Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Nov 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlnga003d17.5                        15 END     3           3       20                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xlnga003d17.5                        15 PI      93       1408     1788                (no blast hit)
     3   0.0    0Xl3.1-xlk145n21ex.3                        11 PI      92       1111     1389                hypothetical protein LOC735101 [Xenopus laevis]
     4   0.0    0Xl3.1-xlk146o06ex.5                         8 PI      92        328      567                cyclin-dependent kinase 9 (CDC2-related kinase) [Xenopus laevis]
     5   0.0    0Xl3.1-IMAGE:7394489.5                       4 PI      91        108      977                similar to Cdk9-prov protein [Gallus gallus]
     6   0.0    0Xl3.1-IMAGE:3200598.5                       2 PI      93        660     1157                hypothetical protein LOC735101 [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012837299 Xl3.1-IMAGE:8548765.5.5 - 100 ESTs
                                                                       ...-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8548765.5.5                                                      TGGGTTAAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAGCGGGGTGCATCATGGCAGAGATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAGGTGTGGCCAAATGTGGACAAATACGAGTTGTACCAGAAACTTGAGCTGCCCAAAGGCCAGAAGAGGAAGGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTTTCTTTTTTTTTTAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCTGTGTTGCTGTACCTATGTATTTTGATAGGGAATGTAAATAAAAT
                                                  Xl3.1-CHK-1012721264                                                            AAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAGCGGGGTGCATCATGGCAGAGATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAGGTGTGGCCAAATGTGGACAAATACGAGTTGTACCAGAAACTTGAGCTGCCCAAAGGCCAGAAGAGGAAGGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTTTCTTTTTTTTTTAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCTGTGTTGCTGTACCTATGTATTTTGATAGGGAATGTAAATAAAATTTATGT
                                                      consensus depths                                                           6     8     7    13    10    15    14    18    22    28    27    37    32    40    35    43    36    43    38    47    40    47    40    47    40    47    40    47    40    48    40    48    40    48    40    48    40    48    40    49    41    50    42    50    42    50    42    51    43    51    43    51    43    51    50    52    49    53    51    54    50    54    49    54    52    54    52    54    49    54    49    54    47    53    49    53    47    53    46    53    48    53    44    53    44    52    44    52    45    52    45    52    42    52    41    51    42    50    37    50    37    49    35    47    33    44    31    42    28    39    27    38    24    37    23    35    20    34    23    33    16    29    16    29    12    27    11    27    10    25    10    24     9    22     8    21     7    20     6    19     6    19     5    19     5    17     6    18     6    15     7    17     7    18     8    16     8    16     8    15     7    13     8    15     8    15     8    13     8    14     9    13    12    16    10    16    10    15    11    16    13    15    14    16    13    16    14    16    13    17    14    17    14    17    16    18    15    18    17    19    17    19    16    21    17    21    16    21    17    21    19    22    17    22    20    22    21    22    19    21    19    21    19    22    19    23    17    22    17    24    17    24    17    25    19    28    12    29    13    33    14    32    16    34    18    33    21    34    20    33    21    34    22    34    21    33    17    33    20    33    21    34    20    34    21    34    19    35    15    35    20    33    20    32    21    32    22    33    21    33    23    33    21    32    19    31    20    32    12    29     5    22     6    19     5    17     6    13
  5   1   2       e>1                            Xl3.1-IMAGE:8548765.5                                                      TGGGTTAAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAGCGGGGTGCATCATGGCAGAGATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAGGTGTGGCCAAATGTGGACAAATACGAGTTGTACCAGAAACT
  5   1   2       e50                              Xl3.1-xlk139o22ex.5                                                       GGGGAGTGGGTTAAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAAN------------GAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGNGGTGTTGTGGCCTTGTCCGAGCCG------------TCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCGTCGGCTNTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCG------------------------TTCGGGGAAGTGTTCAAGGNCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAAT------------ATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTG------------------------NCGTCGCCGAGATCNAGAAGGTGA------------TCAATGGNCTCTACTACATTCACAGGAATNAGATCCTGCACAGAGACA------------ANGTGCTGATCA------------------------CAGACTTTGGGC
  5   1   2       e>1                            Xl3.1-IMAGE:6633475.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAGGTGTGGCCAAATGTGGACAAATACGAGTTGTACCAGAAACTTGAGCTGCCCAAAGGCCAGAAGAGGAAGGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTTTCTTTTTTTTTTAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCTGTGTTGCTGTACCTATGTATTTTGATAGGGAATGTAAATAAAATTTATGTTCTTCCTAAAAAAAA
                                                                   VAR                                                                                                                  TGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCC
                                                                   VAR                                                                                                                                                                              CTTGTCCGAGCC
                                                                   VAR                                                                                                                                                                                                      CTCGTCAGCTCAGCACCGGGAAAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGCAGATGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTGCACAGAGA
                                                                   SNP                                                                                                      --A---------
                                                                   SNP                                                                                                                  -----G------
                                                                   SNP                                                                                                                                          ----T-------
