTCATATTTA
  3   1   2       bld Tbd7                                 XL094n09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGTATTAATGGAAATGAAGTATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAAGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCACATAAAAAACA
  3  -1   2       add Ga12                                 XL195f07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAGNATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTANATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACNANATGCATTGTGTTGGCCATCTCTGGNTAACTCATTGCCACATTTTTNTAATTCCGTTTAATCTATAGACTTTCCCATTANTTAAACGGTCTTTAGATTCGGCCTGATTTTGCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCNATTACCTATTTTCAGCAAGTNTGCCTTTCTG
  3   1   2       bld Neu7 5g3  in                         XL033p08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATTTCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAA
  3   1   2       bld Neu7 5g3  in                         XL014b17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTCATACATGTAGCTTGCAGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTTATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAANATTTAAAACTACTATGCCANTAAAGTGC
  5   1   2       chi Emb1                            IMAGE:6631134.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGCTCGTACGGTCAGATTTTCGNATTCGTCGANCACGCGNTCGCAACACAGACTTCTATTTCTGTGATTGTACATTATGATGCCNCCTCGAGCTAAGATGGCGCTGCAAGATATTTCTCGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGCGGAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGATAAGAAATTTGCTTTCTCCATTTAATATTTACAACTACTATGCCATTAGAGTGCAGTAAAAAACCGAAGCaaaaaaaaaaGGGCG
  3   1   2       bld Egg5      in                    IMAGE:3431766.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGTTGTTAGGAGAGTAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCC
  5   1   2       bld Ga15      in                       XL415d07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTTTAGATTCGGCCTGATTTTGCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCGATTACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAACATCCTTGTGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL415d07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGCATTCAGTGTGGCATCATAATGTACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTTTAGATTCGGCCTGATTTTGCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCGATTACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTAAAACTA
  3   1   2       bld Egg6      in                    IMAGE:4412674.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGATAATGGTAGTTCCCCCCCCGTTTTTGGCACCACATAAGTACAAAATGCATTGTGTGTGGCCCCTCTTCTGGTGTGACCCCAGGTGCTACCATTTTTTTTTTTTTTCnACATTTTTTAAATATATCCCAATATAANATACTTTCCCCATTCGGTTAAANCTGTTTTTAANTTTCGGCGCAGGGTTCCAAGCACACTGCTGCTGATTTTAAATAAGCATTTTGGCTTGTATCTTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCCCAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCCCCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCA
  5   1   2       bld Ga15                               XL454i02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACAAACACAGACTTCTATTTCTGTGATTAGATGTGGTCATTCTTTTTCTAGCTAAGATGGTGCTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAAGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATaaaaaacaaaaaaaaaa
