Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 20 Jan 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

 This cluster: approximate FL confidence score = 97%

 1012837274 Xl3.1-IMAGE:8821599.5.5 - 121 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                      3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     5     9     6    14     8    18    18    28    21    30    25    36    31    49    36    57    37    60    62    65    64    68    64    68    64    69    68    71    68    71    70    71    69    71    58    71    71    72    71    72    71    72    71    72    71    72    72    73    65    73    71    72    71    72    71    72    71    72    71    72    71    72    72    72    71    73    72    75    73    76    73    76    71    75    73    74    73    75    72    73    70    73    69    71    68    71    67    71    68    71    68    73    68    74    68    74    64    72    69    75    72    75    70    76    69    77    70    78    68    78    68    78    67    78    71    80    61    76    59    76    51    74    43    71    37    68    39    70    35    67    32    64    32    63    31    62    26    57    29    57    29    58    27    57    29    56    30    53    30    52    34    50    32    49    34    47    35    45    35    44    38    44    36    45    39    43    38    43    31    42    35    42    36    42    37    41    37    41    38    41    36    41    36    41    34    41    33    38    35    39    35    38    34    38    31    37    30    36    34    36    29    36    33    35    35    37    35    37    30    37    35    36    27    35    33    34    29    33    30    34    30    33    17    32    16    29    16    27    16    26    13    25     9    22     9    19     8    17     7    16     7    15     6    13     7    13     7    13     7    13     6    13     4    13     4    13     4    13
  5   1   2      en>5                            Xl3.1-IMAGE:7298555.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTTGGAATTCTCTCCAGACTAAACCAAAAGTATATATTTTTCTTGTTC
                                                                   VAR                                                                                                                                                                                                                                                                         CCTCCAGCGCCCTCGCGCTCTCTCTGCCCGTCGCCTCCACAGCCGCTGCCACTGCTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGCTGTCGATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAATAAAATGTAAAAAAGCCTCTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTCTACCTGTTCAGTCTGGGCAGCCAAGTGTGCGTTTGGATGTCGGATCCCCACTTTCCTTTTGGATGCAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                         T--C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                         --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                             -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----TG-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --C--G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T--C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     T-G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T-T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --T-----C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --G--------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -C----------
                                               BLH ATG     219    2612                                                                                                                                                 
                                               BLH MIN     195     297                                                                                                                                                 
                                               BLH MPR     186     297                                                                                                                                                 
