Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Nov 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012837274 Xl3.1-IMAGE:8821599.5.5 - 121 ESTs
                                                                       ....-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8821599.5.5                                                                                                                                                 TTCAGCGTATAGGCTTCATTGCCCTGCATTCTGGACGACGTTCAACGGTGTCTGTGAACTACATGTCCCAGAGCGCCTTGCGGTCAGCCCGTCCTCTCAGCTCAGGGCTCTGTGCTCCCGCCCTCGCGTTCTCTCTGCCTGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCAAAATCTTCAAAAAGGAGAAGGAAATGAAAAAAGGAATTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAATTTAAAAAGGCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTTGGAATTCTCTCCAGACTAAACCAAAAG
                                                  Xl3.1-CHK-1012721258                                                                                                                                                       GTATAGGCTTCATTGCCCTGCATTCTGGACGACGTTCAACGGTGTCTGTGAACTACATGTCCCAGAGCGCCTTGCGGTCAGCCCGTCCTCTCAGCTCAGGGCTCTGTGCxxxCGCCCTCGCGTTCTCTCTGCCTGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCAAAATCTTCAAAAAGGAGAAGGAAATGAAAAAAGGAATTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAATTTAAxxxxxCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTTGGAATTCTCTCCAGACTAAACCAAAAGTATATA
                                                      consensus depths                                                                                                                                                      3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     5     9     6    14     8    18    18    28    21    30    25    36    31    49    36    57    37    60    62    65    64    68    64    68    64    69    68    71    68    71    70    71    69    71    58    71    71    72    71    72    71    72    71    72    71    72    72    73    65    73    71    72    71    72    71    72    71    72    71    72    71    72    72    72    71    73    72    75    73    76    73    76    71    75    73    74    73    75    72    73    70    73    69    71    68    71    67    71    68    71    68    73    68    74    68    74    64    72    69    75    72    75    70    76    69    77    70    78    68    78    68    78    67    78    71    80    61    76    59    76    51    74    43    71    37    68    39    70    35    67    32    64    32    63    31    62    26    57    29    57    29    58    27    57    29    56    30    53    30    52    34    50    32    49    34    47    35    45    35    44    38    44    36    45    39    43    38    43    31    42    35    42    36    42    37    41    37    41    38    41    36    41    36    41    34    41    33    38    35    39    35    38    34    38    31    37    30    36    34    36    29    36    33    35    35    37    35    37    30    37    35    36    27    35    33    34    29    33    30    34    30    33    17    32    16    29    16    27    16    26    13    25     9    22     9    19     8    17     7    16     7    15     6    13     7    13     7    13     7    13     6    13     4    13     4    13     4    13
  5   1   2      en>5                            Xl3.1-IMAGE:8821599.5                                                                                                                                                 TTCAGCGTATAGGCTTCATTGCCCTGCATTCTGGACGACGTTCAACGGTGTCTGTGAACTACATGTCCCAGAGCGCCTTGCGGTCAGCCCGTCCTCTCAGCTCAGGGCTCTGTGCTCCCGCCCTCGCGTTCTCTCTGCCTGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCAAAATCTTCAAAAAGGAGAAGGAAATGAAAAAAGGAATTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAATTTAAAAAGGCTCTCTACCTGTTCAGTCTGGGCAGCCAAGTGTGCGTTTGGATGTCGGATCCCCACTTTCCTTTTGGATGCAA
  5   1   2      en>5                            Xl3.1-IMAGE:7298555.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTTGGAATTCTCTCCAGACTAAACCAAAAGTATATATTTTTCTTGTTC
                                                                   VAR                                                                                                                                                                                                                                                                         CCTCCAGCGCCCTCGCGCTCTCTCTGCCCGTCGCCTCCACAGCCGCTGCCACTGCTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGCTGTCGATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAATAAAATGTAAAAAAGCCTCTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTCTACCTGTTCAGTCTGGGCAGCCAAGTGTGCGTTTGGATGTCGGATCCCCACTTTCCTTTTGGATGCAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                         T--C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                         --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                             -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----TG-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --C--G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T--C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     T-G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T-T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --T-----C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --G--------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -C----------
                                               BLH ATG     219    2612                                                                                                                                                 
                                               BLH MIN     195     297                                                                                                                                                 
                                               BLH MPR     186     297                                                                                                                                                 
                                               BLH OVR     219      51                                                                                                                                                 
                                               EST CLI     136      25                                                                                                                                                 
                                               ORF LNG     219       5                                                                                                                                                 
  5   1   2      en>5                            Xl3.1-IMAGE:8821599.5                                                                                                                                                 TTCAGCGTATAGGCTTCATTGCCCTGCATTCTGGACGACGTTCAACGGTGTCTGTGAACTACATGTCCCAGAGCGCCTTGCGGTCAGCCCGTCCTCTCAGCTCAGGGCTCTGTGCTCCCGCCCTCGCGTTCTCTCTGCCTGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCAAAATCTTCAAAAAGGAGAAGGAAATGAAAAAAGGAATTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAATTTAAAAAGGCTCTCTACCTGTTCAGTCTGGGCAGCCAAGTGTGCGTTTGGATGTCGGATCCCCACTTTCCTTTTGGATGCAA
                                                  Xl3.1-CHK-1012685547                                                                                                                                                       GTATAGGCTTCATTGCCCTGCATTCTGGACGACGTTCAACGGTGTCTGTGAACTACATGTCCCAGAGCGCCTTGCGGTCAGCCCGTCCTCTCAGCTCAGGGCTCTGTGCxxxCGCCCTCGCGTTCTCTCTGCCTGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCAAAATCTTCAAAAAGGAGAAGGAAATGAAAAAAGGAATTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAATTTAAAAAGGCTCTCTACCTGTTCAGTCTGGGCAGCCAAGTGTGCGTTTGGATGTCGGATCCCCACTTTCCTTTTGGATGCAAACTTGG
  5   1   2       bld Em10 5g                         IMAGE:8317487.5p CTTCGCTCAGTCACGGCTGTCCTCTCCTCTTGTCATACAGTCAGACCCAAAGCTGCCTCACACCGACTCGCTACTTGTTATTCAGCTGCCTCGTTCTCAGTGCAATTCCCAGCAAGCCCCGGAAACAAATGCAGTGACATGTGCTTCAGCGTATAGGCTTCATTGCCCTGCATTCTGGACGACGTTCAACGGTGTCTGTGAACTACATGTCCCAGAGCGCCTTGCGGTCAGCCCGTCCTCTCAGCTCAGGGCTCTGTGCTCCCGCCTCCAGCGCCCTCGCGCTCTCTCTGCCCGTCGCCTCCACAGCCGCTGCCACTGCTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTATGGAGGAAACCGGGAAAATCTTCAAAAAGGAGAAGGAAATGAAAAAAGGGATTGCTTTTCCCAACAGTATATCATGTAATAAATGTGTGTGTCATTTCTCACCTCGAAAAATGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCATCTAGGAGTTCATGTGGAG
  5   1   2       bld Emb1 5g                         IMAGE:6863929.5p                                                                                                                                     AGTGACATGTGCTTCAGCGTATAGGCTTCATTGCCCTGCATTCTGGACGACGTTCAACGGTGTCTGTGAACTACATGTCCCAGAGCGCCTTGCGGTCAGCCCGTCCTCTCAGCTCAGGGCTCTGTGCTCCCGCCTCCAGCGCCCTCGCGCTCTCTCTGCCCGTCGCCTCCACAGCCGCTGCCACTGCTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTATggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaaGGGATTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTTGATGGAGAAAAAGACTATCATTTCGAAACCCCACTGACCCGNCAAAAGAAAGACCC