  3   1   2       bld Tbd7                                 XL067b17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATGTGGTCATTCTTTTTCTAGATAAGATGGTGNTGGAAGATATTTCTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATNTNTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTNTAGATTCGGCCTGATTTTAAAGAANCATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTNTGCCTTTCTGTTAAAGATTNTCAGTTGTATTCCNCNAATGTCCTTGTATANAACTTCTACCCACANGGGGAGAAATGTAAAGAGACCACAGTATCCTGCAGATCNGACTTG
  3   1   2       chi Neu7      in                         XL018f02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTGGTCATTCTTTTTCTAGCTAANATGGTGNTGGAAGATATTTCTGGTNCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTANCTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCNCAAATGTCCTTGTANANCACNTCNNGCCCACAGGGGGGNTCAATGTAAAGANCCTGCAGTATACCTNCAGAATCAGATCTTGTATTTT
  3   1   2       chi Tbd7      in                         XL068h17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GNGGTCNTTCNNNTTNNAGNTNNGATGGTGNTGGNAGATNTNTCTGGNGCCNCATAAGNNCNNAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTNATTCCGTTTAATCTATAGACTTTCCCATTAGTTCCNCGGTCTAGATTCGGCCTGATTTTAAAGNAACATTTTTGTANTGTACCTGCAATTANCTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGNNATGTNCNGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATG
  3   1   2       bld Lu1       in                    IMAGE:4674092.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCACCACATAAGTACAAAATGCATTGTGTTGGCCCTCTCTGGTTGACCCAGTGCTACATTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTCGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATA
  3   1   2       bld Neu7 5g3  in                         XL046j05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGGTGCCACATAAGTACAAAATGCATTGTGTTGGCCATCTCTGGTTAACTCATTTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAAGATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATCTATATATATTTCCACCATTTTTATTTTAGAAGTTAAGAAATTTGCTTTCNCCATTTAATATTTAA
  3   1   2       bld Emb3 5g3  in                    IMAGE:3400292.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGCATTGTGTTGGCCATCTCTGGTTAACTCATTGCCACATTTTTTTAATTCCGTTTAATCTATAGACTTTCCCATTAGTTAAACGGTCTAGATTCGGCCTGATTTTAAAGAAACATTTTTGTTTGTACCTGCAATTAACTATTTTCAGCAAGTTTGCCTTTCTGTTAAGATTTTCAAGTTGTATTCCACANATGTCCNTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAACTACTATGCCATTAAAGTGCAATAAAAAACAAAAAA
  5   1   2       bld Gas5      in                    IMAGE:3748317.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAGCAAGTTCGCCTTTCTGTTAAAGATTTTCAGATGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTG
  3   1   2       bld Gas5      in                    IMAGE:3748317.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATTTTCAGTTGTATTCCACAAATGTCCTTGTATATAACTTCTACCCACAGGGGGAGAAATGTAAAGAACCTCAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAACATCATTGTGAA
  5   1   2       bld Ga15      in                       XL449j01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCNCCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCNATaaaaaacnaaaaaaaaa
  3   1   2       bld Ga15      in                       XL449j01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTA
  5   1   2       bld Ga15                               XL430n16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCGGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATaaaaaaaaaa
  5   1   2      ests                            Xl3.1-IMAGE:6874226.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACATCATTTACAGGTTATTATTTCCACTGAAAATCCAAGAAACTTTTTTTGACAGGACTGTGGAAGAATCATTCTACATTTTTCCAAGTGTTAATGGAAAACTGAAGGGAAAGTATTAATGGAAACTAAGTATTTCTCAAACGTGTATCTTACAGAGTTGTTGGGAGACTAGCGTGCAGGGTGGCACCATAATGAACACATGTAGATTAAGGCATTTGTACATTAAAGCAGAGTTTACCATTACTACACATCCATTTAATACCAGGTTTATGGTAGTCTATCCAAGATGGAACTACAGATCTCAGAATCTCAGAATTTTTTTAACAAAGATGATGCTGGAAGATAATGGTAGTTCCCCCACCGTTTCTGGCACCACATAAGTACAAAATGCATTGTGTTGGCCCTCTCTGGTTGACCCAGTGCTACATTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTTGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAA
                                                  Xl3.1-CHK-1012688277                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATTTACAGGTTATTATTTCCACTGAAAATCCAAGAAACTTTTTTTGACAGGACTGTGGAAGAATCATTCTACATTTTTCCAAGTGTTAATGGAAAACTGAAGGGAAAGTATTAATGGAAAxxAAGTATTTCTCAAACxTGTAxCTTACAGAGTTGTTGGGAGACTAGCGTGCAGGGTGGCACCATAATGAACACATGTAGATTAAGGCATTTGTACATTAAAGCAGAGTTTACCATTACTACACATCCATTTAATACCAGGTTTATGGTAGTCTATCCAAGATGGAACTACAGATCTCAGAATCTCAGAATTTTTTTAACAAAGATGATGCTGGAAGATAATGGTAGTTCCCCCACCGTTTCTGGCACCACATAAGTACAAAATGCATTGTGTTGGCCCTCTCTGGTTGACCCAGTGCTACATTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTTGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATA
  5   1   2       bld Egg1                               PBX0065B02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACGAGGATTTATGTATTTTTGTTTCTCTAAGTACAACTTGCTCAGTGGTGGTTTCCCATCTGTAATTGGGCACAGTGTGCCTATCCTTGTCACCGCTTTGGTGTGCAGTGATGGAAGCCATACACAACATTTATCTCCGTAATTAttttttttttATATAGAAGAAAAACAAATCTATGTCTATGTATTGATGCTGTCACATAGTCTATACAGGTCTGTATGAAAGATTCCGTTCTCATTAAGCCCCAAACAAAAGGTTTCATTCCACAGCTTAAACTTGTTTTCCATTCTTAGAACATCATTTACAGGTTATTTCCACTGAAAATCCAAGAAACTTTTTTTGACAGGACTGTGGAAGAATCATTCTACATTTTTCCAAGTGTTAATGGAAAACTGAAGGGAAAGTATTAATGGAAACTAAGTATTTCTCAAACATGTAGCTTACAGAGTTGTTGGGAGACTAGCGTGCAGGGTGGCACCATAATGAACACATGTAGATTAAGGCATTTGTACATTAAAGCAGAGTTTACCATTACTACACATCCATTTAATACCAGGTTTATGGTAGTCTATCCAAGATGGAACTACAGATCTCAGAATCTCAGAATTT
  3   1   2       bld Tad2      in                    IMAGE:6874226.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGCAGAGACGTGAGTGGCTTGGCAGATGGGTACTAAGAAAATCTCGAGGGGACGGGATTGCGTTCACCAGTAGACCCCCAAACAAAAAGGTTTATGTTCCGCCGCTTAAGACTTTTTTTTCCTTTCTTTGGACCATCCTTTTCCAGGTTATTTCCCCTGAAAAATCCAAGGAAACTTTTTTTTGACAGGACTGTGGAAGAATCATTCTACATTTTTCCAAGTGTTAATGGAAAACTGAAGGGAAAGTATTAATGGAAACTAAGTATTTCTCAAACATGTAGCTTACAGAGTTGTTGGGAGACTAGCGTGCAGGGTGGCACCATAATGAACACATGTAGATTAAGGCATTTGTACATTAAAGCAGAGTTTACCATTACTACACATCCATTTAATACCAGGTTTATGGTAGTCTATCCAAGATGGAACTACAGATCTCAGAATCTCAGAATTTTTTTAACAAAGATGATGCTGGAAGATAATGGTAGTTCCCCCACCGTTTCTGGCACCACATAAGTACAAAATGCATTGTGTTGGCCCTCTCTGGTTGACCCAGTGCTACATTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTTGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTCCACCATTTTTATTTAGAGGTTAAGAA