                                               BLH OVR     219      51                                                                                                                                                 
                                               EST CLI     136      25                                                                                                                                                 
                                               ORF LNG     219       5                                                                                                                                                 
  5   1   2       bld Brn1 5g                         IMAGE:6952610.5p                                                                                                                                                                                                                                                               GCCTCCAGCGCCCTCGCGTTCTCTCTGCCTGTCGCCTCCGCGCGCTGCTGCAGCCTTTGCCACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTTTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCAAAATCTTCaaaaaaaaaaaaaaaaaaaaaaaaaGG
  5   1   2       bld Neu7 5g                              XL040f05.5p                                                                                                                                                                                                                                                                                                                            ACTGCTTGTACTCAGGACTGGGTGAAAGAGCTGTCGGAGGCCACAAACATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTATGGAGGAAACGGGCaaaatcttcaaaaaggagaaggaaatgaaaaaaggaatTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTC
  5   1   2       bld Neu7 5g                              XL030l07.5p                                                                                                                                                                                                                                                                                                                               CTGATACTGAGGAAGGGGTGAAAGAGCTGTCACAGGCCCACAAAGATGTCGGGTGACGAAGAACAGCAGGAGCAGACCATCGCGGAGGACCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTACTGCGTGCTCTGGTGGATACAGCAACAGCTGGGGCTTCACTCCTTAATTTGTGTGAGAAAGGTGATGCAATGATTAtggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTNATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCT
  5   1   2       bld Ga12                                 XL148c24.5p                                                                                                                                                                                                                                                                                                                                                                                                                     GGATCTGGTGGTCACCAAGTACAAGATGGGGGGCGACATTGCCAACAGGGTCCTGCGCACTCTGTTGGATACAGCAACAGCTGGGGCATCACTCCTTAATTTGTGTGAGAAGGGTGATGCAATGATTAtggaggaaacgggcaaaatcttcaaaaaggagaaggaaatgaaaaaaggaaTTGCTTTCCCAACGAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGTGATCTGGTGAAAATCGATCTAGGTGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGA
  5   1   2       bld Sp1       out                   IMAGE:4964301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGCAATGATTatggaggaaaccgggaaaatcttcaaaaaggagaaggaaatgaaaaaagggaTTGCTTTCCCAACAAGTATATCTGTAAATAATTGTGTGTGTCATTTCTCACCTCTGAAAAGTGACCAAGATTATCTGCTCAAGGATGGGGATCTTGTGAAAATCGATCTAGGAGTTCATGTGGATGGCTTCATTGCTAATGTTGCCCACAGCTTTGTTGTTGGAGCCTCAAAGGAGTGTCCGGTGACTGGACGTAAAGCTGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTAC
  5   1   2       bld Spl       in                    IMAGE:8463052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNGGATGGCTTCAATGCTAATGTTGCCCACCCCTTTGTAGATGGAGCCTCAAAGGAGTGTCCGGTGACTGGGCGTAAAGCCGATGTCATCAAAGCAGCGCATCTTTGTGGAGAAGCCGCTCTGCGTCTTGTTAAACCAGGAAATCAGAACACACAAGTGACTGAAGCATGGAATAAAATTTCTCCAGAATTTAAATGTACTCCAATACAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAGAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCATGAAGTTTATGCTGTCGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCATTGCCATTCACTCTCAGGGCATTTGATGATGAAAAGAAGGTGATGATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCATTGTCTTTTATGAAAAGGAAGGGGTATTTGTAACTAAATTCAAGTTCACTGTTCTTCTTATGAACAATTGGTCCTATGAGGAATACAAGAGGGCGCTTTTGAACTTGATTGGTAAAACACGACATTGGGTGAAAGATTCGGA
  3   1   2       bld Ga18 5g3  in                        xlk3l21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGCTGNNGNCATCAAAGCANCNNNNTTNNNGTAGNANCTNNCTGCGTCNTGNNAANCCAGNAAANCAGNNCTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATNTACTCCAATAGAAGGAATGCTTTCTCACNNNNNAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGANCCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAANCCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGNAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATNCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGNCCTGCCAGTTAATATTTTTTANNNNNNCGTTNTTT
  3   1   2       bld Neu7      in                         XL048p15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATGTCATCAAAGCAGCCCATCTTTGTGTAGAAGCTGCCCTGCGTCTTGTGAAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTT
  5   1   2       bld Skin                            IMAGE:8643850.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGAAACCGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGgaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaatgccactgctgaagaaaaTGA
  3   1   2       bld Ga12      in                         XL177e10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACCAGGAAATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATANCTANCGGCC
  3   1   2       bld DMZ  5g3  in                         xl259a10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGGAAATCAGAACTCGCAAGTGACTGANGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCNTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTNTGANTTGANGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCnGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAACGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATT
  5   1   2       bld Ov1                    IMAGE:6317250-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGAACTCGCAAGTGACTGAAGCATGGAATAAAATTTCCCCATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCATTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGgaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaaTGCCACTGCTGAAGAAAATGAAGGCACTGAGT
  3   1   2       chi Ga18      in                       xlk52o14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TNANGCATGNANTAAANTTNCCCCNNNTTTTAAATNNNCNCNNNNNNANGNNATNNTTTCTCACNNNNNAAGCAGCATGTCATTGATGGANAAAAGACTNTCATTCAGAACCCCNCTGNNCAGCAAAAGAAAGNCCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAANCCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCANCCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATNCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGNCCTGCCAGTTAATATTTTTTANNNNNNCGTTNTTTTNNNNNCCCT
  5  -1   2       chi Bla2                            IMAGE:7298524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATAAATTTCCCCATCTTTAAATGTACTNCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTATGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaatgccactgctgaagaaaatgaaggcactgagtgaaaggaggcttttctctgaaaaaaaagaaaaaaaagaaaaagaaaaaaaaaaaaggaagaacataaaaaaaaaaaaaaCTCGAGGGGGGCCCGTCCCAATCGCCTTAGACTGGGGG
  3   1   2       bld FaBN 5g3  in                    IMAGE:8074582.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCTTTTAAATGTACTCCAATAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACTTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATGAACAAAGAAAAAAATAAATAGGG