  5   1   2       bld Ga12      in                         XL177e10.5p                                                                                                                                              GGCTTCAGCGTATAGGCTTCATTGCCCTGCATTCTGGACGACGTTCAACGGTGTCTGTGAACTACATGTCCCAGAGCGCCTTGCGGTCAGCCCGTCCTCTCAGCTCAGGGCTCTGTGCTCCCGCCTCCAGCGCCCTCGCGCTCTCTCTGCCCGTCGCCTCCACAGCCGCTGCCACTGCTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTatggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAA
  5   1   2       bld DMZ  5g3  in                         xl259a10.5p                                                                                                                                                                                                               ATGTCCCAGAGCGCCTTGCGGTCAGCCCGTCCTCTCAGCTCAGGGCTCTGTGCTCCCGCCTCCTGCGCCCTCGCGCTCTCTCTGCCCGTCGCCTCCACAGCCGCTGCCACTGCTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCATGAGCANACCATCGCGGAGGACCTGGTGGTCACCAAGTACAANATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTatggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTANGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCANAGGAGTGTCCGGTGACTGGACNTANAGCTGATGTCATCAAANCANCCCATCTTTGTGTAGAANCTGCCCTGCGTCTTGTGAAA
  5   1   2       bld Emb9 5g                         IMAGE:7977095.5p                                                                                                                                                                                                                                                CTCAGCTCAGGGCTCTGTGCTCCCGCCTCCAGCGCCCTCGCGCTCTCTCTGCCCGTCGCCTCCACAGCCGCTGCCACTGCTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTatggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGGAAA
  5   1   2       bld Thy  5g                         IMAGE:8547533.5p                                                                                                                                                                                                                                                    GTTTAATAAAAAGCAAGAACTCATCGATACGAATTCGTCCCGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAATGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAGAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTG
  5   1   2       bld Brn2 5g                          Brn2-zb04f01.5p                                                                                                                                                                                                                                                      GGTGCTCCCGCCTCCAGCGCCCTCGCGTTCTCTCTGCCTGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTTTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTAtggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGG
  5   1   2       bld Int2 5g                         IMAGE:8821599.5p                                                                                                                                                                                                                                                       CCCGAATGATTAATAGAAAGATCCCAACAAATACAAATTCGTCCCCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGgaggaaacaggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAGAAAGACCATGAAAAAGCAGAATTTGACGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCCCTGGAGAAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACATTTACAAAAGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCCTTTTTCAGTGAAGTCGAAAGGGGCGCCTGA
  5   1   2       bld Emb4 5g                         IMAGE:4682529.5p                                                                                                                                                                                                                                                             CCGCCTCCAGCGCCCTCGCGTTCTCTCTGCCTGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCCATGAAAAGCAGAATTTGAGGGCCATGAAAGTTATGCTGGCCATGTTCTTATTACCCCTGGGAGAGGGAAAAGCCAAAGGGATGCGGGACAGCGGCCCAACCATTTTACAAAAGGGAccccccccTAAGCAGTAT
  5   1   2       bld Brn1 5g                         IMAGE:6952610.5p                                                                                                                                                                                                                                                               GCCTCCAGCGCCCTCGCGTTCTCTCTGCCTGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTTTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCAAAATCTTCaaaaaaaaaaaaaaaaaaaaaaaaaGG
  5   1   2       bld Ov1  5g                         IMAGE:8330167.5p                                                                                                                                                                                                                                                               GCCTCCAGCGCCCTCGCGTTCTCTCTGCCTGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAAACCCACTGACCAGCAAAAGAAAGA
  5   1   2       bld Ga15 5g                            XL488c01ex.5p                                                                                                                                                                                                                                                                CCTCCAGCGCCCTCGCGTTCTCTCTGCCTGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATANAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCANAACCCCACTGACCANCAA
  5   1   2       bld Ov1  5g                         IMAGE:8332282.5p                                                                                                                                                                                                                                                                       TCCCTCCAGCGCCCTCGCGCTCTCTCTGCCCGTCGCCTCCACAGCCGCTGCCACTGCTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTATggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaaGGGATTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAAATAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGA
  5   1   2       bld Ga15 5g                            XL510d05ex.5p                                                                                                                                                                                                                                                                         CCCTCGCGTTCTCTCTGCCTGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTTTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCC
  5   1   2       bld Tad1 5g                         IMAGE:6877722.5p                                                                                                                                                                                                                                                                           GGGGCGTTCTCTCTGCCTGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCAAAATCTTGAAAAAGGAGAAGGAAATGAAAAGAGGAATTGCTTTCCCAACGAGTATATCTGTAAATAATGGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTGGTGGGGAAGCCGCTCTGCGTCCTGTTAAACCAGGGAATCAGAACACACAAGTGACTGAAGCATGGAATAAAAATTCTCCAGAATTTAAATGTACTTCCAATAGAAAGGAATGCTTTTCTCACCAGCCTAAAGCAGCCATGTCATTTGATGGAAAGGAAGACTAATCATTCAGAAACCCCCACTGAACCGGCCaaaaaaaaaGGAACCTGTGAAAAAAGCCCAAT
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959704.5p                                                                                                                                                                                                                                                                             GACGCGTGGGGCGCTCTCTCTGCCCGTCGCCTCCACAGCCGCTGCCACTGCTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACACGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTatggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAAT
  5   1   2       bld Spl  5g                         IMAGE:8462523.5p                                                                                                                                                                                                                                                                             CGCGTTCTCTCTGCCTGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAGAAAGACCATGAAAAGCAGAATTGAGGTCCATGAGTTATGCTGTGATGTCTTATAGCCTGGAAGGAAAGGCAAGATGCGGAC
