Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 09 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-xlk158p08ex.5                         9 END     2           2       22                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xlnga001k04.3                         7 PI      87       1870     2112                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012837303 Xl3.1-XL473p09ex.5.5 - 81 ESTs
                                                                       ........-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-XL473p09ex.5.5                             CAGAGAGCAGGAGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTATGGACGAGGACGAGGAGGAAGAAGAAGAGGAGGAGGATGATGAAGAAGAAGAGGACGAGCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGCCCCCCGACCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTAATTCATGTTAATAATTATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGACACATTGGACATACATAGGGGAATAAAGGAAATTGTTTGTTTAAAAAACTCAAAACTAAAAAAAAAATTGGTCTGGAAGATGGTCTGGCAGAACAAAAAAAAAAAGTCTTATTTCATGGCAGCTCAAGGGGAGGGGGTCACCTTTTTTTATTATTTTTTAATGTTATTCTGCTGGAAACGAAAAAACAACTACAAGGAACTTGACAATTTTCTGGAAGAAGGAAAAAAAAAACTGATTTCTTCTATGCATCTGATTCTCAATCTGCAGGGAGTTGCAAGACGCAGACACAACTGCTACACTTACACACAACTGTGAACTGATTCAAGAGTTTACTTCTTACAGGTCAAACAATGTGCAGGTTATTCTTTTTTTTTTTTTGGTCACAATGTGATTTTTTTTTTATTATTTTTTTTGCCAACAACTACTTTATAATTTTATAACTGGTTCCCTTTATTATTACCTCCTTGAATCCAGACAACCCAGACCTCAGTAACAAAAAACAAAAAAGTAGAGAAAAAAAAAAGGTATTGAAACATTTTTGATACATAACAGACCTCAGTCTTTTTTTAAAAATTTAAACTATTTTCAGGCGTATTTTTGTACAGTTTAAAGAAAAGGGAACATTCCTGCTGTTT
                                                  Xl3.1-CHK-1012722629                                   GCAGGAGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTATGGACGAGGACGAGGAGGAAGAAGAAGAGGAGGAGGATGATGAAGAAGAAGAGGACGAGCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGCCCCCCGACCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTAATTCATGTTAATAATTATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGAxxxxxxGGACATAxxxxxGGGAATxAAGxAAATTGTTTxxxxAAAAAACTCAAAACTAAAAAAAAAATTGGTCTGGAAGATGGTCTGGCAGAACAAAAAAAAAAAGTCTTATTTCATGGCAGCTCAAGGGGAGGGGGTCACCTTTTTTTATTATTTTTTAATGTTATTCTGCTGGAAACGAAAAAACAACTACAAGGAACTTGACAATTTTCTGGAAGAAGGAAAAAAAAAACTGATTTCTTCTATGCATCTGATTCTCAATCTGCAGGGAGTTGCAAGACGCAGACACAACTGCTACACTTACACACAACTGTGAACTGATTCAAGAGTTTACTTCTTACAGGTCAAACAATGTGCAGGTTATTCTTTTTTTTTTTTTGGTCACAATGTGATTTTTTTTTTATTATTTTTTTTGCCAACAACTACTTTATAATTTTATAACTGGTTCCCTTTATTATTACCTCCTTGAATCCAGACAACCCAGACCTCAGTAACAAAAAACAAAAAAGTAGAGAAAAAAAAAAGGTATTGAAACATTTTTGATACATAACAGACCTCAGTCTTTTTTTAAAAATTTAAACTATTTTCAGGCGTATTTTTGTACAGTTTAAAGAAAAGGGAACATTCCTGCTGTTTTTTTTT
                                                      consensus depths                                  8    17    18    29    24    31    27    36    28    38    29    38    30    39    31    39    32    40    32    42    31    42    32    42    32    42    32    43    40    43    40    43    40    44    41    44    44    44    44    44    42    44    44    44    45    45    45    45    44    45    45    45    45    46    45    46    46    47    45    47    45    48    45    48    45    48    44    47    45    49    45    49    43    48    42    47    42    48    37    48    42    48    33    48    34    50    35    51    34    51    30    48    30    48    29    47    28    47    26    47    26    46    26    45    25    45    22    42    22    39    14    29    14    28    15    27    13    24    11    20    10    19    10    21    12    21    15    22    16    23    17    24    17    24    16    26    19    26    18    24    19    25    19    24    19    24    19    24    18    21    17    22    18    22    18    22    20    23    19    22    19    22    21    23    21    24    18    24    23    24    24    25    21    25    22    25    23    24    23    24    23    24    23    24    22    24    23    24    22    24    22    24    21    24    23    25    23    25    22    25    21    25    22    25    22    25    22    25    22    25    20    24    19    23    11    21    11    21    11    21    11    21    11    21    11    20    11    20    11    20    10    20    11    19    17    19    10    18    10    18    10    18     8    15     8    14     5    12     5    11     4     9     