  5  -1   2       bld Bla2      in                    IMAGE:7295918.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTACTCCATAAGAAGGAATGCTTTCTCACCAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCACTGACCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTATGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGgaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaatgccactgctgaagaaaatgaaggcactgagtgaaaGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGTCAATaaaaaaaagaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGG
  3   1   2       bld Neu7      in                         XL032a05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCTAAAGCAGCATGTCATTGATGGAGAAAAGACTATCATTCAGAACCCCNCTGANCAGCAAAAGAAAGACCATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCATTGAACCTGATTTGTACAAATCTGAGCTTNAGGTGCAAGATTCTGAGTTGAAGGCNCTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAnAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCNCTGAGTGAAAGGAGGCTTTTCCCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTATTTTGGCTCTCCCTTCTT
  3   1   2       bld Spl  5g3  in                    IMAGE:8464381.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTTGACGATGATCAGAGACAGAAATCCTTTTAGATCATGAGAGCTTCCAGTAGCGCATCTGAGGAAGCTTCTTAGACCCCTGCACNAAGAGACTGAAAGCAGATTGAGTCACGAGTTCGCTGTAATGTCTATACACTGAGAGGAAGCANNGGATGCTGACAGCGACAACAATTACAAAAGGACCGACTAGCAGTATGGCTGAAAATGAAACCTCCCGTGCCTTTTCAGTGAAGTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAATTTAAAAAGGCTCTCTACCTGTTCAGTCTGGGCAGCCAAGTGTGCGTTTGGATGTCGGATCCCCACTTTCCTTTTGGATGCAAACTTGGACATTCAAAGACATATTTCATACTAAACAAAATACACACACTTAAAACAAACAAACAGCGC
  5   1   2       bld Ov1       in                    IMAGE:8328952.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGAAAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCATTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGgaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaaTGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCCCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACaaaaaaaaaaaaaaaG
  3   1   2       bld Ov1       in                    IMAGE:8328952.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAGCAGAATTTGAGGTCCACGAAGTTTACGCTGTAGATGTTCTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCATTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCCCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTAAACAAAAAAAAAAAAAAAG
  3   1   2       bld Ga18      in                      xlk137p18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTATTAGCACTGGAGAGGGAAAGGCAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGNCCCGACTAAGCAGTATGGCTTGAAAATGAAANCCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATNCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCANCCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCNCTGTTCTCTTAATGCCCAATGGTCCTATGAGGATANCTAGCGGCCCCTTTGANCCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATnCCACTGCTGAAGAAAATGAAGGCNCTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGNCTNCCAGTTAATATTTTTTAGNNNNNCGTTNTTTNTGGCTCTCCCTTCTTTANCCTGACAATTAACATGAATTAANNCAANG
  5   1   2       bld Ga18      in                      xlk137p18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATTAGCACTGGAGAGGGAAAGGNAAGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTNNNNNATGCGCCAAACACGAGCTTCTNCNACCTTTTNA
  3   1   2       bld Emb4 5g3  in                    IMAGE:4959704.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGATGCTGGACAGCGAACAACAATTTACAAAAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTAAAAC
  3   1   2       bld Egg1                            IMAGE:3302351.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCAACAACATTTACAACAGGGACCCGACTAAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTCTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAATTTAAAAAGGCAAA
  5   1   2       add Tbd5                            IMAGE:3580233.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTCCTTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAAGGCATTTGAGGATGAAAAGAACGCGACAATGGGAGTTGTGGAATGCGCCAAACATGAGCTACTCCAACCTTGCAATGTTCTTTATGAAACGGAGGGTGAA