  5   1   2       chi Brn1 5g                         IMAGE:6950601.5p                                                                                                                                                                                                                                                                               ACCGGTCCGGAATTCCCCGGATCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATACAAGGAATGCTTTCTCCCCACCCAAAGCCGCCTGTCCTTGCATGGAGAGAAAACTATCTTTCCGAACCCCCACTTGACCACCCAAAGAAAGACCCATGAAAAACCCTAAATTTTAGGGTCCCCCAAAATTTAATGCCCCTCCCATGTTCCCAACCAAACCCCTCGCACAACGCAACACGGCCCAAAGATTTGTCGGGACCCAACGTCCACAAACAACCTT
  5   1   2       chi Tad1                            IMAGE:6940323.5p                                                                                                                                                                                                                                                                                         GGGCTCTCTGCCCGTCGCCTCCACAGCCGCTGCCACTGCTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTATGGAggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGCGAAAATCGATCTATGACGTCATGTGGATGGCTTCATTGCTAAAGTTGGCCACAACTCTTGTTGTTGGAGCCCTCAAAGGCATCGTCCGGTGGACTTGGACCGTCAAAAGCCTGAAAGTCCATCAAAAACCAAGCCCCACCCTTTTAGTGGTCAAAAAGCCTGCCCCTTGTCGGTCCTTGCTGTAAATCCCGGGGAAAATCCACGAAACCTCCGCCCAAGTGAAACCTCCAAAGCCCTGGGTAATTAAAAAAATTTTCCCCCCCATCCCTTTTTCTACAAATGGTTCCCTCCCCACATCTAGCAAATGGCAAATGGGCTGCCTTCCTCCACTCTACGCCCTTACAAACCCTAAGCCACCGATTTCATTTGCCAACGGGGACAAAAAACAATGAACCCTCTTCCCTTTTTCAGAAAACAACCTCGCTCATACTTACAACCCTGCGGCCATATATAAGTAACAATGCACCGCCCCTCGA
  5   1   2       bld Tbd7 5g                              XL066j13.5p                                                                                                                                                                                                                                                                                              GTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCCTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAG
  5   1   2       bld Emb9 5g                         IMAGE:7976910.5p                                                                                                                                                                                                                                                                                               CGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACAGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCACTGGGAGAGGGAAA
  5   1   2       bld FaBN 5g                         IMAGE:8077807.5p                                                                                                                                                                                                                                                                                               CGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCCTGGAATAAAATTTCTCCAGAATTAAATGTACTCCAATAGAAGGAATGCTTTCTCACAGCTTAAGCAGCATGTCATTTATGGAGAGAAACTATATTTCAAACCCCCTGACAGCAAATAAGACCTGAAAACAGATTTCTGCCTGAATTATGCTGTGATTTCTTTTACCTGGAATGAAGGTCAGATCTGA
  5   1   2       bld Ov1  5g                         IMAGE:8330350.5p                                                                                                                                                                                                                                                                                               CGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAAGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCCAGCAAAGAAAGACCATGAAAAAGCAGAATTGAGGTCCA
  5   1   2       bld Em10 5g                         IMAGE:8319171.5p                                                                                                                                                                                                                                                                                               CGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTTTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTAAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAACTAAACAGCCTGTTCTTGATGGAGAGAAGACTATCATTCAAAACCCCACTG
  5   1   2      seed Spl  5g                         IMAGE:8462110.5p                                                                                                                                                                                                                                                                                               CGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTATGCTGTCGATGTTCTATAGCACTGGAGAGGAAGGCAANGATC
  5   1   2       bld Emb4 5g                         IMAGE:5569879.5p                                                                                                                                                                                                                                                                                                GCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTTTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAAGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCCTTCAGAACCCCACCTGACCAGCCAAAAGAAAGACCATGAAAAAAGCACAAATTTGAAGGGTCCCATGAAGTTTAATGCCGGCCCAAGGTTCCTTATTAACCACTTGAAGAAGGGAAAAGGCCCAAGGGATGGGGGGAACGCCCCGCCAATCAATTTTCCAAAAGGGGGcccccccccTAAAACCACGATGCGCCCCGCAAATTGGAAAGCCTCCCCGGGCGCGCTTTTCT
  5   1   2       bld Te2  5g                         IMAGE:7208299.5p                                                                                                                                                                                                                                                                                                GCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAGCAGAATTTGAGGGTCATGAGTTTATGCTGT
  5   1   2       bld Emb9 5g                         IMAGE:7974729.5p                                                                                                                                                                                                                                                                                                 CCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAA
  5   1   2       bld Thy  5g3  in                    IMAGE:8548746.5p                                                                                                                                                                                                                                                                                                  CTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAAGGATGCTGGACAGCGCACACATTTACAAAGGACTCCCACTAAGCAGTATGGCTGAAATGAACTCCGTGCTTTTCAGTGAGTAGAAGGTGCTTTGATGCCATTGCATCACTCTCAGGCCATTGAAGAATGAAAGCAG
  5   1   2       bld Em10 5g3  in                    IMAGE:7981486.5p                                                                                                                                                                                                                                                                                                       CGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaATTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCACTGACCAGCAAAGGAAGACATGAAAAACAGAATTGAGGTCATGAATT
  5   1   2       bld FaBN 5g3  in                    IMAGE:8074390.5p                                                                                                                                                                                                                                                                                                              CACAGCCGCTGCCACTGCTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTatggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGAAAGGGCAGGGATGCTGGACAGCA
  5   1   2       bld Spl  5g                         IMAGE:8461227.5p                                                                                                                                                                                                                                                                                                              CACAGCCGCTGCCACTGCTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTAtggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCCCAGCTAAAGCAGCATGTCATTGATGGAGAAAGACTATATTCAGAACCCACTGACAGCAAAGAAGACATGAAAAGCAGATTTGAGTCACGAGTTACCTGTGATGTCTATTACACTGAAGAAAGCAGGATCTGAACGACACATTAAANGGACGACTACGTGCTGATGAACTCTGCTTCAGATGAAGCTGACAGCTCTCGACTGGAAGAGAATGTG
  5   1   2       bld DMZ  5g3  in                         xl322e03.5p                                                                                                                                                                                                                                                                                                              CTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTG
  5   1   2       bld Tbd7 5g                              XL087g22.5p                                                                                                                                                                                                                                                                                                               CTGCAGCCTTTGCCCTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTTTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCAAAATCTTCAAAAAGGAGAAGGAAATGAAAAAAGGAATTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAG
  5   1   2       bld Neu7 5g3  in                         XL032f21.5p                                                                                                                                                                                                                                                                                                                 GCAGCCTTTGCCCTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCAAAATCTTCAAAAAGGAGAAGGAAATGAAAAAAGGAATTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAA
  5   1   2       bld Neu7      in                         XL048p15.5p                                                                                                                                                                                                                                                                                                                  GGCCGCTGCCCTGCTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTatggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAG
  5   1   2       bld Int2 5g                         IMAGE:8824518.5p                                                                                                                                                                                                                                                                                                                          CGGGCCTACGTACCATAGGGACCGCACCCCACCCGAATTCGTCCCCAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGgaaacaggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaATTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAAGATGCGGGACAGCGCACACATTTACAAAGGGACCCCACTAAGCAGTATGGCCTGAAATGAAAACCTCCCGTGCCTTTTCAGTGAAGTCGAAGAGGCCGCTTTGAATGCAATGCCATTCAA
  5   1   2       bld Neu7 5g3  in                         XL033p14.5p                                                                                                                                                                                                                                                                                                                           GNCTGATACTGAGGAAGGGGTGAAAGNAGCTGTCACAGGCCCACAAAGNATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTATGGAGGaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTT
  5   1   2       bld Em10 5g3  in                    IMAGE:7981578.5p                                                                                                                                                                                                                                                                                                                           CACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTTTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATNGAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATAGCACTG
  5   1   2       bld Thy  5g                         IMAGE:8549378.5p                                                                                                                                                                                                                                                                                                                           CACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGATATCATTCAGACCCCACTGACCAGCAAAGAAGACCATGAAAACAGAATTGAGGTCATGAATTTAGCTGTGATGTTCTATAGCCTGGAAGGGAAAGCAAGATGGGGAACCACACAATACAAAGGACCACTACCGTATGCTGAATAAACTCCTGC
  5   1   2       bld Neu7 5g                              XL040f05.5p                                                                                                                                                                                                                                                                                                                            ACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTC
  5   1   2       bld FaBN 5g                         IMAGE:8077329.5p                                                                                                                                                                                                                                                                                                                            CCTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAAAACCCACTGACCAGCAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCACTGGAGAAGGAAAAGCAA
  5   1   2       bld FaBN 5g3  in                    IMAGE:8074582.5p                                                                                                                                                                                                                                                                                                                             TGCTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTATGGAGGAAACCGGGAAAATCTTCAAAAAGGAGAAGGAAATGAAAAAAGGGATTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCCATGAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTTATAGCACTGGAGAGGGAAAGGCAGGGATGCTNGACAGCGAACAACATTTTACAAAGGGACCGAC
  5   1   2       bld Panc 5g                         IMAGE:8737193.5p                                                                                                                                                                                                                                                                                                                             CTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGATTTGAGGTCCATGAAGTTTATGCTGTCGATGTCTATAGCACTGGAGAGGGAAAGCAAAGATGCGGACAGCGCCACACATTTACAAAGGAACCCCACTAAGCAGTATGACTGGAAATGAAACCTCCCGTGCTTTTCAGTGAGTTAGAGAGGCGCTGATGCCATGCATCACCTCTCCAGCATTGAGTAATGAAAAGAAGC
  5   1   2       bld Spl  5g3  in                    IMAGE:8464381.5p                                                                                                                                                                                                                                                                                                                              GNTGNTNCTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTATGGAGGAAACCGGGAAAATCTTCAAAAAGGAGAAGGAAATGAAAAAAGGGATTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCATAAGAAAGACCATGATAAAGCAGATTTGAAGTCTACGAAGTTACCCTGTAAATGTCTTATACCACTGAAAAGGAAAGCAAGGTAGCTGGACGCTACACAATTACAATAGA
  5   1   2       bld Neu7 5g                              XL030l07.5p                                                                                                                                                                                                                                                                                                                               CTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTAtggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTNATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCT
  5   1   2       bld Ga15 5g                            XL437j14ex.5p                                                                                                                                                                                                                                                                                                                               CTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAAGCAGAATTTGAGGTCCATGAAGTTTTATGCTGTCGATGTTCTTATTAGCACTGGAGAGGGAAAG
  5   1   2       bld Tad2 5g                         IMAGE:6931501.5p                                                                                                                                                                                                                                                                                                                                 GGGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCCGAACACACAAGTGACTGAAGCATGGAAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGGAATGCTTTTCTCACCAGCTTAAAGCACCATGTCCATTGATGGGAGAGGAGAACTATCCTTTCAGAAACCCCCCCTGGACCAGGCCAAAAGAAAGGAACCCTGGAAAAAAAGCCAGAAATTTTGGAGGGTCCCCTGGAAAGGTTTTATTGCTCGGTTCCCAAGTTTTCCA