3     8     3     7     2     4     2     3     2     3     3     4     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     3     5     2     4     2     4     2     4     2     4     2     3     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2      4-98                               Xl3.1-XL473p09ex.5                             CAGAGAGCAGGAGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTATGGACGAGGACGAGGAGGAAGAAGAAGAGGAGGAGGATGATGAAGAAGAAGAGGACGAGCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGCCCCCCGACCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTAATTCATGTTAATAATTATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGACACATTGGACATACATAGGGGAATAAAGGAAATTGTTTGTTTAAAAAACTCAAAACTAAAAAAAAAATTGGTCTGGAAGATGGTCTGGCAGAACAAAAAAAAAAAGTCTTATTTCATGGCAGCTCAAGGGGAGGGGGTCACCTTTTTTTATTATTTTTTAATGTTATTCTGCTGGAAACGAAAAAACAACTACAAGGAACTTGACAATTTTCTGGAAGAAGGAAAAAAAAAACTGATTTCTTCTATGCATCTGATTCTCAATCTGCAGGGAGTTGCAAGACGCAGACACAACTGCTACACTTACACACAACTGTGAACTGATTCAAGAGTTTACTT
  5   1   2      4-98                               Xl3.1-xlk79k20ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAAAAAAGTCTTATTTCNTGGCAGCTCAAGGGGAGGGGGTCACCTTTTTTTATTATTTTTTTAATGTTATCTGCTGGAAACGAAAAAACAACTACAAGGAACTTGACAATTTTCTGGAAGAAGGAAAAAAAAAACTGATTTCTTCTATGCATCTGATTCTCAATCTGCAGGGAGTTGCAAGACGCAGACACAACTGCTACACTTACACACAACTGTGAACTGATTCAAGAGTTTACTTCTTACAGGTCAAACAATGTGCAGGTTATTCTTTTTTTTTTTTTGGTCACAATGTGATTTTTTTTTTATTATTTTTTTTGCCAACAACTACTTTATAATTTTATAACTGGTTCCCTTTATTATTACCTCCTTGAATCCAGACAACCCAGACCTCAGTAACAAAAAACAAAAAAGTAGAGAAAAAAAAAAGGTATTGAAACATTTTTGATACATAACAGACCTCAGTCTTTTTTTAAAAATTTAAACTATTTTCAGGCGTATTTTTGTACAGTTTAAAGAAAAGGGAACATTCCTGCTGTTTTTTTTTTTTTTATTATTGTTATGAATTTTTTTGGTTCAGNGAGACTTTCAGGCACTTCCTATCTCTTCTCTCTCTGTCTTAGCATGCAAGTATGTT------------TCCTGGTTAANGGATTAAAATTTAAAAAAAAAATGN
                                                                   VAR                                         GAAGGAGCAGGG
                                                                   VAR                                                                 ATGTAAGGCGCT
                                                                   VAR                                                                                                     CAGCAACAGTGAAATTGAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCGACACGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTCCAAGTCGCCGACCCTGGCTCAATCCCCGGAGAAAAGCCCCAAGAGCCGCAGCGCGGGCAAGAAATGCCCCAAACTGAAACCCAGTCACAGCGGCAACAGCTCCAAGTCGCTCAGCATCAAGTCCGAGTACGGGGTCGGCGGCGACTATGTGTTCGGCAGCCCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTCGTCCGGCAAAGCGGCCGTGATGAAATGCGTCTTTATGGACGAGGACGATGAGGAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCTCGCCACTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGAGGGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGCCACATTGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGGAATGAAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAGAAAGGAAA
                                                                   SNP                                                                                                                                                                                                                             ------C-G---
                                                                   SNP                                                                                                                                                                                                                                         ----T--G----
                                                                   SNP                                                                                                                                                                                                                                                     ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                 -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                             --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----A--T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A-C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             T---C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---C-----C--