  5   1   2       bld Lmb2                            IMAGE:8637759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGACTAGCAGTATGGCTTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGgaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaatgccactgctgaagaaaaTGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGaaaaaaaaataaaaaatttaaaaaGGCTCTCTACCTGTTCAGTCTGGGCAGCCAAGTGTGCGTTTGGATGTCGGATCCCCACTTTCCTTTTGGATGCAAACTTGGACTTCAAAGACTATTTCATACTAAACAAATACACACCTATAAACAAAAATAAAGCAGGCTCaaaaaaaaaaaaaaaaaaaaaaGGCGCGCAGGCTGATTCCTAGACGCGCTCGGCTCCCCTAATGAGCTATACTAATCGACTGAAATCTGTGATTGACACCACAATGAGAAATGTT
  3   1   2       bld Neu7 5g3  in                         XL033p14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCTTTTTCAGTGAAGTTGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATAATNAAACAAANAAAAAAAAATAAAAAAT
  5   1   2       bld Thy                             IMAGE:8547175.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGATTCATAATTCTATTCGTCCGCAATGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGgaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaatgccactgctgaagaaaatgaaGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGaaaaaaaaataaaaaatttaaaaaGGCTCTCTACCTGTTCAGTCTGGGCAGCCAAGTGTGCGTTTGGATGTCGGATCCCCACTTTCCTTTTGGATGCAAACTTGGACATTCAAAGACATATTTCATactaaacaaaatacacacactataaaacaaaaaaataaaaGCAGGCATCAAATCAGTCTTTTTAGCCCCTCTTTCATACAGATATTGTACAGAGAAATGGACACGCCACTTCCAGGTTACTCTCAGTCAAAGCTGCAACGATATGTGGCAGTTACACTTGTAA
  5   1   2       bld DMZ       in                         xl248o02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCGATTCGGCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGgaaaacccagaaaaagaagaaaaagaaggcatcaaaaaatgctgaaaatgccactgctgaagaaaatgaagGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl248o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCATTCACTCTCAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACCTTGCGTTA
  3   1   2       bld Egg1                               PBX0001D08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAGCATTTGAGGATGAAAAGAAGGCAAGAATGGGAGTTGTGGAATGCGCCAAACACGAGCTTCTTCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGGACAAATTTGAGCTTGAGGTGCAAGATTTTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCCCTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGGACCTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAATTTAAAAAGGCAAAAAAAAAAAAAAAAAAAAAAGATTC
  3   1   2       bld FaBN 5g3  in                    IMAGE:8074390.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGATGAAGAAGGCAAGAATGGAGTTGTGAATGCGCCAAACACGAGTTCTTCACCTTTTAATGTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCATTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCCCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAAATTTAAAAAGGCTCTCTACCTGTTCAGTCTGGGCAGCCAAGTGTGCGTTTGGATGTCGGATCCCCACTTTCCTTTTGGATGCAAACTTGGACATTCAAAGACATATTTCATACTAAACAAAATACACACACTATAAAACAAAAAAATAAAAGCAGGCATCAAATCAGTCTTTTTAGCCCCTCTTTCTATACAGATATTGTTACAGAGAAATGGAACACGCCACCTTCCAGGTTTACTCTTCAGTCAAAAGCCTGCAGACGATTATGTGGCAGGTTTTACAACTGTAAACCAGGAGAGAGCATAACTTCTGG
  3   1   2       bld Egg1                               PBX0001A07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCAACCTTTTAATGTTCTTTATGAAAAGGAGGGTGAATATGTAGCTCAGTACAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATTTGAGCTTGAGGTGCAAGATTTTGAGTTGAAGGCACTTTTGCAAAGTTCAGCAAGTCGGAAAACCCAGAAAAAGAAGAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCCCTGCTGAAGAAAATGAAGGCCCTGAGTGAAAGGAGGCTTTTCTTTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGGACCTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTGAAACAAAGAAAAAAAAATAAAAAATTTAAAAAGGCAAAAAAAAAAAAAAAAAAAAAAGATTC
  5   1   2       bld Ga15      in                       XL482b13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 gaaaaagaaggcatcaaaaaatgctgaaaatgccactgctgaagaaaatgaAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAACATGAATTaaaacaaagaaaaaaaaataaaaaatttaaaaaggcaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL482b13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAAAAGAAGGCATCAAAAAATGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACTGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTTAGTACTTGCGTTATTTTTGGCTCTCCCTTCTTTATCCTGACAATTAAC