                                                                   SNP                                                                                                                                                      ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                  ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                              ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              T-----------
                                               BLH ATG     238    1030                                                      
                                               BLH MIN     115     311                                                      
                                               BLH OVR     238      47                                                      
                                               EST CLI      36      27                                                      
                                               ORF LNG     238       4                                                      
  5   1   2       e>1                            Xl3.1-IMAGE:8548765.5                                                      TGGGTTAAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAGCGGGGTGCATCATGGCAGAGATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAGGTGTGGCCAAATGTGGACAAATACGAGTTGTACCAGAAACT
                                                  Xl3.1-CHK-1012686552                                                            AAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAGCGGGGTGCATCATGGCAGAGATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAGGTGTGGCCAAATGTGGACAAATACGAGTTGTACCAGAAACTTGAGCT
  5   1   2       bld Gas5 5g                         IMAGE:3747473.5p TCCCACTGTGATGCGGTTCGGCCATTCCATGTGAATAGACGGGGGGAGTGGGTTAAAAACACACAAGCGGGGATCCTTCTAAAGGCGCGCAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAAAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAGCATGAGAATGTGGTTCACCTTATAAAGAATTGGCGGAATAAAATTTCTCCG
  5   1   2       bld Ga12 5g3  in                         XL190i03.5p                  GCGGTTCGGCCATTCCATGTGAATAGACGGGGGGAGTGGGTTAAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCG
  5   1   2       bld Thy  5g3  in                    IMAGE:8548765.5p                                    GTGCTTTGGGGGAGTCCTCGATTCGAATTCGTCCCGCTTTCTTCTAGAGGCGCGCAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAAGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAGACAGCCAGCCAAACAAGTACACCAATCGGGTTGGTACACTCTGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATATGTCCTCCATCGATTTGTGGGAGCGGGTGCATCATGCCAGAAATGTGGAACAGAAAGCTCCATAATGGC
  5   1   2       bld Em10 5g3  in                    IMAGE:7981242.5p                                           GACGGGGGGAGTGGGTTAAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATCACAGGAATAGATCCTGCCAGGACATGAGGCAGCAACGTGCTGATCACAGAACGGGTGTGAACTGCAACTTGGCTGCAGACTTCGCCTTGCAGACGCAGCAACAGTCACATCGGTGTCCCTGTTCACCCGACTCTCTGGACGGTA
  5   1   2       bld Ga15 5g3  in                       XL484p10ex.5p                                             CGGGGGGAGTGGGTTAAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAAGCGGGGAGGAAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTANCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCNAACATCGGCAGAC
  5   1   2       bld Em10 5g                         IMAGE:8320971.5p                                             CGGGGGGAGTGGGTTAAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATG
  5   1   2       bld Emb4 5g                         IMAGE:5542442.5p                                              GGGGGGAGTGGGTTAAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCCCAGAGACCTGAAGGGAGCAAACGTGCTGATCACCAGAAGACGGGGGGGTTGAAACTTGCCGAACTTTGGGGCCTTGCCAAGAACAATTCCACCCTTTGCCAAGAAACCACCCCGGTCCCAACCACGTAACCCCACGTGGCGGGCCGCATCACACCTCGTGGGGGCTTCGCACTCCCCTGCAACCCTCCCGTTTCGCCGGCACGCACGCGTTTGCATTCCACGGGGGGCCTCCTCCCCC
  5   1   2       bld Em10 5g                         IMAGE:7982650.5p                                                     GTGGGTTAAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAAGCGGGGAGGAAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTGCAGACTTTGGGCTTGCCAGAGCATTCAGCTTGCCAAGACAGCCA
  5   1   2       bld Tbd7 5g3  in                         XL086j08.5p                                                        GNAAAACACACAAGCCTTCTTCTAGTAGGCGCGCAGNAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCAATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCA
  5   1   2       bld Emb9 5g3  in                    IMAGE:7975829.5p                                                         GTTAAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCCAGTTTACCGTCGCCGAGATCAAGAAAGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATTCTGCACAA
  5   1   2       add Ga18 5x   ?                       xlk101g08ex.5p                                                          GGTTAAAAACACACAAGCGGGGATCCTTCTAGAGGCGCGCAGAANNNNGAGNNAAGTGAAAGAACANGCCAGAATCTCTCATCCGGCTCCTCCGTAGCAGTCCGAGGTGTTGTGGCCTTGTCCGAGCCGTCNNNCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGNNGCNGTCGGCTTTGCCCGGAATCCGATTCCCGAGGACCTTCCGGNTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTNCGACTCTNTGGAATTCCCTTACTGCGATGAGGTCTCCAAGNACGAGCGGNNNNNNAGATCGGCCAGGNNACATTCGGGGAAGNGTTCAAGGNCAAACATCGGCNGANNGGGAAGAAAGNTGCACTCNAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTNCGAGAGATCNAAATCCTGCAGCTCTTGAAACACGAGAATGTGGNTCANCTTATAGAGATTTGTCGGAATAAAANTTCTCCCACAGCCNACCAATACAATAGATGCNAAGGGACTATTTTCCTGGTGNTCGNNTTTTGCGAGCNCNATCTAGCAGGATTGCTGNGCNANNNCNCGTCAAGNTTACCGTCGCCGAGATNNAGAAGGTGATGCAGAT
  5   1   2       bld Tbd7 5g                              XL059b09.5p                                                                         ATCCTTCTAGNNGCGCGCAGAAGCGGGGAGGCAAGTGAAAGAACAGGCCAGAATCTCTCATCCGGCTCCTCCGTAGCAGTCCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTGGAATTCCCTTACTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTCTTGAAACACGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAACCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGC
  5   1   2       bld Ga15 5g   ?                        XL431a21ex.5p                                                                              TCTAAAGGCGCGCAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTANCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCANATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAANATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCANANACGGGGTGTTGAAACTTGCANACTTTGGGCTTGCCANANC
  5   1   2       bld Ga12 5g                              XL152p18.5p                                                                                       CTGCAGGNAATTCGGCACGAGGGAAAGAACAGGCCAGAATCTCTCATCCGGCTCCTCCGTAGCAGTCCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTGGAATTCCCTTACTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCACTGCGAGAGATCAAAATCCTGCAGCTCTTGAAACACGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCA
  5   1   2       bld DMZ  5g                              xl223e02.5p                                                                                          CAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCA
  5   1   2       bld DMZ  5g                              xl316h22.5p                                                                                          CAGAAGCGGGGAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTTTATCCTCCTCAGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACA
  5   1   2       bld DMZ  5g                              xl323p15.5p                                                                                              AGCGGGGAGGCAAGTGAAAGAACAGGCCAGAATCTCTCATCCGGCTCCTCCGTAGCAGTCCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTGGAATTCCCTTACTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTCTTGAAACACGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCA
  5   1   2       bld Emb1 5g                         IMAGE:6863824.5p                                                                                               CCCCACGCGTCCGCCCACGCGTCCGCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAAGGAGCAAACGTGCTGATCACCANAAGAACGGGGTGTTGAAAACTTGCAGACTTTGGGCTTTGCCAGAGCATTCAACCTTTCCCAAGAACAGCCAGCCCAAACAAGTACACCAATCGGGGTGGTTACCCTTCTGGTATCGACCCCCCTGGAACTGCTTCCTGGGGGAA
  5   1   2       chi Ga15                               XL443h17ex.5p                                                                                               GCGGGGAGGAAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTTTATCCTCCTCAGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAAGTAAGTAACATTTTGTGTATCTCTGCGTGCTGCACGCGCTGTTTGGGGGGGTTGCTGCTTGGGTGGCGACTTTCACAGCCAGGACACACACACAGCATGGTTGTCTGTCTGTCTCACTATCCTTTGTCTGGCTCCTTCTTCTTTTTTTATTCTCACTACTTTGATTTCTAAACAANCAAACACCATACACATTGCATGGAAACTGCANCATCTCCTCTGCCTGGTGTANTGA
  5   1   2       bld Ga15 5g                            XL438l18ex.5p                                                                                                CGGGGAGGCAAGTGAAAGAACAGGCCAGAATCTCTCATCCGGCTCCTCCGTAGCAGTCCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTGGAATTCCCTTACTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTCTTGAAACACGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCGTTCAGCCTTGCTAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGA
  5   1   2       bld Tbd7 5g3  in                         XL104e20.5p                                                                                                  GGNAGGCAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGT
  5   1   2       bld DMZ  5g                              xl259n09.5p                                                                                                  GGGAGGCAAGTGAAAGAACAGGCCAGAATCTCTCATCCGGCTCCTCCGTAGCAGTCCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTGGAATTCCCTTACTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTCTTGAAACACGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGA
  5   1   2       bld DMZ  5g                              xl249e16.5p                                                                                                  GGGAGGCAAGTGAAAGAACAGGCCAGAATCTCTCATCCGGCTCCTCCGTAGCAGTCCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTGGAATTCCCTTACTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTCTTGAAACACGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACC
  5   1   2       bld DMZ  5g                              xl233m15.5p                                                                                                  GGGAGGNAAGTGAAAGAACAGGCCAGAATCTCTCATCCGGCTCCTCCGTAGCAGTCCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCNTGGTAAAGAACTACGACTCTGTGGAATTCCCTTACTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCTAGATCGGCCAGGGCACATTCGGGGAAGTGTTCNAGGCCNAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTCTTGAAACACGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAG
  5   1   2       bld Ga12      in                         XL143b03.5p                                                                                                      GGAAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTC
  5   1   2       bld Emb1 5g                         IMAGE:6863638.5p                                                                                                      GGAAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGGTACACTCTGGGATCGACCCCCTGAGCTGCTTCCTGGGGGGAGCGTGGATTATGGCCCTTCCCATCGAATTTTTTGGGGAACCGCGGGGTGCAATCATGGGCAGAAGATG
  5   1   2       bld Emb1 5g                         IMAGE:6636809.5p                                                                                                        CAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCCAGCCAACAAGTACACCAATCGGGTTGTTACACTCCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAACCGGGGTGCATCTTGGCAGAAAAGTTGGACCAAAACCCCCTTTATGCCAGGGGAAATCCGAAGCAGCATCAGCTTG
  3  -1   2       bld Bla2      in                    IMAGE:7297323.3p                                                                                                        GGAAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCCGTCGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAAGCCGGGGCCCGTCGGCCTGTGCCCCGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCATGGTAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTNCATGGCCTCTACTACTTCACAGGAATAGTTCCTGCACAGAGACATGAAGCAGCAACGTGCTATCACAGAGACNGGTGTTGAACTGCGGACTTGGCTGCAGACATCAGCTTGCAGACACAGCCACATACACATCGTTGTCTCTGTCGCCC
  5   1   2       bld Emb1 5g                         IMAGE:5155285.5p                                                                                                            GGACGCGTGGGTCGCCCACGCGTCCGCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGGAATAAGATCCTGCACGGAGACATGAAGGCAGCAAACGGGCTGATCACCACGAGACGGGGTGTTTGAAACTTGCAGACTTTTGGGGCTTGCCCAGAGCATTTCAGCCTTGCCCAAGAACAAGCCGAGCCAAAACAAGTTACACCCAAATCCGGGGTTGGTAACAACTCCTGGGGAATCGCGACCCCCN
  5   1   2       bld Ov1  5g                         IMAGE:5047369.5p                                                                                                               AAGAACAGGCCAGAATCTCTCATCCGGCTCCTCCGTAGCAGTCCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTGGAATTCCCTTACTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCTGTCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTCTTGAAACACGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCCAGATCAAGAAG
  5   1   2       bld Ga18 5x                            xlk68m22ex.5p                                                                                                               GCAAGTGAAAGANCAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGNNNNGTGTTGTGGCCTTGTCCGAGCCNNNNNNCCTGAACTCGTCAGCTCAGCACCGGGAAAGGNCGNNNNNNTCGGCTNTTCCCGGNATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGNCTCCAAGTACGAGCGGNTNNNNAGATCGGNCAGGGNACATTCGGGGAAGTGTTCAAGGNCAAACATCGGCAGANGGGGAAGAAAGTTGCNCTCAAAAAAGNTCTGATGGAAAATGAGAAGGAAGGGNTCCCTATCACAGCTCTGCGAGAGATCNAAANCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATANNANTTCTCCCACAGCCAACCAATACAATAGATGCNAAGGGACTATTTTCCTGGNGTTCGACTTTTGCGAGCNCGATCTAGCAGGATTGCTGNGCANNNNNNCGTCAAGNTTACCGTCGCCGAGATCAAGAAGGNGATGCAGATGCTGCTCAATGGCCTCTACTA