  3  -1   2       bld Ga15 5x3  in                       XL486h06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTATTGATGCTGTCACATAGNTCTATACAGGTCTGTATGAAAGATTCCGTTCTCATTAAGCCCCAAACAAAGGTTTCATTCCACAGCTTAAACTTGTTTTCCATTCTTAGAACATCATTTACAGGTTATTATTTCCACTGAAAATCCAAGAAACTTTTTTTGACAGGACTGTGGAAGAATCATTCTACATTTTTCCAAGTGTTAATGGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCAAACGTGTATCTTACAGAGTTGTTGGGAGACTAGCGTGCAGGGTGGCACCATAATGAACACATGTAGATTAAGGCATTTGTACATTAAAGCAGAGTTTACCATTACTACACATCCATTTAATACCAGGTTTATGGTAGTCTATCCAAGATGGAACTACAGATCTCAGAATCTCAGAATTTTTTTAACAAAGATGATGCTGGAAGATAATGGTAGTTCCCCCACCGTTTCTGGCACCACATAAGTACAAAATGCATTGTGTTGGCCCTCTCTGGTTGACCCAGTGCTACATTTTTTTTTTTTTACATTTTTNAAATTANCTATANAAANACTTTCCCATTCGTTAAACNGNCTTTANTTTCGGCCAGGTTCCAANACNCNGCNGCTGATTTNAAANAANCATTTNNCTNGNANCNGCAANGACCTATTTNCANCAAGTTNGCCTTTCNGTNAAATTTTTAGNNG
  5   1   2       bld Ga15      in                       XL430b24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTTCCGGAACATCATTTACAGGTTATTATTTCCACTGAAAATCCAAGAAACTTTTTTTGACAGGACTGTGGAAGAATCATTCTACATTTTTCCAAGTGTTAATGGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCAAACGTGTATCTTACAGAGTTGTTGGGAGACTAGCGTGCAGGGTGGCACCATAATGAACACATGTAGATTAAGGCATTTGTACATTAAAGCAGAGTTTACCATTACTACACATCCATTTAATACCAGGTTTATGGTAGTCTATCCAAGATGGAACTACAGATCTCAGAATCTCAGAATTTTTTTAACAAAGATGATGCTGGAAGATAATGGTAGTTCCCCCACCGTTTCTGGCACCACATAAGTACAAAATGCATTGTGTTGGCCCTCTCTGGTTGACCCAGTGCTACAtttttttttttttncnttttttAAATTANCTANATAAANACTTNCCCATTCG
  5   1   2       bld Ga15      in                       XL430d23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACATCATTTACAGGTTATTATTTCCACTGAAAATCCAAGAAACTTTTTTTGACAGGACTGTGGAAGAATCATTCTACATTTTTCCAAGTGTTAATGGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCAAACGTGTATCTTACAGAGTTGTTGGGAGACTAGCGTGCAGGGTGGCACCATAATGAACACATGTAGATTAAGGCATTTGTACATTAAAGCAGAGTTTACCATTACTACACATCCATTTAATACCAGGTTTATGGTAGTCTATCCAAGATGGAACTACAGATCTCAGAATCTCAGAATTTTTTTAACAAAGATGATGCTGGAAGATAATGGTAGTTCCCCCACCGTTTCTGGCACCACATAAGTACAAAATGCATTGTGTTGGCCCTCTCTGGTTGACCCAGTGCTACAtttttttttttttncattttttAAATTATCTATATAAATACTTNCCCATTCGTNAAACNGNCTTTAATTTCGGCCNGGTNCCAANACCCNGCNGCTGATTTTAAANAANCNTTTTGCTNGNATCNGCAANGACCTATTTNCNCCAAGTTNGCCTTNCGGTTAAATTTTTAGT
  3   1   2       bld Ga15 5g3  in                       XL517n10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAAAATCCANGNAACTTTTTTGGNCNGGNCGGGGGAAGAATCATTNTACNTTTTTCCAAGGGGTAANGGAAAACTGAAGGGNAAGNATTAATGGNAANTAAGTATTTTTCAAACANGTAGCTTACAGAGTTGTTGGGNGACTAGNGNGCAGGGGGGCCCCATAANGNACCCANGNAGATTAAGGCNTTTGNNCNTTAAAGCNGNGNTTACCNTTACTACCCNTCCNTTTAATACCNGGNTTATGGNAGTNTATCCNAGNNGGNACTNCAGATNTCAGAATNTCAGAATTTTTTTAACAAAGNNGNTGNNGGNAGANAATGGNAGTTCCCCCCCCGnTTTTGGCCCCCCANAAGNACAAAANGCNTTGGGNNGGCCCTNTNTGGNNGNCCCNGGGGTNCNNTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTCGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTCTCCATTA
  3   1   2       add DMZ       in                         xl329k15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTGACAGGNCTGNGGAAGAATCNTTNTACATTTTTCCAAGNGTTAATGGAAAACTGAAGGGAAAGTATTAATGGAAACTAAGTATTTTTCAAACGNGTAGCTTACAGAGTTGTTGGGNGACTAGCGTGCAGGGGGGCCCCATAATGNACNCATGTNGATTAAGGCNTTTGNNCNTTAAAGCNGNGTTTACCNTTNCTACNCATCCNTTTAATACCNGGNTTATGGNNGNCTNTCCNAGNNGGAACTACAGNTNTCAGAATATCNGGNTTTTTTTAAAAAAGNNGNTGCTGGAAGATAANGGNAGTTCCCCCNCCGTTTNNGGCCCCNCATAAGTACAAAATGCNTTGNGNTGGCCCNCTNTGGNTGNCCCNGGGNTACNTTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTTGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTNNAGAGGTTAAGAAAT
  5   1   2       bld Egg5      in                    IMAGE:3431903.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACAGGACTGTGGAAGAATCATTCTACATTTTTCCAAGTGTTAATGGAAAACTGAAGGGAAAGTATTAATGGAAACTAAGTATTTCTCAAACATGTAGCTTACAGAGTTGTTGGGAGACTAGCGTGCAGGGTGGCACCATAATGAACACATGTAGATTAAGGCATTTGTACATTAAAGCAGAGTTTACCATTACTACACATCCATTTAATACCAGGTTTATGGTAGTCTATCCAAGATGGAACTACAGATCTCAGAATCTCAGAATTTTTTTAACAAAGATGATGCTGGAAGATAATGGTAGTTCCCCCACCGTTTCTGGCACCACATAAGTACAAAATGCATTGTGTTGGCCCTCTCTGGTTGACCCAGTGCTACAtttttttttttttacattttttAAATTATCTATATAAATACTTTCCCATTTGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTT
  3   1   2       add DMZ  5g3  in                         xl316d18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CNTTTTACATTTTTCCAAGNGTTAATGGAAAACTGAAGGGAAAGTATTAATGGAAACTAAGTATTTTTCAAACGNGTAGCTTACAGAGTTGTTGGGAGACTAGCGTGCAGGGNGGCCCCATAATGAACNCATGTAGATTAAGGCATTTGNNCATTAAAGCAGNGTTTACCNTTNCTACNCNTCCNTTTAATACCNGGNTTATGGTAGTCTNTCCNAGNNGGNACTACAGATNTCAGAATATCNGGNTTTTTTTAAAAAAGATGNTGCTGGAAGATAATGGTAGTTCCCCCCCCGTTTNNGGCCCCNCATAAGTACAAAATGCNTTGNGTTGGCCCNCTNTGGNTGNCCCNGNGNTACNTTTTTTTTTTTTTACATTTTTTTAAATTATCTATATAAATACTTTCCCATTCGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGATTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTNTNAATNTACNGTGTAAGNTGAGATGATNANATATTTCCNCCCATTTTTAT
  5   1   2       bld Gas5      out                   IMAGE:3747507.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTCTACATTTTTCCAAGTGTTAATGGAAAACTGAAGGGAAAGTATTAATGGAAATGAAGTATTTCTCAAACATGTATCTTACAGAGTTGTTGGGAGACTAGCGTGCAGGGTGGCACCATAATGAACACATGTAGATTAAGGCATTTGTACATTAAAGCAGAGTTTACCATTACTACACATCCATTTAATACCAGGTTTATGGTAGTCTATCCAAGATGGAACTACAGATCTCAGAATCTCAGAATTTTTTTAACAAAGATGATGCTGGAAGATAATGGTAGTTCCCCCACCGTTTCTGGCACCACATAAGTACAAAATGCATTGTGTTGGCCCTCTCTGGTTGACCCAGTGCTACAtttttttttttttACATTTTCTAAATTATCTATATAAATACTTTCCCATTCGTTTAACTGGCTTTAA
  3   1   2       add DMZ  5g3  in                         xl291c23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGTGTTAATGGAAAACTGAAGGGAAAGTATTAATGGAAACTAAGTATTTNTCAAACGNGTAGCTTACAGAGTTGTTGGGAGACTAGCGTGCAGGGNGGCNCCATAATGAACACATGTAGATTAAGGCATTTGTACATTAAAGCAGNGTTTACCATTACTACNCATCCNTTTAATACCAGGTTTATGGTAGTCTATCCAAGANGGAACTACAGATNTCAGAATATCNGGATTTTTTTAAAAAAGATGATGCTGGAAGATAATGGTAGTTCCCCCNCCGTTTCNGGCNCCNCATAAGTACAAAATGCNTTGNGTTGGCCCTCTCTGGNTGNCCCNGNGNTACNTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTTGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATNATATATTTCCACCATTTNTATTNTAGAGGNTANGAAATGTGCTT
  3   1   2       add DMZ  5g3  in                         xl296g17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAACGNGTAGCTTACAGAGTTGTTGGGAGACTAGCGTGCAGGGNGGCNCCATAATGAACACATGTAGATTAAGGCATTTGTNCNTTAAAGCAGNGTTTACCNTTACTACNCATCCATTTAATACCAGGNTTATGGTAGTCTNTCCAAGNTGGAACTACAGATCTCNGAATATCAGGATTTTTTTAAAAAAGANGATGCTGGAAGATAATGGTAGTTCCCCCNCCGNTTCTGGCNCCNCNTAAGTACAAAANGCNTTGNGTTGGCCCTCTNTGGTTGNCCCNGTGNTACATTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTTGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTNTAGAGGNTANGAAAT
  3   1   2       add DMZ  5g3  in                         xl282i09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GNGTAGCTTACAGAGTTGTTGGGAGACTAGNGTGCAGGGGGGCCCCATAATGAACNCNTGTAGATTAAGGCATTTGTACNTTAAAGCNGNGTTTNCCNTTNCTACNCATCCNTTTAATACCAGGNTTATGGNNGTNTNTCCNAGNNGGNACTACNGATNTCAGAATATCNGGNTTTTTTTAAAAAAGANGNTGNTGGAAGATAATGGTAGTTCCCCCNCCGTTTNNGGCCCCNCATAAGTACAAAATGCNTTGNGTTGGCCCTCTNTGGNTGNCCCNGNGNTACNTTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTCGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGATTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTNNAGAGGTTAAGAAAT
  3   1   2       add DMZ  5g3  in                         xl258m04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTAGCTTACAGAGTTGTTGGGAGACTAGCGTGCAGGGNGGCNCCATAATGAACNCATGTAGATTAAGGCATTTGTACATTAAAGCAGNGTTTACCATTNCTACNCATCCATTTAATACCNGGTTTATGGNNGTCTNTCCNAGANGGNACTACAGATCTCAGAATATCNGGATTTTTTTAAAAAAGATGATGCTGGAAGATAATGGTAGTTCCCCCNCCGTTTCNGGCCCCNCATAAGTACAAAATGCNTTGNGNTGGCCCTCTNTGGNTGNCCCAGNGNTACATTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTCGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTNNAGAGGNTAAGAAAT
  3  -1   2       add DMZ  5g   in                         xl231h02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATAATGAACACATGTATTATTAAGGCATTTGTACATTAGNGCAGAGTTTACCATTNCTACACANCCATTTAATACCAGGTTTATGGNAGTCTATCCTNGATGGAACTNCAGATCTCAGAATCNCNGAATTTTNTTAACANAGATGATGCTGGAAGANAATGGNAGTTCCCCCACCGTTTCTGGCACCACATNNGTACAGAATGCATTGNGTTGGCCCTCTCTGGTTGACCCAGTGCTACATTG
  3   1   2       bld Egg5      in                    IMAGE:3431903.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACCAGGTTTATGGTAGTCTATCCAAGATGGAACTACAGATCTCAGAATCTCAGAATTTTTTTAACAAAGATGATGCTGGAAGATAATGGTAGTTCCCCCACCGTTTCTGGCACCACATAAGTACAAAATGCATTGTGTTGGCCCTCTCTGGTTGACCCAGTGCTACATTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTTGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTGCT
  3   1   2       bld Ga15 5g3  in                       XL479d20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCCAAGANGGAACTACAGNTNTCAGNATTTCNGAATTTTTTTAACAAAGANGANGNTGGAAGANAATGGTAGTTCCCCCCCCGTTTTTGGCCCCCCANAAGNACAAAANGCNTTGNGNTGGCCCTNTTNGGGTGNCCCNGGGNTNCNNTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTCGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATNTGCTTTCTCCAT
  3   1   2       bld Ga15      ?                        XL405g03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCNCGNGTCCGNTGGAAGATAANGGTAGTTCCCCCCCCGNTTNTGGCCCCNCATAAGTACAAAANGCNTTGGGNTGGCCCTNTNTGGGTGNCCCNGNGNTACNTTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTCGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGATTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTCTCCAT
  3   1   2       bld Tbd7                                 XL100d12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAANAATGGTAGTTCCCCCNCCGTTTCTGGCNCCNCATAAGTACAAAATGCATTGTGTTGGCCCTNTNTGGTTGACCCAGTGNTACATTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTTGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAA
  3   1   2       bld Emb3      in                    IMAGE:3400208.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTACAAAATGCATTGTGTTGGCCCTCTTTGGTTGACCCAGTGCTACATTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTTGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGGTTAAGAANATTTGCTTTCTCNCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAA
  3   1   2      seed Tbd7 5g3  in                         XL080l12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACAAAATGCATTGTGTTGGCCCTCTTTGGTTGACCCAGTGCTACATTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTTGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCAGATCAGACTTGTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGA
  3   1   2       add Ga15      in                       XL430b24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACATTTTTTTTTTTTTACATTNTTTAAATTATGNTATATAAATACTTTCCCATTNGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGNCACTGCTGCTGATTNTAAATAAGCATTNTGNTTGTATCTGCAATGCCCTATTTTCAGCAAGTTTGCCTTTNTGTTAAANTTTTAGNGGTATTCCACAAATGTAGAATATAAATTCTACCCACNGGGGTGTAGAAATGTACAGAAGNCACATGTATCCTGCNGATCAAGNACNGTGTATTNNAAANTT
  3   1   2       bld Ga15      in                       XL459h22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TNCNTTTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTCGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTAAATTTTTAGTTGTATTCCACAAANGTAGAATATAAATTCTACCCACAGGGGGNGTAGAAATGTACAGAACCACAGTATCCNGCAGATCAGACTNGTATTTTAAATTTANCNGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATNTGCTTTCTCCAT
  3   1   2       add Neu7      in                         XL006o19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACATTTTTTTTTTTTTACATTTTTTAAATTATCTANANAAATACTTTCCCATTCGTTAAACTGTCTTTAANTTCGGCCNGGTTNCNAGACNCTGCTGCTGATTTTNAATAAGCATTTTGCTTGNATNNGCAANGACCTANTTTCAGCAAGATTGCCCTTCTGTTAAANTTTTAGTTGTANTCCACAAATGTAGAANATAAATTCTACCCNCANGGGNGTAGAAATGNACANAACCCCAGNATCCNGCNGANCAGACTTGNATTTTAAANTTACTG
  3   1   2       add Ga15      in                       XL430d23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACANTTTTTTTTTTTTACATTNTTTAAATTATCTATATAAATACTTTCCCATTCGTTAAACTGTCTTTAATTTCGGCCAGGTTCCAAGACNCNGCTGCTGATNNTAAATAAGCATTNTGNTTGTATCTGCAATGACCTATTTTCAGCAAGNNTGCCNTTCTGTTAAANTTTTANTNGTATTCCACAAANGTAGAATATAAATTCTACCCNCAGGGGTGTAGAAANGTACAGNACCACAGTATCCTNCNGATCAGNCGTTGNATTCNAAATTNACGGNGTAAACGAGA
  3   1   2       add Tbd7 5g3  in                         XL105p24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTTTTTTACATTTTTTAAATTATCTATATAAATACTTTCCCATTTGTTAAACTGTCTTTAATTTCGNNCAGGTTCCAAGACACTGCTGCTGATTTTAAATAAGCATTTTGCTAGTATCTGCAATGACCTATNTTCAGCAAGTTTGCCTTTCNGTTANATTNTTAGTTGTATTCCNCAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGACACCACAGTATCCTGCGAGATCAGACNTGTATTTTAAATTNACTGTGTAAATGAGAATGTATTATATAT
  3   1   2       add Tbd7                                 XL104p09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTTTTTTACANTTNTTAAATTATCTATATAAATACTTTCCCATNTGTTAAACTGTCTTTANTTTCGNCCAGGTTCCAAGACNCTGCTGCTGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATNTTCAGCAAGTTTGCCTTTCTGTTANATTTTTAGTTGTATTCCNCAAATGTAGAATATAAATTCTACCCACAGGGGTGTAGAAATGTACAGAACCACAGTATCCTGCNGATCAGACTTGTATTTTAAATTTACTGTGTAAATGTAGAATGATTATATATCTTGCCAGCCATTTTTATTT
  3   1   2       add Tbd7      in                         XL065g02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGATTTTAAATAAGCATTTTGCTTGTATCTGCAATGACCTATTTTCAGCAAGTTTGCCTTTCTGTTANATTTTTAGTTGTATTCCNCNAATGTAGAATATAAATTCNACCCNCAGGGGTGTAGAAATGTACAGNACCACAGTATCCTGCNGATCAGACNTGTATTTTAAATTNACTGTGTAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)