  5   1   2      en>5                            Xl3.1-IMAGE:7298555.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTTGGAATTCTCTCCAGACTAAACCAAAAGTATATATTTTTCTTGTTC
                                                  Xl3.1-CHK-1012693181                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTTGGAATTCTCTCCAGACTAAACCAAAAGTATATATxTxTxTTGTTCAATGCA
  5  -1   2       bld Bla2                            IMAGE:7298555.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGCCCGcccccccccccccccGTAGAAAAAAATTTCAAATGGTGATGTNGCTACCATTGCAGGTCGAGGAACATACACGCTTGGAACTGGTTTACAGATCGACACAGNTGACTGATATTTCAGATAATGCTCATAGAGATCTCTCCAGCTAGCGCTGTCTGATGAGAGAGATATCATCAGACCCCCTGACAGCAAAGAAGACCTGAAAAACAGATTGAGGTCCATGAAGTTATGCTGTCGATGNCTTATTAGCACTGGAGAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTaaaacccagaagaagaagaaaaagaaggcatcaaaaactgctgaaaatGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGttttttttttttgcctctcccttctttatcctgacaattaaacaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCATCGCCCAAGAAGCG
  3   1   2       bld Thy  5g3  in                    IMAGE:8548746.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCAGATAATATCATGAGATGTCTCCAGTAGCGCATCTGAGAGGAGATTCATAGACCATGCCAGCNAAGAGACTGAAAGCAGATTGAGTCATGAGTTAGCTGTGATGTCTATAGCCTGAGAGGAAAGCAAAGATGCGGACAGCGCACACAATTTCAAAAGGACCCCACAAGCAGTAGGCNTGAAAAGAAAACCTCCCGTGCCTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTATACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCACACTCGGACATTCAAACACACATTTCGAATTCTGTCCCTTTTTTACATTTTATTATTTTTTTTTCTTGTTCAATGCAGAAGATGAGG
  3   1   2       bld Spl  5g3  in                    IMAGE:8463831.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGATTATATCAGAGAGTTTCCATTAGCCATCTGTGGAGAGTTTATCGACCCTGCGCAAAGAAGCCGAAAAGCGATTGAGTCAGAAGTTATCTGCATGTCTATAGCCTGAGAGGAAGCAAAGATGCGGACAGGCACACAATTACAAAGGACCCCACTAGCAGTATGCCTGAAAAGAAAACCTCCCGTGCCTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTTGGAATTCTCTCCAGACATAACCAAAAGTATATCTTGTTCAATGCAGAAGAGAGGGG
  3   1   2       bld Spl       in                    IMAGE:8463052.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCTGTGGGAGCTCCTCAACCCCTGCACAAAGAAGACTGAAGCAGATTGAGTCCTGAGTATGCGTGATGTCTTTAGCATGAGAGGAAGCAAAGATGCGGCAGGCACACATTTACAAAGGACCCCACTAGCAGTATGCTGAAAATGAAACCTCCCGTGCCTTTTCAGTGAAGAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTCGAATTCTCTCCCGATTAAACACATTAAGTATTTTTTTTCTTGTTCAATGCAGAAAACGAGG
  3   1   2      seed Em10 5g3  in                    IMAGE:7981486.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCACTGGAGAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTTGGAATTCTCTCCAGACTAAACCAAAAGTATATATATATCATTGTTACAATTGACAAGGAAAA
  3   1   2       add DMZ  5g3  in                         xl322e03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGAGAGGGAAAGGCAAAGGATGCGGGACAGCGCACAACAATTTNCNAAAGGGACCCCNCTNAGCNGTATGGCCTGAAAATGAAAACCTCCCGNGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCNTTCNCTNTCAGGGCNTTTGAGGANGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACNTGAGCTTNTCCNACCTTTCAATGTTNTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCNCTGTTNTTTTAATGCCCNATGGTCCTATGAGGATAACTAGCGGCCCCTTTGNACCTGATTTGTACAAATTTGAGCTTGAGGTGCAAGATTTTGAGTTGAAGGCNCTTTTGCAAAGTTCAGCAAGTNGTAAAACCCCGAAGAAGAAGAAAAAGAAGGCnTCAAAAACTGCTGAAAATGCCCCTGCTGAAGAAAATGAAGGCCCNGAGTGAAAGGNGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAAT
  5   1   2       bld Skin                            IMAGE:8643061.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAAGGATGCGGGACAGCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTCGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGTGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAaaacccaaaagaagaagaaaaagaaggcatcaaaaactgctgaaaatgccactgctgaagaaaaTGAAGGCACAGAGTGAAAGGAGGCTTTTCCCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGGttttttttttttttgcctctcccttctttatcctgacaattgaaacaaagaaaaaaaaaataataaaaaatttaaaaaGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAACTTGGACATTCAAAGACATATTTTGGAATCTCTCCAGACTAACCNNAAGTTATATATATAATAAACTATAAATAAAGCGGGCTCAAGCaaaaaaaaaaaaaaaaaaGGCGGCCCATTGATGTGACANCTGGTAGTC