  5   1   2      seed DMZ       in                         xl305e02.5p                                                                                                                 GAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCA
  5   1   2       bld Ga12 5g                              XL195d23.5p                                                                                                                  CACGAGGCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAACCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCA
  5   1   2       bld Emb1 5g                         IMAGE:6864687.5p                                                                                                                      GCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTTGGGCTTGCCCAGAGCATTCAGCCTTTGCCAAGAACAGCCAGCCCAACAAAGTACACCAAATCGGGGTTGTTTACACTCTGGGTATCCAACCCCCCTGAGGCTGCCTTCTTGGGGGGGAAGCGNTGGATTTAATGGCCCCCTCCC
  5   1   2       bld Ga12 5g   out                        XL191l10.5p                                                                                                                          CGAGGCTCTCATCCGGCTCCTCCGTAGCAGTCCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTGGAATTCCCTTACTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTCTTGAAACACGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAG
  5   1   2       bld Neu7 5x                              XL011l15.5p                                                                                                                              GCTCTCATCCGGCTCCTCCGTAGCAGTCCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTGGAATTCCCTTACTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGTAGGAAGTGGAGTTTCCTCTCTTCTTTTATGGATGTGGAATGTGATTGGAAAATCTCCAGAAGTGGGTATCCCTCAGTGCTGAGTATTTGGGGCACTGTAGCAAGAAGTGGGCCTCATCCTCTATGGCCTCCTGGTCACATCGCTCGCACGGTCTGTAGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTCTTGAAACACG
  5   1   2       bld Ga15 5g3  in                       XL414p07ex.5p                                                                                                                               CTCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCANAGACGGGGTGTTGAAACTTGCANACTTTGGGCTTGCCANAGCATTCANCCTTGCCAAGAACAGCCAGCCAAACAAGTAC
  5   1   2       bld Emb1 5g                         IMAGE:5155432.5p                                                                                                                                TCTCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGGTTGTTACACTTCTGGTATCGACCCCCCTGAGCTGCTTCCGGGNGGAAAGCGTGATTATGGGCCCCTCCCATCCGATTTGTGGGGGAACCCGGGGC
  5   1   2       bld Emb1 5g                         IMAGE:6634217.5p                                                                                                                                  TCATCCGGCTCCCCCGTAGCAGTGCGAGGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTNGAAACTTGCAGACTTTTTGGGCTTGCCAGAAGCATTCAGCCTTTTGCCAAGAACAGCCAGGCCAAAACAAGGTACACCCAATTCGGGGTTTGGTTACACCTTCTGGGGTATCCGAACCCCCCTTGGAAGCTTGGCTTTCTTgggggggggAA
  5   1   2       bld Egg1 5g                            PBX0029E04.5p                                                                                                                                                             GGTGTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACC
  5   1   2       bld Emb1 5g                IMAGE:6635104-IMAGp.IMAGp                                                                                                                                                              GACTAGTTCTAGATCGCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGC
  5   1   2       bld Emb1 5g                         IMAGE:6635104.5p                                                                                                                                                                CTACTTCTAGATCGCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTAACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGGCTCAATGGCCTCTACTACATTCACAGGAATAAAATCCTGCACAGAGACATGAAGGGAGCAAAACGTGCCTGATCACCCACAAGACGGGGGTGGTTGGACACCTTGCACGACTTTTGGGGCTTGGCCCAGAGCCATTCCAGGCCCTTGTCCCAAGAAAACAGGCCCAGCCCCAAACAAAGGTAACACCAAATTCCGGGGTTTGGTTACCCCCTCCCCGGGTGAATTCGAACCCTCCCTGGAAGCCTTGCCTTTCCCggggggggAACACCGTGGAATCTNATTGGGGGCCCCTTCTCCCATTTCGAAATTTTTGTTGGGCGCGGAAAACGGCCAGTGCTGGCCTATTCTCATTGGCGCCCACGACAAAATGCGGCGCGGGACCCCCCCGACAGATAGCGCCCCCCTCGTTTTTATATTGCGTAAGATGGGGAGC
  5   1   2       bld DMZ  5g   ?                          xl275a01.5p                                                                                                                                                                GTTGTGGCCTTGTCCGAGCCGTCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGTCGGCCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAACCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGA
  5   1   2       bld Ga18      out                     xlk127h05ex.5p                                                                                                                                                                                                                           AAAGNNCGNNNNGTCGGCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTGGAATTCCCTTACTGCGATGAGGTCTCCAAGTACGAGCGGCTNNNNAGATCGGCCAGGNCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTCTTGAAACACGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAANNNNACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTNNNGAGCGTTCAGNCTTGCTAAGAACAGCCANNCAAACAAGTACACCAATCGGGNTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGNGNNTGATTATGGCCCTCCCATCGATTTGTGGGGAGNNG
  5   1   2       bld Ga18 5g                           xlk121l11ex.5p                                                                                                                                                                                                                                                                                TCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGNCTCCAAGNACGAGCGGCTCNCNAGATCGGCCAGGNNACATTCGGGGAAGNGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGNTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGANTTGTCGGAATAAAANTTCTCCCACAGCCAACCAATACAATAGATGCNAAGGGACTATTTTCCTGGNGTTCGACTTTTGCGAGCNC
  5   1   2       bld Tbd7 5g                              XL069j11.5p                                                                                                                                                                                                                                                                                                 GCCATGGNAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGNCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCA
  5   1   2       bld Emb9      in                    IMAGE:7975874.5p                                                                                                                                                                                                                                                                                                                                 GGATCTATTGCGATGAGGTCTCCAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAACCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGTTCACCTGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTTCATCCTTGCCAAAAACAGCCAGCCCAAACAGTCACACCATTCGGGTTGTTACCACTCTGGAATCAACCCCCTGAGCTGCTTCTGGGGGAGCGTGTATTTGGCCCTCCCATCCATTTTTAGGGTATCGGGGTGCATCATGGTAAATATGTGCACTACAAGCCCCCTTATGCAGGGGAATCTAAAACTGCCTC
  5   1   2       bld Ga18      in                      xlk102j08ex.5p                                                                                                                                                                                                                                                                                                                                                       CCAAGTACGAGCGGCTCGCAAGATCGGCCAGNNNNATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAANNNNACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGNNGAGCATTCAGCCTTGNCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAGNGGGGTGNATCATGGCAGAGANGTGGACCAGAAGNCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCANNTGTGCGGCTCCATCACNNCAGAG
  5   1   2       bld DMZ                                  xl237p02.5p                                                                                                                                                                                                                                                                                                                                                                                      GCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTCTTGAAACACGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCGTTCAGCCTTGCTAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAGCGGGGTGCATCATGGCAGAGATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAGGTGTGGCCAAATGTGGAC
  5   1   2       bld Tbd7      out                        XL094m24.5p                                                                                                                                                                                                                                                                                                                                                                                                  GGCACATTCGGGGAAGTGTTNAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAACCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAGCGGGGTGCATCATGGCAGAGATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTNCATCACACCA
  5   1   2       bld Em10      in                    IMAGE:7981720.5p                                                                                                                                                                                                                                                                                                                                                                                                              GCCAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAGCGGGGTGCATCATGGCAGAGATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAAGTGTGGCNAAATGTGGACAAATACGAGTTGTACCAGAAACTTGAGCTGNCCAAGGGCAGAAGAGAAGGTGAGG
  5   1   2       bld Gas6                            IMAGE:3473781.5p                                                                                                                                                                                                                                                                                                                                                                                                                     TCGGCTGACGGGGAATAAAGTCGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCACATGCTGCTCATTGGCCTATACTACATTCACAGGACTAAGATTCTGCACACAGACATGAACGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAGCGGGGTGCATCATGGCAGAGATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAGGTGTGGCCAAATGTGGACAAATACGAGTTGTACCAGAAACTTGAGCTGCCCCAAGGCCAT
  5   1   2       bld Emb1                            IMAGE:3402921.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAGCGGGGTGCATCATGGCAGAGATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTC
  5   1   2       e50                              Xl3.1-xlk139o22ex.5                                                       GGGGAGTGGGTTAAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAAN------------GAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGNGGTGTTGTGGCCTTGTCCGAGCCG------------TCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCGTCGGCTNTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCG------------------------TTCGGGGAAGTGTTCAAGGNCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAAT------------ATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTG------------------------NCGTCGCCGAGATCNAGAAGGTGA------------TCAATGGNCTCTACTACATTCACAGGAATNAGATCCTGCACAGAGACA------------ANGTGCTGATCA------------------------CAGACTTTGGGC
                                                  Xl3.1-CHK-1012708670                                                             TGGGTTAAAAACACACAAGCTTCTTCTAGAGGCGCG------------GAAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGNGGTGTTGTGGCCTTGTCC------------CTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCGTCGGCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTA------------------------------------GAAGTGTTCAAGGNCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGNTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGNTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGN------------------------CCGAGATCNAGAAGGTGATGCAGA------------GNCTCTACTACATTCACAGGAATNAGATCCTGCACAGAGACATGAAGN------------TGATCANCAGAG------------AACTTNCAGACTTTGGGCTTNCAG
  5   1   2       bld Ga18      in                      xlk133h02ex.5p                                                       GGGGAGTGGGTTAAAAACACACAAGCTTCTTCTAGAGGCGCGCAGANNNNNGAGGNAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCNNGGTGTTGTGGCCTTGTCCGAGCCGNCNNNCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGNNNCNGTCGGCTNTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGNCTCCAAGTACGAGCGGNT
  5   1   2      skin Ga18      in                      xlk117a18ex.5p                                                                  TAAAAACACACAAGCTTCTTCTAGAGGCGCGCAGAANNNNGAGGAAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTGCGNGGTGTTGTGGCCTTGTCCGAGCCGTCNNNCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGNNGNNGTCGGCTNTNCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTNNNNAGATCGGNCAGGNNACATTCGGGGAAGTGTTCAAGGNCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAANAAGNTCTGATGGAAAANGAGAAGGAAGGGTTCCCTATCACAGCTCTNCGAGAGANCNAAATCCTGCAGCTGTTGAAANATGAGAATNTGGNTCACCTTATAGAGATTTGTCGGAATNAAANTTCTCCCACAGCCAACCNATACNATAGATGCAAAGGGACTATTTTCCTGGNGTTCGANTTTTGCGAGCACGNNC