  5   1   2       bld Lmb1 5g                         IMAGE:8531742.5p                                                                                                                                                                                                                                                                                                                                    GCANGGCCATCAATAGAATTCGTCCGTCGGAGGCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacaggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCACTGGAGAG
  5   1   2       bld Emb9 5g                         IMAGE:7978186.5p                                                                                                                                                                                                                                                                                                                                      TGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTATggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaaGGGATTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAATGGA
  5   1   2       bld Int2 5g                         IMAGE:8526502.5p                                                                                                                                                                                                                                                                                                                                      TGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTATGGAGGAAACCGGGAAAATCTTCAAAAAGGAGAAGGAAATGAAAAAAGGGATTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAGACTATCATTCAGACCCCACTGACCAGCAAAGAAAGACATGAAAAGCAGAATTGAGGTCACGAAGTTAGCTGTAATGTCTTATTACACTGAAGGAAGGCAAGGATCTGACGCAACACATTTACAAGGACCACTACGTAGCTGAATGAACTCCTGCTTTCTGATGAAGCCTTACATCCTCTCAAATTAGAAAAAG
  5   1   2       bld Em10 5g                         IMAGE:8320446.5p                                                                                                                                                                                                                                                                                                                                        CAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacaggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCACTGACCAGCAAAAGAAGACCATGAAAAGCAAATTTGAGGTCATGAAGTTATGCTGCGATGTCTTATTACCTGGAAGGAAAGGCAAGATCGGACGCCACACATTACAAAGGACCCTAGCGATGCTGAAAGAACTCCGTGCTTTCAGATA
  5   1   2       bld Spl  5g3  in                    IMAGE:8463831.5p                                                                                                                                                                                                                                                                                                                                         CGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATG
  5   1   2       bld Emb4 5g                         IMAGE:4201663.5p                                                                                                                                                                                                                                                                                                                                          GGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTTTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGGTGGAGCCTCAAAGGAGTGGTCCGGGGAACTGGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGGGGAGAAGCCCGTTCTGCGTTCTTGTTTAACCCGGGAAATCAGAAA
  5   1   2       bld Em10 5g                         IMAGE:7982675.5p                                                                                                                                                                                                                                                                                                                                          GGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGATAAACCAAATTTGAGGTCCATGAAAGTTATGCTGTCGATGTTCTTATTAGCACTGGAGAGGGAAAGGCA
  5   1   2       bld Ga18 5g3  in                        xlk3l21ex.5p                                                                                                                                                                                                                                                                                                                                                GTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTatggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAANCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGANCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGNNNCTGGACAGNGAACAACAATTTACAAAAGNNNCCNACTNAGCAGNNNGGCTTNAAATGAAAACNTNCCGNNNNNTTTTCAGTNAA
  5   1   2       bld DMZ  5g                              xl276a12.5p                                                                                                                                                                                                                                                                                                                                                GGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCA
  5   1   2       bld DMZ       in                         xl304j08.5p                                                                                                                                                                                                                                                                                                                                                      GAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTATggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaaGGGATTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGC
  5   1   2       bld Emb4 5g                         IMAGE:5514690.5p                                                                                                                                                                                                                                                                                                                                                       AAGAGCTGTCGGACGTAAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCCTTTCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGgaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCANAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCACTGGAGAGGGAAANGGCAANGATGCNGNACAGCGCANCACAATTTACAAANGGNACNNCCACTAGC
  5   1   2       bld Panc 5g                         IMAGE:8736480.5p                                                                                                                                                                                                                                                                                                                                                             TCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAAGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAGACCATGAAAAAGCAGAATTTGAGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCACTGGAGAGGGAAAGCAAAGATGCGGACAGCGCCACACATTTACAAAGGACCCACTAGCAGTATGCTGAAATGAAACTCCGTGCTTTTCATGAGTAGAGAGGCGCTTGATGCATGCATCACTCCTCAAGGCAATTGAG
  5   1   2       bld Emb4 5g                         IMAGE:5542833.5p                                                                                                                                                                                                                                                                                                                                                              ACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTATGGAGGAAACCGGGAAAATCTTCAAAAAGGAGAAGGAAATGAAAAAAGGGATTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAANAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGGTCCACGAAGTTTACGCCCTGGTAGATGTTNCTTATTAGCCACTGGGAAGAGGGAAAAGGGCAAGGGGATGCCTGGGACAAGCGAAACCAACAAATTTTACAAAAAAGGGGACCCCGAACTAANNNCAGTTAATGGGCTTTTGGaaaaatgaaaaaaaccctcccgntggccctttttttttCAAGGTGAAAAATTTGGAAAAAAGGGCCGCCCTTTTTGTATGGA
  5   1   2       bld Em10 5g                         IMAGE:8320335.5p                                                                                                                                                                                                                                                                                                                                                                GAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTTTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAGACTATCATTCAGACCCCACTGACAGCAAAGAAAGACCATGAAAACAGAATTGAGGTCATGAAGTATGCTGCGATGTTCTATAGCCTGGAAGGAAAGCAAGATCGGACACCACACATTACAAGGACCACTAGCTATGCTGAATGAACTCGTGCTTTATGATAAAGCCTGACAGCATCTCCAGCTGAGATAAAGCAA