  5   1   2       bld Egg1                               PBX0123G06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCACAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATGAAAACCTCCCGTGCCTTTTTCAGTGAAGTAGAGAGGCGCTTTGATGCAATGCCATTCACTCTCAGGGCATTTGAGGATGAAAAGAAGGCGAGAATGGGAGTTGTGGAATGCGCCAAACATGAGCTTCTCCAACCTTTCAATGTTCTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCACTGTTCTCTTAATGCCCAATGGTCCTATGAGGATAACTAGCGGCCCCTTTGAACCTGATTTGTACAAATCTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCACTTCTGCAAAGTTCAGCAAGTCGTAAAAcccaaaagaagaagaaaaagaaggcatcaaaaactgctgaaaatgccactgctgaagaaaaTGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTCTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGttttttttttttGTCTCTCCCTT
  3   1   2       add Neu7 5g3  in                         XL032f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAACAATTTACAAAAGGGACCCCACTAAGCAGTATGGCCTGAAAATNAAAACCTCCCGTGCCTTTTTCAGTNAAGTANANAGGCGCTTTNATGCAATGCCATTCACTNTCAGGGCATTTNAGGATGAAAANAAGGCGANAATGGGAGTTGTGGAATGCGCCAAACATNAGCTTNTCCAACCTTTCAATGTTNTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCNCTGTTCTCTTAATGCCCAATGGTCCTATNAGGATAACTAGCGGCCCCTTTGAACCTGATTTGNACAAATCTGAGCTTNAGGTGCAAGATTNTGAGTTNAAGGCACTTCTGCAAAGTTCAGCNAGTCGTAAAACCCAGAANAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAATGCCNCTGCTGAAGAAAATGAAGGCNCAGAGTGAAAGGAGGCTTT
  3   1   2       add Neu7 5g3  in                         XL004p12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GNGCTTTNATGCAATGCCATTCNCTNTCAGGGCATTTNAGGATNAAAANAAGGCGANAATGGGAGTTNTGGAATGCGCCAAACATGAGCTTNTCCAACCTTTCAATGTTNTTTATGAAAAGGAGGGTGAATTTGTAGCTCAGTTCAAGTTCNCTGTTCTNTTAATGCCCAATGGTCCTATGAGGATAACNAGCGGCCCCTTTGAACCTGATTTGNACAAATCTGAGCTTNAGGNGCAAGATTNTGAGTTGAAGGCNCTTCTGCAAAGTTCAGCNAGTCGTAAAACCCnGAAGAAGAAGAAAAAGAAGGCnTCnAAAACTGCTGAAAATGCCnCTGCTGAAGAAAATGAAGGCNCAGAGTGAAAGGAGGCTTTTCTC
  3   1   2       bld Em10 5g3  in                    IMAGE:7981578.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTGAACCTGATTTGTACAAATTTGAGCTTGAGGTGCAAGATTCTGAGTTGAAGGCAATTCTGCAAAGTTCAGCAAGTCGTAAAACCCAGAAGAAGAAGAAAAAGAAGGCATCAAAAACTGCTGAAAAAGCCACTGCTGAAGAAAATGAAGGCACAGAGTGAAAGGAGGCTTTTCTCTGAGGTGTTTGACTTTGACCTGCCAGTTAATATTTTTAGTACTTGCGTTTTTTTTTTTTGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGAAAAAAAAAATAATAAAATGTAAAAAAGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCGAGGACCTATTTTACAATTCTCTTATTTTTTTTTCCTTGTTACAAATTGTCCAAGAAACAG
  5   1   2       bld Emb4                            IMAGE:4684200.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTAGATCGCGACCTGCCAGTTAATATTTTTAGTACTTGCGtttttttttttttGCCTCTCCCTTCTTTATCCTGACAATTGAAACAAAGaaaaaaaaataataaaatgtaaaaaaGCCTCTCTACCTGTTCAGTCCGGGCAGCCGAGTGTGCGGTTGGATGTGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATTTTGGAATTCTCTCCAGactaaaccaaaagtatatatatataaataaaactataaaataaaaGCAGGCATCAAAGCAGTCTTTTAGCCCTCTTTCTATACAGATATTGTTACATCGAAAAGGAACACACCACCTTCCAGGTTACTCTTCTTCTGTCGACAATGATGATTATACGGCAGGTTTTGCCACTTGTTAAACGTGAAGTAGAGCAATTATTCCTGTACTGTGTGCACTAACTTACCCATGTGAGTTGTTCTGGAGCCATTGCTTCTGCAGCGGTACAGGGATCTTAAGCTACAGCATGTCAGACACATTTTTTAGATAATGGCCGTTTATGTGAATTTGTAACAATTTTTATATAGCTATTTACATATTTGTGAGCTAATTAGCGGAACAAATCTATATCACGGATTGCCGGTCATTTTTCGTCTAACTGCCTCTGCATTCGACAACTAAAGTGGAGCACATTTAATAGATGGACCTTGCACACATGCAAAACACAAATGCCAGTTTTGCCAAAAGATGTTGAAAGACCCCTGAAGTCAACCCTGGGGAATAGGTCATCAATTTTGTGGAATTGCTGAAAAACCTTTTAGNTATTACAGTTAAAGTGACTGTCCTGATAAAATATCCAAAACTCCCAAAAAAGGACAATGGAAGTACCCTTCAGGGGTTTTTCCGGTATGAATGAGGGGAAAAAATGGCCTAACTTTGCAATAATTGAAATTAAGTCCTTTTGGGAACATTAAAA
  3  -1   2       add Ga18      in                       xlk76b02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTACCTGTTCAGTCCGGGCAGCCGAGTNTNCGGNTNGATGNGGGATCCCTACTTTCCCTTTGGATGCAAACTTGGACATTCAAAGACATATNTTGGAATTCTCTCCAGACTAAACCAAAAGTnTnTnTnTnTnNATNAAA

In case of problems mail me! (