  5   1   2      seed Ga18      in                      xlk139o22ex.5p                                                                                                        GGGAGGAAAGTGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTNCGAGGTGTTGTGGCCTTGTCCGAGCCGNCNNNCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGNGCCGTCGGCTGTGCCCGGAATCCGATTCCCGAGGACCTTCCGGTTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTNNNNAGATCGGNCAGGGNNCATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGNTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGNTCANCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGNAANNNCNCGTCAAGNTTANCGTCGCCGAGATCNAGAAGGTGATGCAGATNNTGCTCAATGGNCTCTACTACATTCACAGGAATNAGATCCTGCACAGAGACATGAAGNNAGNAAANGTGCTGATCANCAGAGANGGGGTGNTGAAACTTNCAGACTTTGGGCTTNCAGANNATTCAGCCT
  5   1   2      skin Ga18      in                       xlk65j12ex.5p                                                                                                                 TGAAAGAACAGCCCAGAATCTCTCATCCGGCTCCCCCGTAGCAGTNNNNGGTGTTGTGGCCTTGTCCGAGCCGNCNNNNCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCGTCGGCTNTGCCCGGAATCCGATTCCCGAGGACCTTCCGGNTCAGAGCCCCCTCCTTCCGCCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGNCTCCNAGTACGAGCGGNTCNNNAGATCGGNCAGGGNNCANTCGGGGAAGTGTTCAAGGNCAAACATCGGCAGANNGGGAAGAAAGTTGCACTCNAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGNTC
  5   1   2       e>1                            Xl3.1-IMAGE:6633475.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAGGTGTGGCCAAATGTGGACAAATACGAGTTGTACCAGAAACTTGAGCTGCCCAAAGGCCAGAAGAGGAAGGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTTTCTTTTTTTTTTAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCTGTGTTGCTGTACCTATGTATTTTGATAGGGAATGTAAATAAAATTTATGTTCTTCCTAAAAAAAA
                                                  Xl3.1-CHK-1012687017                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAGGTGTGGCCAAATGTGGACAAATACGAGTTGTACCAGAAACTTGAGCTGCCCAAAGGCCAGAAGAGGAAGGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTTTCTTTTTTTTTTAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCxxxxxTxxxxxxCCTATGTATTTTGATAGGGAATGTAAATAAAATTTAxxxTxxTCCTAAAAAAAAAAAAAA
  5   1   2       bld Ga18      in                       xlk72i17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAGCGGGGTGCATCATGGCAGAGATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGANNNNNNCAAATGTGGACAAATACGAGTTGTACCAGAAACTTGAGCTGCCCAAAGGCCAGAAGAGGAAGGTGAAGGAAAGGCTGAAGGNTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGNCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGNAACttttttttcttttttttttaactatatataaatttttcaattcctttttttAAGNATCTGTNTA
  5   1   2       bld Gas4                            IMAGE:3420159.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGGATCGATACGTGGGGAGCGGGGTGCATCATGGTATACATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAGGTGTGGCCAAATGTGGACAAATACGAGTTGTACCAAAAACTTGAGCTGCCCAAAGGCCAGAAGAGGAAGGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTGTGAATACTTGGCACCTCCTACGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATGCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTC
  5   1   2       bld DMZ       ?                          xl266b23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGCATCATGGCAGAGATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAGGTGTGGCCAAATGTGGACAAATACGAGTTGTACCAGAAACTTGAGCTGCCCAAAGGCCAGAAGAGGAAGGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACtttttttttctttttttttaactatatatatatttttcaattcctttttttAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTC
  3   1   2       bld Brn1                            IMAGE:6950833.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTGTGGCCCCGGAAGCCCCCCTTAAGGCAGGGGGAATACCGGAGCCGGCTTCAGGGTGACACTCCTTCAGCCAAATTGTGGGGGGTCCCATCACCCCAGAGGGTGGGGCCAAAAGTGGGACAAATTCCGAGTTGTACCAGAAACTTGAGTTGCCCAAAGCCCAGAAGAGGAAGGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTTTCTTTTTTTTTTAACTATACATATATTTTTCAATTCCTTCTTTTAAGAATCCGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTCGCATACGTTTTAGGGTATCACTATTCAGAAGAATCGCATTAATGACCTAGGCTAATTCTTTTCTATCCAAGGGAAACAGAACTTTAACTGTGAGATACCAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCGAAAAAAATGCTTTCTGGTGCTGACCAAG
  3   1   2       bld Thy  5g3  in                    IMAGE:8548765.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCTTGGAGGGATAGCTCCATGATTTGGACGGGGCTCTGCAGATGGACAGAGCCCTTAGCAGGGATCGAGCAGCTCAGTGCATCATCAGCAATGTGCGCTCATCACACAGAGTGTGCCAAATGTGACAATACGAGTGTACCAGAACTTGAGCTGCCCAAGNCCAGAAGAGGAAGGTGAAGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTTTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTCTTTTTTTTTTAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACTAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCCGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCCTCAAAAAAATGCTTTCCGTGCTGCCGTCTACAGATCTAACAAAGAATACCATCT
  5  -1   2       bld Bla2                            IMAGE:7298825.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCATGCAGAGAGTGACCAGAGCCCCATATGCAGGGAATACAGAGCAGCATCAGTGACATCATCAGCCAATGTGCGNTCCATCACACCAGAGGTGTGGCCAAATGTGGACAAATACGAGTTGTACCAGAAACTTGAGCTGCCCAAAGGCCAGAAGAGGAAGGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCGGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACtttttttttttttttttttACTATATATATTTTTCAATTCCTTTTTTAAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGAAATGTACAGCTGCATACATTTTGTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCTGATCTaaaaaaaaaaaGATTGCTCTTGTTCAGACAGGTTTTTGAAAATAATaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATCCCCTAAGATAG
  5   1   2      seed Emb1                            IMAGE:6633475.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAGGTGTGGCCAAATGTGGACAAATACGAGTTGTACCAGAAACTTGAGCTGCCCAAAGGCCAGAAGAGGAAGGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACtttttttttcttttttttttAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCAGATCTaaaaaaaaaaaaGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCNAAAAAATGCTTTCTGNNGTGCTGGACCTATGTATTTTTGATAGGGAATGTAAAATAAAAATTTATGTTTCTCCCTAAA
  3   1   2       add Em10 5g3  in                    IMAGE:7981242.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTGCCCACCTTGGGGGGGATAGAAATGCCAAACCCTTTGGGGATAGCGGTCCTGACTTTCGCAATGGGGTCATCACAGGGGGGCAAATGGAAATTGAGTGTCAGAATTGGTGCCAAACCAAAGGGAAGGAAGGAAAGCTAAGGTAATTTAAGATGTTGTGCATGGATTTTTAGCAAGCGTTGATTTGGACCAGGCAGGGACAGACAGGGACGAAGCTTGAACCTTGTTTTCTCAGGTCCGTTCAAGGCATAAGAACCTTATGAACATGCCATCAGCTCNCAATCAGTCCATGTTTGCACACTTGGCACCTCNTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTTTCTTTTTTTTTTAAGTAAACATAAATTTTTCAATTCCTTTCTTTTAAGAATCTGTATAACCGTAGTACCGGGAGCAAGGACTACAGTTGACATGTACAGCTGCACGCGTTTTAGGGCCTCACTATTCGGAAGAATGGCATGAAGGACATAGGCTAATTGTTTTCGCTCCAAGGGAAACGGAACTTTAACTGTGAGATACCATGATGGTAAAAAAAAAAAAGATTGTTCTTGTTCCGACAGGCGTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCTGTGTTGCTGTACCTATGATCTGAAGGAGGGATGTAATATC