  5   1   2       bld Em10 5g                         IMAGE:7980153.5p                                                                                                                                                                                                                                                                                                                                                                 GAGGCCACAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTTTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCACGCTAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCACTGACCAGCATAAGAAGACCATGAAAAGCAGATTTGAGGTCATGAATTTATGCTTCGATGTTCTATTACACTGGAAGGGAAAGCAAGGAGCGGACACGCACACATTTANAATGGACCCATAGCATATGCTGAAATAAACTCCGGCTTTCATGAGTAAAGCCTTGAGCAGCATCCTCAGCATTAGAGAAGAGCAATGGATG
  5   1   2       bld Em10 5g                         IMAGE:7979394.5p                                                                                                                                                                                                                                                                                                                                                                 GAGGCCACAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTTTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAGACCATGAAAAACAGATTTGANGTCATGAAGTTATGCTGTCGATGTTCTATAGCACTGAGAGGAAAGCAANGATCNGACACCACACATTACAAAGGACCACTAGCATATGCTGAATGAAACTCGTGCTTTCATGAGTAAAGCCTTATCATGCATCTCCAGCATGAGAGAAGAGCAATGATG
  5   1   2       bld Neu7 5g3  in                         XL004p12.5p                                                                                                                                                                                                                                                                                                                                                                   GCACAAACATGTCGGGTGACGAAGAACAGCAGGNAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAA
  5   1   2       bld Neu7      in                         XL032a05.5p                                                                                                                                                                                                                                                                                                                                                                           TCGGGTGACGATAGAACAGCAGGCAGCAGACCATACGCGGAGGACCTGGTGGTCACCAAGTACAAGCATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTatggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAANGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAG
  5   1   2       bld Ga12                                 XL180f21.5p                                                                                                                                                                                                                                                                                                                                                                             TGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTTTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGTTTTTGCAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGT
  5   1   2       bld Brn1                            IMAGE:6950011.5p                                                                                                                                                                                                                                                                                                                                                                                TCCGGAATTCTCGGGATGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacaggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTCGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAAGGCATTTGAGGATGAAAAGAAGCGAGAATGGGGAGTTGTGGAATGCGCCCAAACTGAA
  5   1   2       bld Ga18      in                       xlk52o14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                             ATCGCGGAGGANCTGGTGGTCACCAAGTACAAGATGGGGGGNGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTatggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAANCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGNCCACNNNNNNACGCTGTAGATGTTCTTATTAGCACTGGAGANGGAAAGNNAAGGGANNNTGGACAGCGAACAACAATTTACAAAAGGGANCCGACTAAGCAGNATGGCTTGAAAATGAAAANCTCCCGTGCCTTTTTCAGTGA
  5   1   2       bld Thy                             IMAGE:8549700.5p                                                                                                                                                                                                                                                                                                                                                                                                                 CGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTatggaggaaacaggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGATGCGGGACAGCGCACAACATTTACAAANGGNACCCACTAGCAGTATGGCTGAAATGAAAACTCCGTGCTTTTCAGTGAGTGAGAGCGCTTGAGCATGCATCATCTCAGCATTGAGATGAAGAGCAGATGGATGTG
  5   1   2       bld Ga12                                 XL148c24.5p                                                                                                                                                                                                                                                                                                                                                                                                                     GGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTAtggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGA
  3  -1   2       bld Bla2      in                    IMAGE:7295918.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTATGGAGGAAACCGGGAAAATCTTCAAAAAGGAGAAGGAAATGAAAAAAGGGATTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAGAAAGACCATGAAAAGCAGAATTTGAGTCCACGAAGTTATGCTGTAGAGTTCTTATAGCACTGGAAGGGAAGGCAAGGATCTGGACACAACACATTTACAAGGGACGACTAGCATATGCTGAATGAAACTCCTGCTTTNCATGAGTGAAGCCTTATCATGCTCCTCCACATGAGTAAGAGAGATGATTGAGCACATTACTAGTTGAGAGATCTATTCTCGTGAGCTTTTGTGCGCAAAAAAGTGGTACGGGGGCG
  5   1   2       bld Sp1       out                   IMAGE:4964301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGCAATGATTatggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTAC
  5   1   2       add Ga18      in                       xlk76b02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCATTTCTCACCTCTGAAAAGTGACCAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCNATGTCATCAAAGCAGNNNNCTTTGTGGAGAAGCCGCTCTNNNNTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATNCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGGAATGCGCCNNACATGAGCTTCTCCNACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGNTCAGTNNAAGTTCACTGTTCTCTTAATGCCNNANGGTCCTATGANGATAACTAGNGNCCCCTTTG
  5   1   2       bld Lmb1                            IMAGE:8531782.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGTCATCCATAANATTCGTCCCGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAG
  3   1   2       bld DMZ       in                         xl304j08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTGAAGG
  5   1   2       bld Skin                            IMAGE:8644863.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCACCTTTCATGTTCTTTATGAAAGGAGGGTGATTTGTACTCANTTCAGTCACTGTTCTCTATGCCNATGGTCTATGAGATAACTAGCGCCCTTTGACTGATTGTAAATCTGAGCTGAGTGCAGATCTGAGTGAAGCCTCTGCAGTCACAGTCTAACCAGAAGAGAAAGAAGCTCAATGCTAATCCTGTAGAATGAGCNATGAGAC
  5   1   2       bld Spl       in                    IMAGE:8463052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNGGATGGCTTCAATGCTAATGTTGCCCACCCCTTTGTAGATGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATACAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCATTGCCATTCACTCTCAGGGCATTTGATGATGAAAAGAAGGTGATGATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCATTGTCTTTTATGAAAAGGAAGGGGTATTTGTAACTAAATTCAAGTTCACTGTTCTTCTTATGAACAATTGGTCCTATGAGGAATACAAGAGGGCGCTTTTGAACTTGATTGGTAAAACACGACATTGGGTGAAAGATTCGGA
  3   1   2       bld Ga18 5g3  in                        xlk3l21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGCTGNNGNCATCAAAGCANCNNNNTTNNNGTAGNANCTNNCTGCGTCNTGNNAANCCAGNAAANCAGNNCTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATNTACTCCAATAGAAGGAATGCTTTCTCACNNNNNAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGANCCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAANCCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGNAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATNCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGNCCTGCCAGTTAATATTTTTTANNNNNNCGTTNTTT
  3   1   2       bld Neu7      in                         XL048p15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTT
  5   1   2       bld Skin                            IMAGE:8643850.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGAAACCGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGgaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaatgccactgctgaagaaaaTGA
  5   1   2       chi Ov1                             IMAGE:6317250.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGACGCGTGGGATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAGACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGTAAAGAAGGCAACAATGGGAGTTGCGGAATGCGCCAAAAACGAGCTTCTTCCAACCTTTTAATGTTCTTTTATGAAAAAGGAGGGCTGACTATGTAAGCTCCAGTCACCAGTTCCACTGGTTCTCTGTAATGGCCCAAGGGTCCCTATGCAAGAATAAACTAACCGccccccccATTTGGAAACCCTGGATTTTGGTCACAAAAAGCGTGGCGGCCCTTGTGAGGGTGCACAACGACTCCCTTGCAACCCGGAAAGGAGCCACATTTCTTGACAAAAGAGTTCCCCGAGCTAAAGCCACGCGCAAGACATCCTGCTCCCAAAATACGCCCAAGCTACAATGACACGCAAGCGGGTACATTGCACACAAAAAATACGGGCTTCGCGCAAAGAATATGTGCGCCCAACACCTGGGGCACTTGGCGCACGACTACGAAACACTGTCTATAAACCGGCGCAACCCCCACTTGTCGTAAAGTTGGGAGAAAAACACGCGCGATAATCGGCCTTATCTTTTCCTTCATCTCCCTTGCGGGCAGGAGGTGGCGGTATGCCGAGGTGGACCACTCTTTCTCTAAAACCCCCTGCGCCCACCGCGGCGTGTAGAGATCATCTGTCGTATTGTCAAAACAGACCGTCTATGTAGAGGGCGTATTATATTCGTTTCTGATGGGGACTCCCCTCTCCGCCTCTTTCAACTATTCATATCCGCCCCGGGAAACATACGTTAAAAACACATCGTCACAACTGGCCGAAAACTANGAGGCGACAAGACGAAACCTACACACTATCAGCTGAGACATCCTTCCTATTAATAGAGGGCGTCCCCATTGCTGAACCCCGGAGCGCCCCACGCAGCGTTGGGTGGGACAGGGACGTCCAACCTCGTTAAACCATCCCCACTGACAAAAGTGTCGTGTGATAACACACCCCCCTCATCTATGTCTCTCTCTTCTGAGGCGCAGG
  3   1   2       bld Ga12      in                         XL177e10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATANCTANCGGCC
  3   1   2       bld DMZ  5g3  in                         xl259a10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGGAAATCAGAACTCGCAAGTGACTGANGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCNTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTNTGANTTGANGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCnGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAACGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATT
  5   1   2       bld Ov1                    IMAGE:6317250-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCATTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGgaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaaTGCCACTGCTGAAGAAAATGAAGGCACTGAGT
  3   1   2       chi Ga18      in                       xlk52o14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TNANGCATGNANTAAANTTNCCCCNNNTTTTAAATNNNCNCNNNNNNANGNNATNNTTTCTCACNNNNNAAGCAGCATGTCATTGATGGANAAAAGACTNTCATTCAGAACCCCNCTGNNCAGCAAAAGAAAGNCCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAANCCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCANCCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATNCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGNCCTGCCAGTTAATATTTTTTANNNNNNCGTTNTTTTNNNNNCCCT
  5  -1   2       chi Bla2                            IMAGE:7298524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATAAATTTCCCCATCTTTAAATGTACTNCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTATGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaatgccactgctgaagaaaatgaaggcactgagtgaaaggaggcttttctctgaaaaaaaagaaaaaaaagaaaaagaaaaaaaaaaaaggaagaacataaaaaaaaaaaaaaCTCGAGGGGGGCCCGTCCCAATCGCCTTAGACTGGGGG
  3   1   2       bld FaBN 5g3  in                    IMAGE:8074582.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACTTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATGAACAAAGAAAAAAATAAATAGGG
  5  -1   2       bld Bla2      in                    IMAGE:7295918.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTACTCCATAAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTATGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGgaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaatgccactgctgaagaaaatgaaggcactgagtgaaaGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGTCAATaaaaaaaagaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGG
  3   1   2       bld Neu7      in                         XL032a05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCNCTGANCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCATTGAACCTGATTTGTACAAATCTGAGCTTNAGGTGCAAGATTCTGAGTTGAAGGCNCTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAnAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCNCTGAGTGAAAGGAGGCTTTTCCCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTATTTTGGCTCTCCCTTCTT
  3   1   2       bld Spl  5g3  in                    IMAGE:8464381.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTTGACGATGATCAGAGACAGAAATCCTTTTAGATCATGAGAGCTTCCAGTAGCGCATCTGAGGAAGCTTCTTAGACCCCTGCACNAAGAGACTGAAAGCAGATTGAGTCACGAGTTCGCTGTAATGTCTATACACTGAGAGGAAGCANNGGATGCTGACAGCGACAACAATTACAAAAGGACCGACTAGCAGTATGGCTGAAAATGAAACCTCCCGTGCCTTTTCAGTGAAGTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAATTTAAAAAGGCTCTCTACCTGTTCAGTCTGGGCAGCCAAGTGTGCGTTTGGATGTCGGATCCCCACTTTCCTTTTGGATGCAAACTTGGACATTCAAAGACATATTTCATACTAAACAAAATACACACACTTAAAACAAACAAACAGCGC
  5   1   2       bld Ov1       in                    IMAGE:8328952.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCATTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGgaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaaTGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCCCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACaaaaaaaaaaaaaaaG
  3   1   2       bld Ov1       in                    IMAGE:8328952.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCATTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCCCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTAAACAAAAAAAAAAAAAAAG
  3   1   2       bld Ga18      in                      xlk137p18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGNCCCGACTAAGCAGTATGGCTTGAAAATGAAANCCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATNCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCANCCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCNCTGTTCTCTTAATGCCCAATGGTCCTATGAGGATANCTAGCGGCCCCTTTGANCCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATnCCACTGCTGAAGAAAATGAAGGCNCTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGNCTNCCAGTTAATATTTTTTAGNNNNNCGTTNTTTNTGGCTCTCCCTTCTTTANCCTGACAATTAACATGAATTAANNCAANG
  5   1   2       bld Ga18      in                      xlk137p18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATTAGCACTGGAGAGGGAAAGGNAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTNNNNNATGCGCCAAACACGAGCTTCTNCNACCTTTTNA
  3   1   2       bld Emb4 5g3  in                    IMAGE:4959704.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTAAAAC
  3   1   2       bld Egg1                            IMAGE:3302351.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCAACAACATTTACAACAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTCTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAATTTAAAAAGGCAAA
  5   1   2       add Tbd5                            IMAGE:3580233.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTCCTTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAAGGCATTTGAGGATGAAAAGAACGCGACAATGGGAGTTGTGGAATGCGCCAAACATGAGCTACTCCAACCTTGCAATGTTCTTTATGAAACGGAGGGTGAA
  5   1   2       bld Lmb2                            IMAGE:8637759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGACTAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGgaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaatgccactgctgaagaaaaTGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGaaaaaaaaataaaaaatttaaaaaGGCTCTCTACCTGTTCAGTCTGGGCAGCCAAGTGTGCGTTTGGATGTCGGATCCCCACTTTCCTTTTGGATGCAAACTTGGACTTCAAAGACTATTTCATACTAAACAAATACACACCTATAAACAAAAATAAAGCAGGCTCaaaaaaaaaaaaaaaaaaaaaaGGCGCGCAGGCTGATTCCTAGACGCGCTCGGCTCCCCTAATGAGCTATACTAATCGACTGAAATCTGTGATTGACACCACAATGAGAAATGTT
  3   1   2       bld Neu7 5g3  in                         XL033p14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATAATNAAACAAANAAAAAAAAATAAAAAAT
  5   1   2       bld Thy                             IMAGE:8547175.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGATTCATAATTCTATTCGTCCGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGgaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaatgccactgctgaagaaaatgaaGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGaaaaaaaaataaaaaatttaaaaaGGCTCTCTACCTGTTCAGTCTGGGCAGCCAAGTGTGCGTTTGGATGTCGGATCCCCACTTTCCTTTTGGATGCAAACTTGGACATTCAAAGACATATTTCATactaaacaaaatacacacactataaaacaaaaaaataaaaGCAGGCATCAAATCAGTCTTTTTAGCCCCTCTTTCATACAGATATTGTACAGAGAAATGGACACGCCACTTCCAGGTTACTCTCAGTCAAAGCTGCAACGATATGTGGCAGTTACACTTGTAA
  5   1   2       bld DMZ       in                         xl248o02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCGATTCGGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGgaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaatgccactgctgaagaaaatgaagGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl248o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACCTTGCGTTA
  3   1   2       bld Egg1                               PBX0001D08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGGACAAATTTGAGCTTGAGGTGCAAGATTTTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCCCTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGGACCTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAATTTAAAAAGGCAAAAAAAAAAAAAAAAAAAAAAGATTC
  3   1   2       bld FaBN 5g3  in                    IMAGE:8074390.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGATGAAGAAGGCAAGAATGGAGTTGTGAATGCGCCAAACACGAGTTCTTCACCTTTTAATGTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCATTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCCCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAAATTTAAAAAGGCTCTCTACCTGTTCAGTCTGGGCAGCCAAGTGTGCGTTTGGATGTCGGATCCCCACTTTCCTTTTGGATGCAAACTTGGACATTCAAAGACATATTTCATACTAAACAAAATACACACACTATAAAACAAAAAAATAAAAGCAGGCATCAAATCAGTCTTTTTAGCCCCTCTTTCTATACAGATATTGTTACAGAGAAATGGAACACGCCACCTTCCAGGTTTACTCTTCAGTCAAAAGCCTGCAGACGATTATGTGGCAGGTTTTACAACTGTAAACCAGGAGAGAGCATAACTTCTGG
  3   1   2       bld Egg1                               PBX0001A07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATTTGAGCTTGAGGTGCAAGATTTTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCCCTGCTGAAGAAAATGAAGGCCCTGAGTGAAAGGAGGCTTTTCTTTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGGACCTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAATTTAAAAAGGCAAAAAAAAAAAAAAAAAAAAAAGATTC
  5   1   2       bld Ga15      in                       XL482b13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 gaaaaagaaggcatcaaaaaatgctgaaaatgccactgctgaagaaaatgaAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTaaaacaaagaaaaaaaaataaaaaatttaaaaaggcaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL482b13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAAC
  5   1   2      en>5                            Xl3.1-IMAGE:7298555.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTTGGAATTCTCTCCAGACTAAACCAAAAGTATATATTTTTCTTGTTC
                                                  Xl3.1-CHK-1012693181                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTTGGAATTCTCTCCAGACTAAACCAAAAGTATATATxTxTxTTGTTCAATGCA
  5  -1   2       bld Bla2                            IMAGE:7298555.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGCCCGcccccccccccccccGTAGAAAAAAATTTCAAATGGTGATGTNGCTACCATTGCAGGTCGAGGAACATACACGCTTGGAACTGGTTTACAGATCGACACAGNTGACTGATATTTCAGATAATGCTCATAGAGATCTCTCCAGCTAGCGCTGTCTGATGAGAGAGATATCATCAGACCCCCTGACAGCAAAGAAGACCTGAAAAACAGATTGAGGTCCATGAAGTTATGCTGTCGATGNCTTATTAGCACTGGAGAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTaaaacccagaagaagaagaaaaagaaggcatcaaaaactgctgaaaatGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGttttttttttttgcctctcccttctttatcctgacaattaaacaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCATCGCCCAAGAAGCG
  3   1   2       bld Thy  5g3  in                    IMAGE:8548746.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCAGATAATATCATGAGATGTCTCCAGTAGCGCATCTGAGAGGAGATTCATAGACCATGCCAGCNAAGAGACTGAAAGCAGATTGAGTCATGAGTTAGCTGTGATGTCTATAGCCTGAGAGGAAAGCAAAGATGCGGACAGCGCACACAATTTCAAAAGGACCCCACAAGCAGTAGGCNTGAAAAGAAAACCTCCCGTGCCTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTATACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCACACTCGGACATTCAAACACACATTTCGAATTCTGTCCCTTTTTTACATTTTATTATTTTTTTTTCTTGTTCAATGCAGAAGATGAGG
  3   1   2       bld Spl  5g3  in                    IMAGE:8463831.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGATTATATCAGAGAGTTTCCATTAGCCATCTGTGGAGAGTTTATCGACCCTGCGCAAAGAAGCCGAAAAGCGATTGAGTCAGAAGTTATCTGCATGTCTATAGCCTGAGAGGAAGCAAAGATGCGGACAGGCACACAATTACAAAGGACCCCACTAGCAGTATGCCTGAAAAGAAAACCTCCCGTGCCTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTTGGAATTCTCTCCAGACATAACCAAAAGTATATCTTGTTCAATGCAGAAGAGAGGGG
  3   1   2       bld Spl       in                    IMAGE:8463052.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCTGTGGGAGCTCCTCAACCCCTGCACAAAGAAGACTGAAGCAGATTGAGTCCTGAGTATGCGTGATGTCTTTAGCATGAGAGGAAGCAAAGATGCGGCAGGCACACATTTACAAAGGACCCCACTAGCAGTATGCTGAAAATGAAACCTCCCGTGCCTTTTCAGTGAAGAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTCGAATTCTCTCCCGATTAAACACATTAAGTATTTTTTTTCTTGTTCAATGCAGAAAACGAGG
  3   1   2      seed Em10 5g3  in                    IMAGE:7981486.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCACTGGAGAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTTGGAATTCTCTCCAGACTAAACCAAAAGTATATATATATCATTGTTACAATTGACAAGGAAAA
  3   1   2       add DMZ  5g3  in                         xl322e03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGAGAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTNCNAAAGGGACCCCNCTNAGCNGTATGGCCTGAAAATGAAAACCTCCCGNGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCNTTCNCTNTCAGGGCNTTTGAGGANGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACNTGAGCTTNTCCNACCTTTCAATGTTNTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCNCTGTTNTTTTAATGCCCNATGGTCCTATGAGGATAACTAGCGGCCCCTTTGNACCTGATTTGTACAAATTTGAGCTTGAGGTGCAAGATTTTGAGTTGAAGGCNCTTTTGCAAAGTTCAGCAAGTNGTAAAACCCCGAAGAAGAAGAAAAAGAAGGCnTCAAAAACTGCTGAAAATGCCCCTGCTGAAGAAAATGAAGGCCCNGAGTGAAAGGNGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAAT
  5   1   2       bld Skin                            IMAGE:8643061.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTCGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGTGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAaaacccaaaagaagaagaaaaagaaggcatcaaaaactgctgaaaatgccactgctgaagaaaaTGAAGGCACAGAGTGAAAGGAGGCTTTTCCCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGGttttttttttttttgcctctcccttctttatcctgacaattgaaacaaagaaaaaaaaaataataaaaaatttaaaaaGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAACTTGGACATTCAAAGACATATTTTGGAATCTCTCCAGACTAACCNNAAGTTATATATATAATAAACTATAAATAAAGCGGGCTCAAGCaaaaaaaaaaaaaaaaaaGGCGGCCCATTGATGTGACANCTGGTAGTC
  5   1   2       bld Egg1                               PBX0123G06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAAcccaaaagaagaagaaaaagaaggcatcaaaaactgctgaaaatgccactgctgaagaaaaTGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGttttttttttttGTCTCTCCCTT
  3   1   2       add Neu7 5g3  in                         XL032f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATNAAAACCTCCCGTGCCTTTTTCAGTNAAGTANANAGGCGCTTTNATGCAATGCCATTCACTNTCAGGGCATTTNAGGATGAAAANAAGGCGANAATGGGAGTTGTGGAATGCGCCAAACATNAGCTTNTCCAACCTTTCAATGTTNTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCNCTGTTCTCTTAATGCCCAATGGTCCTATNAGGATAACTAGCGGCCCCTTTGAACCTGATTTGNACAAATCTGAGCTTNAGGTGCAAGATTNTGAGTTNAAGGCACTTCTGCAAAGTTCAGCNAGTCGTAAAACCCAGAANAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCNCTGCTGAAGAAAATGAAGGCNCAGAGTGAAAGGAGGCTTT
  3   1   2       add Neu7 5g3  in                         XL004p12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GNGCTTTNATGCAATGCCATTCNCTNTCAGGGCATTTNAGGATNAAAANAAGGCGANAATGGGAGTTNTGGAATGCGCCAAACATGAGCTTNTCCAACCTTTCAATGTTNTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCNCTGTTCTNTTAATGCCCAATGGTCCTATGAGGATAACNAGCGGCCCCTTTGAACCTGATTTGNACAAATCTGAGCTTNAGGNGCAAGATTNTGAGTTGAAGGCNCTTCTGCAAAGTTCAGCNAGTCGTAAAACCCnGAAGAAGAAGAAAAAGAAGGCnTCnAAAACTGCTGAAAATGCCnCTGCTGAAGAAAATGAAGGCNCAGAGTGAAAGGAGGCTTTTCTC
  3   1   2       bld Em10 5g3  in                    IMAGE:7981578.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTGAACCTGATTTGTACAAATTTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCAATTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAAAGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTTTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCGAGGACCTATTTTACAATTCTCTTATTTTTTTTTCCTTGTTACAAATTGTCCAAGAAACAG
  5   1   2       bld Emb4                            IMAGE:4684200.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTAGATCGCGACCTGCCAGTTAATATTTTTAGTACTTGCGtttttttttttttGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGaaaaaaaaataataaaatgtaaaaaaGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTTGGAATTCTCTCCAGactaaaccaaaagtatatatatataaataaaactataaaataaaaGCAGGCATCAAAGCAGTCTTTTAGCCCTCTTTCTATACAGATATTGTTACATCGAAAAGGAACACACCACCTTCCAGGTTACTCTTCTTCTGTCGACAATGATGATTATACGGCAGGTTTTGCCACTTGTTAAACGTGAAGTAGAGCAATTATTCCTGTACTGTGTGCACTAACTTACCCATGTGAGTTGTTCTGGAGCCATTGCTTCTGCAGCGGTACAGGGATCTTAAGCTACAGCATGTCAGACACATTTTTTAGATAATGGCCGTTTATGTGAATTTGTAACAATTTTTATATAGCTATTTACATATTTGTGAGCTAATTAGCGGAACAAATCTATATCACGGATTGCCGGTCATTTTTCGTCTAACTGCCTCTGCATTCGACAACTAAAGTGGAGCACATTTAATAGATGGACCTTGCACACATGCAAAACACAAATGCCAGTTTTGCCAAAAGATGTTGAAAGACCCCTGAAGTCAACCCTGGGGAATAGGTCATCAATTTTGTGGAATTGCTGAAAAACCTTTTAGNTATTACAGTTAAAGTGACTGTCCTGATAAAATATCCAAAACTCCCAAAAAAGGACAATGGAAGTACCCTTCAGGGGTTTTTCCGGTATGAATGAGGGGAAAAAATGGCCTAACTTTGCAATAATTGAAATTAAGTCCTTTTGGGAACATTAAAA
  3  -1   2       add Ga18      in                       xlk76b02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTACCTGTTCAGTCCGGGCAGCCGAGTNTNCGGNTNGATGNGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATNTTGGAATTCTCTCCAGACTAAACCAAAAGTnTnTnTnTnTnNATNAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)