  3   1   2       bld Neu4                            IMAGE:4085014.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACACTCATCAGCCAATTGTGCGGCTCCATCACACCAGAGGTGTGGCCAAATGTGGACAAATACGAGTTGTACCAGAAACTTGAGCTGCCCAAAGGCCAGAAGAGGAAGGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTTTCTTTTTTTTTTAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATGGTCAAAAAAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAGCTAAAACTGTGAGATACCAGATCTGTTTAGGAA
  3   1   2       add Em10      in                    IMAGE:7981720.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAGGTGTGGCCAAATGTTGACAAATACGAATGGTACCAGGAACTTGAGGTGCCCAAAGCCCAGAAGATGGAAGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGAATTGGACCCAGCGCAGAGAACAAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCGTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTTTCTTTTTTTTTTAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCACACGTTTTAGGGCCTCCCCATTCAGAAGAATCGCATTAATGACCTAGGCTAATTCTTTTCTCCCCAAGTGAAACAGAACTTTAATTTTGAGATACCAGATTTAAAAAAAAAAAAAGATTGCTCTTGTTCCGACAGGCTGATACACCCTCCCATGTAGCTAATACCGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCCTCAAAAAAATGCTTTCCGTGCTGCCGTACCACAGATCTGAAAAGGAGGTATTAAAAATT
  3   1   2       bld Ga12      in                         XL143b03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATACGAGTTGTACCAGAAACTTGAGCTGCCCAAAGGCCAGAAGAGGAAGGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTTTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTT
  3   1   2       bld Emb9      in                    IMAGE:7975874.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTTGTACCAGAAACTTGAGGTGCCCAAAGGCCAGAAGAGGAAGGTGAAGAAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGAGTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTTTCTTTTTTTTTTAACTATATATATATTTTTCAATTTCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCAGATCTAAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCTGGTTGCTGTTACCAGATCTCAACAAAGAATAAATATCGG
  5   1   2       bld Ga15                               XL412i02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTACCAGAAACTTGAGCTGCCCAAAGGCCAGAAGAGGAAGGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACtttttttttctttttttttaactatatatatatttttcaattcctttttttAANAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCAGATCTAGaaaaaaaaaa
  3   1   2       add DMZ       in                         xl305e02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGGAAGGTGAAGGAAAGGCTGAAGGCTTATGTGAAAGATGTNTGTGCNCTGGATTTTATAGACAAGCTGTTGATTTTGGACCCNGNGCNGNGAACAGNCAGNGNCGNAGCTTTGAACCCCGNTTTTTTTTGGTNCGNTCCAANGCCTTTTGNCCTAAAGAACNTGCTNTTTNCTCNCNATCNGTCCNTGTTTGAATACTTGGCCCCTCCTNGGNGAAGNGGGGGNCNCNTGCCCCNACAGCCNGCCNATCNGGCCCGGNATCCTGNTGCCCCCNACCNATCNGAATTTGNCNGNGTTTTTTNAGNCNTAAATTTTTATTTNTGGGNGNGNGGNAACTTTTTTTTTnTTTTTTTTTTAACNANATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCNTACGTTTTAGGGTATCAATATTCAGAAGAATGGCNTTAATGACNTAGGATAATTCTTTTCTATCCAAGTGAAACNGAACTTTAACTGTGAGATACCNGATCTAGAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGNCGCGTTGTGAACTGAAGAATCNTCAANAAAAT
  5  -1   2       bld Bla2      in                    IMAGE:7297323.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCAGAAGAGAAGTGAAGAAAGCTGAGGCTTATTGAAAGATGTCTTGCACTGATCTTATAGACAAGCTGTTGATTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACtttttttcttttttttttaactatatataaatttttcaattcctttttttAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACTAGATCTaaaaaaaaaaaaGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCTGTGTTGCTGTACCTATGTATTTTGATAGGGAATGTAAATAAAATTTATGTTCTCCTaaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCAATCGCCATG
  5   1   2       bld Ga18      ?                       xlk145d18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTTATGTGAAAGATGTCTGTGCACTGGATCTTATAGACAAGCTGTTGATTTTGGACCCAGCGCAGAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACtttttttcttttttttttAACTATATATAAATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGNATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACTAGATCTaaaaaaaaaa
  3   1   2       add Gas6                            IMAGE:3473993.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATAAACAACTGGTTTATTTGGCGCCAGCGCAGAGCACAGACAGCGACGAAGTTCTGACCACCGATATCTTTTGGTCCGATGCAATGCCTTCTGACATAGAGACAATGCTCTTTACTCCAATCCAGTCCATGTTTGAATACTTGACACCTCCTAGGAGAATAGGCGATCACATGCCCCAACAGCCAGCCAATCAAG
  5   1   2       bld DMZ       in                         xl281e03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAACAGACAGCGACGAAGCTCTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTCTGACCTAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACtttttttttcttttttttttaactatatatatatttttcaattcctttttttAANAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACNGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCANAANAANGGCATTAANGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACNGNGAGATACCAGATCTaaaaaaaaaa
  3   1   2       bld Unk4                                 AGL_4F12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGAACCACGATTTCTTCTGGTCCGATCCAATGCCTTATGACCTAAAGAACATGCTCTCTACTCGCAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTTTCTTTTTTTTTTAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATACCGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTC
  3   1   2       bld Emb9 5g3  in                    IMAGE:7975829.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCCCCAACCTTNTGACATAAAGAACATGCTCTCTACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTTCTTTTTTTTTTAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTCCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGGAACTGAAGAATCTTCAAAAAAATGCTTTCTGTGTTGCGTACTGTACCTCTGTAGGAAGATAAATATCGG
  3   1   2       bld Gas5                            IMAGE:3747480.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAATCCCTTCTGACCTAAAAAACATGCTCTCAACTCACAATCAGTCCATGTTTGAATACTTGGCACCTCCTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTTTCTTTTTTTTTTTAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGACTTTTAACTGTGAGATCCCAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCTGTGTTGCTGTACCTATGTATTTTGATAGGGAATGTAAATAAAATTTATGTTCTCCTAAAAAAAAAAAAAAAAA
  3   1   2       bld Oo1                             IMAGE:5078280.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCATGTTTGAATACTTGGCACCTCTTAGGAGAAGAGGCGGACACATGCCCCAACAGCCAGCCAATCAGGCACGGAATCCTGCTGCCACCAACCAATCAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTCTTTTTTTTTTAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGCGAAACAGAACTTTAACTGTGAGATACTAGATCTAAAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAATGCTTTCTGTGTTGCTGTACCTATGTATTTTGATAGGGAATGTAAATAAAATTTATGTTAAAAAAAA
  3   1   2       chi DMZ       in                         xl281e03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGNATCCTGNTGCCCCCNACCNATCNGAATTTGNCNGNGTTTTTTNAGNCNTAAATTTTTNTTTNTGGGGGNGGGGNAACNTTTTTTTTnTTTTTTTTTTAACNANATATATATTTTTCAATTCCTTTTTTTAAGAATNTGTATAACGGTNGTATGGGGNGCAAGGNCTACNGTTGACNTGTACAGCTGCNTACGTTTTAGGGTATCNATATTCNGAAGAATGGCCTTAATGACNTAGGNTAATTNTTTTCTATCCAAGNGAAACNGAACTTTAACTGTGNGATACCNGATNTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCCTGTGTTGCTGTACC
  3   1   2       bld Tbd7 5g3  in                         XL086j08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCNCCAACCAATCANAATTTNACANAGTTTTTTAANACATAAATTTTTNTTTATGGGANAGTGGAAACTTTTTTTTTTTTTTTTTTTTTAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATNTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCAGATCTAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTNCTGTGTTGCTGTACCTATGTATTTGCATAGGGNAATGTAAATAAAATTTA
  5   1   2       add Ga15                               XL439o04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAATTTGACAGAGTCTTCTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACtttttttcttttttttttAACTATATATAAATTTTTCAATTCCTTTTTTTAANAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCANAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGNGAAACAGAACTTTAACTGNGAGATACTANATCTaaaaaaaaaaaaNATNGCNCTNGTNCAAACGGGCNGATACCCCCNGCCANGNANCTACTACNGCTACTTACAAAAGGGCNGGNCAGNAAACNCGTNGGGAACTGaaaaanctncaaaaaaaNGCTTTCNGGGTNGCNGNNCCTANGTATTTTGATAGGGAANGTAAATAAAATTTNNGTNCCCCTaaaaaaaaaa
  5  -1   2       chi Ga15      in                       XL510p09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ttttttttttggntttttttttttttttattttAAACNAGATTTATTTAAACNACGNGATGTCNGNCTTGAACGGGAAAAACNNCCTAAAANGGGTAttttttntttttAAAGCTTTCCTAATATTTCCCCCGGNGACANGTACAGCTGCNTACGTTTTAGGGTATCNATATTCNGAAGAATGGCNTTAATGNCNTAGGNTAATTNTTTTNTATCCNAGNGAAACNGNACTTTAACTGNGNGATNCTAGATTTaaaaaaaaaaaaGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCTGTGTTGCTGTACCTATGTATTTTGATAGGGAATGTAAATAAAATTTATGTTCTC
  3   1   2       bld Gas5      out                   IMAGE:3749741.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTAAGACATAAATTCTTATTTATGGGAGAGTGGAAACTTTTTTTTCTTTTTTTTTTAACTATATATATATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCAGATCTAAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCTGTGTTGCTGTACCTATGTATTTTGATAGGGAATGTAAATAAAATTTATGTTCTCCTAAAAAAAAAAAAGAAAA
  3   1   2       bld Ga18      in                       xlk72i17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGGAGAGTGGANTNTTTTTTTTTTTTTTTTTTANCNANANANAAATTTTTNAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACTAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATNCTTTCTGTGTT
  3   1   2       bld Tbd7 5g3  in                         XL104e20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAANTTTTTTTTTTTTTTTTTTTTTAACTANANANANATTTTTCAATTCCNTTTTTTAAAAATNTGTANAACGGTANTATNGGGANCAAGGACTNCAGTTTACATGNACANCTGCATACGTTTTAGGGTATCAATATTNANAANAATGGCATTAATGACANAGGATAATTNTTTTNTATCCAAGTGAAACANAACNTTNACTGTNAGATACCAGATNTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCCTGTGTTGCTGTACCTAT
  3   1   2       bld Ga18      in                       xlk65j12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGNNNTTTTTnnnnnnTTTTTTTTnnnnAnAnAAAAATTTTTnnnTTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACTAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATNCTTTCTNTGT
  3   1   2       bld Ga18      in                      xlk102j08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTTTTTTTTTTTNNCNANANNNAANTTTTTNNATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAA
  3   1   2       bld Ga18      in                      xlk117a18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTTTTTTTnnnnnAAAAAAATTTTTnnnTTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACTAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATNCTTTCTNTG
  3  -1   2       bld Ga10                            IMAGE:3558234.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTAACTATATATAAATTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACTAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCTGTGTTGCTGTACCTATGTATTTTGATAGGGAATGTAAATAAAATTTATGTTCTC
  3  -1   2       bld Ga10                            IMAGE:3558282.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTACTATATTTTTTTTTTCAATTCCTTTTTTTAAGAATCTGTATAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACTAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCTGTGTTGCTGTACCTATGTATTTTGATAGGGAATGTAAATAAAATTTATGTTCTC
  5   1   2       add Ga18      out                     xlk166g16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTATATATATTTTTCAATTCCTTTTTTAAAGAATCTGTATAACGGTAGNATGGGGAGNAAGGNCTACAGTTGAAATGTACAGCTGCATACATTTTGTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTNAAANAGAACTTTNACTGTGAGANACNTGATCTaaaaaaaaaNATTNCT
  3  -1   0       chi Ga15      in                       XL510p09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTGAACGGGAAAAACAACCTAAAATGTGTATTTTTTCTTTTTAAAGCTTTCCTAATATTTCACCCGGCGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACTAGATCTAAAAAAAAAAAANATNGCNCTTGTTCANACNGGCTGATACNCCCTGCCATGTANCTACTACNGCTACTTACAGAAGGGCNGGNCAGTANACNCGTTGNGAACTGAANAATCTTCAAAAAAANGCTTTCNGGGTNGCTGTACCTATGTATTTTGATAGGGAANGTAAATAAAATTTATGTTCNC
  3   1   2       bld Ga18      in                      xlk139o22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ANNNCTTTTTTTNAGNNTCTGNANAACGGTAGTATGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACTAGATCTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCNTTCTGNG
  3   1   2       bld Ga18      in                      xlk133h02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTNCTTTTTTTNAGNATCTGNATAACGGTAGTNTGGGGAGCAAGGACTACAGTTGACATGTACAGCTGCATACGTTTTAGGGTATCAATATTCAGAAGAATGGCATTAATGACATAGGATAATTCTTTTCTATCCAAGTGAAACAGAACTTTAACTGTGAGATACCAGATCTAGAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATNCTTTCTGTGTTGCNTG
  3   1   2       bld Ga15 5g3  in                       XL414p07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGGATAATTTTTTTNTATCCNAGNGAAACNGAACTTTAACTGNGNGATNCTAGATTTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTC
  3   1   2       bld Tbd7      in                         XL058e11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAGAACTTTAACTGTNAGATACCAGATNTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAATGCTTTCTGTGTTGCTGTACCTATGTATTTTNATAGGGNA
  3   1   2       bld Ga15 5g3  in                       XL484p10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATTTAAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCTGTGTTGC
  5   1   2       add Tbd7      in                         XL058e11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   aaaaaaaaaaaGTATTGCTGCTTGTTCAGAACAGGCTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACNCGTTGTGAACTGAANAATCTTCAAAAAATGCTTTCTGTGTTGCTGTACCTATGTATTTTGATAGGGAATGTAAATAAAATTTATGTTCTCCTaaaaaaaaaa
  3   1   2       bld Ga12 5g3  in                         XL190i03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TNAAAAAAAAAAAGATTGCTCTTGTTCAGACAGGNTGATACACCCTGCCATGTAGCTACTACTGCTACTTACAGAAGGGCTGGTCAGTAGACGCGTTGTGAACTGAAGAATCTTCAAAAAAATGCTTTCTGTGTTGCTGTACCTATGTATTNTGATAGGGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)