                                               BLH ATG     110     981                             
                                               BLH MIN     110     146                             
                                               BLH OVR     110      91                             
                                               EST CLI      -9      42                             
                                               ORF LNG     110       7                             
  5   1   2      4-98                               Xl3.1-XL473p09ex.5                             CAGAGAGCAGGAGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTATGGACGAGGACGAGGAGGAAGAAGAAGAGGAGGAGGATGATGAAGAAGAAGAGGACGAGCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGCCCCCCGACCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTAATTCATGTTAATAATTATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGACACATTGGACATACATAGGGGAATAAAGGAAATTGTTTGTTTAAAAAACTCAAAACTAAAAAAAAAATTGGTCTGGAAGATGGTCTGGCAGAACAAAAAAAAAAAGTCTTATTTCATGGCAGCTCAAGGGGAGGGGGTCACCTTTTTTTATTATTTTTTAATGTTATTCTGCTGGAAACGAAAAAACAACTACAAGGAACTTGACAATTTTCTGGAAGAAGGAAAAAAAAAACTGATTTCTTCTATGCATCTGATTCTCAATCTGCAGGGAGTTGCAAGACGCAGACACAACTGCTACACTTACACACAACTGTGAACTGATTCAAGAGTTTACTT
                                                  Xl3.1-CHK-1012685908                                   GCAGGAGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTATGGACGAGGACGAGGAGGAAGAAGAAGAGGAGGAGGATGATGAAGAAGAAGAGGACGAGCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGCCCCCCGACCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTAATTCATGTTAATAATTATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGAxxxxxxGGACATAxxxxxGGGAATxAAGxAAATTGTTTxxxxAAAAAACTCAAAACTAAAAAAAAAATTGGTCTGGAAGATGGTCTGGCAGAACAAAAAAAAAAAGTCTTATTTCATGGCAGCTCAAGGGGAGGGGGTCACCTTTTTTTATTATTTTTTAATGTTATTCTGCTGGAAACGAAAAAACAACTACAAGGAACTTGACAATTTTCTGGAAGAAGGAAAAAAAAAACTGATTTCTTCTATGCATCTGATTCTCAATCTGCAGGGAGTTGCAAGACGCAGACACAACTGCTACACTTACACACAACTGTGAACTGATTCAAGAGT
  5   1   2       bld Eye1 5g                         IMAGE:7019866.5p CTGGTCCGGTCCGGATTCCCGGGATGCTCAGAGAGCAGGAGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCTTTCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTATggacgaggaccaggagggaagaagaagaggaggaggatgatgtaagaagaggaggacgagCTGCCAGATCAGGATTAAACAGGGAGGAAGACGACAAGGCCGCTTGCGAACAAATATAATGGTGGGCCCAAAGTTGCCCGGGCCAAGTTA
  5   1   2       bld Ga15 5g                            XL473p09ex.5p                 AGtgagagagctcagagagcaggagagagagGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTATGGACGAGGACGAGGAGGAAGAANAAGAGGAGGGAGGATGATGA
  5   1   2       bld DMZ  5g3  in                         xl296g18.5p                  GtgagagagctcagagagcaggagagagagGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGA
  5   1   2       bld Tbd7 5g                              XL067c17.5p                    GgagagagagagagagcaggagagagagGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGC
  5   1   2       bld Ga15 5g                            XL486p11ex.5p                    TCCGGAGAGCTCAGAGAGCAGGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTATGGACGAGG
  5   1   2       bld Em10 5g                         IMAGE:8320500.5p                    GTgagagagctcagagagcaggagagagGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGCGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCAGCGGCGGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAGCGTCCGGCAAACTGCGGCAGCGGCGTGAATGCGTCTTatggacgagacgagaggagaagagaggagacgagatgagaagagagacgactgcgtcagattacggagagaCACAGCGCTCACATTATGTGCAAGTGCGCATCGACTGATCTCTCGCAT
  5   1   2       bld DMZ  5g                              xl305g16.5p                    gagagagctcagagagcaggagagagagGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCC
  5   1   2       bld DMZ  5g                              xl245f10.5p                    gagagagctcagagagcaggagagagagGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTATGGACG
  5   1   2       bld DMZ  5g                              xl241b23.5p                    GTGAGACAGCTCAGAGAGCAGGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAG
  5   1   2       bld Ga15 5g                            XL434m08ex.5p                      AGCTCANAGAGCAGGAGAGAGAGGGGCTCTATGCTGAGGAACTGGCANATAACAGCTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCANTGACAGCCATGGTGCAGCGAGCATACATGGACAGCAGCCANCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCNANCGGAGGAANATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTATGGAC
  5   1   2      seed Ga15 5g                            XL463o23ex.5p                      gagagctcagagagcaggagagagagGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTATGGACGAG
  5   1   2       bld Emb3 5g3  out                   IMAGE:3399663.5p                        GAGCTCAGAGAGCAGGAGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGCGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCATGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGTAAAGAGCTCATAGTGGATCCTTCAGTCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCATCGCCGGGCATGATATGCCCCAAACTCAAGCCTAGTCACAGCGGCTGCGGGTCCCAGTGCGTCAGTATTCAAGTCCGAGTACAGCGGCTGGCAGCGACCAGTATTGTGTT
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3200690.5p                         AGAGCTCAGAGAGCAGGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACA
  5   1   2       bld Ga18 5g3  in                      xlk145b01ex.5p                         AGAGAGNTCAGNGNNNNGAGAGAGGGNNTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCNGGTGCCTCTGGACGAAAGNGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCNGNNNNGNANNAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCNGNCNCCNAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCNNNNNNNCGAGTATNTGTTCGGNAGCCCCAAAGCGTCCGGNAAANNTG
  5   1   2       bld Ga18 5g3  in                      xlk143p03ex.5p                           AGCTCAGNGNNNGGAGAGAGAGGGGNTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCGGTGCCTCTGGACGAAAGNGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACNAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCG
  5   1   2       bld Tbd7 5g                              XL060n21.5p                            GAGNAGCAGGAGNAGTAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGC
  5   1   2       bld Ga18      in                       xlk69j22ex.5p                            GCTCAGNGNNNNGAGAGAGAGGGNNTCTATGTGAGGAANTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGNAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCGGTGCCTCTGGACGAAAGNGACCCGGACTGGTGTAAAACGGCCACCGGNNACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCA
  5   1   2       bld Tbd7 5g                              XL094l19.5p                               GAGCAGGAGNAGAGNAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTNCAAGTCGCTCAGTAT
  5   1   2       bld DMZ                                  xl233m16.5p                                GCCGCGCTGGAAGGAGCAGGGAAGTAGGGCTCTATGTAAGTCGCTGGCACAGGAGTGCAACAGTAGCAACAGCAACAGTGAAATTGAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGCGGCTCTGGATGAGAGTGACCCAGACTGGTGCAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGCGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTAAAACACATGGCCGACTACCCCGACTACAAGTACCGGCCCAGGAAAAAACCTAAAGTGGATCCTACCGCCTCCAAGTCGCCGACCCTGGCTCAATCCCCGGAGAAAAGCCCCAAGAGCCGCAGCGCGGGCAAGAAATGCCCCAAACTGAAACCCAGTCACAGCGGCAACAGCTCCAAGTCGCTCAGCATCAAGTCCGAGTACGGGGTCGGCGGCGACTATGTGTTCGGCAGCCCCAAGTCGTCNGGCAAAGCGGCCGTGATGAAATGCGTCTTT
  5   1   2       bld Oo1                             IMAGE:6642770.5p                                 CCGCGCTGGAAGGAGCAGGGAAGTAGGGCTCTATGTAAGGCGCTGGCACAGGAGTGCAACAGTAGCAACAGCAACAGTGAAATTGAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGCGGCTCTGGATGAGAGTGACCCGGACTGGTGCAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGCGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTACCCCGACTACAAGTACCGGCCCAGGAAAAAACCCAAAGTGGATCCTACCGCCTCCAAGTCGCCGACCCTGGCTCAATCCCCGGAGAAAAGCCCCAAGAGCCGCAGCGCGGGCAAGAAATGCCCCAAACTGAAACCCAGTCACAGCGGCAACAGCTCCAAGTCGCTCAGCATCAAGTCCGAGTACGGGGTCGGCGGCGACTATGTGTTCGGCAGCCCCAAGTCGTCCGGCAAAGCGGCCGTGATGAAATGCGTCTTTAtggacgaggacgatgaggaggaggaggaggatgaagaagaagaagaggaCGAGCTGCAGATCAGGATCAAACAGGAGGGAAGACGACGAGTCGCTGCGACTTTACAATGGTGGCCAAAGNTGCCGGCCAGTNCCGAACCCTGAGTTCATCCTCGGGCCGAAATTCCGGTGGAAAGCCGCCCAAGTAATGGTACCA
  5   1   2       bld DMZ                                  xl249e17.5p                                 CCGCGCTGGAAGGAGCAGGGAAGTAGGGCTCTATGTAAGGCGCTGGCACAGGAGTGCAACAGTAGCAACAGCAACAGTGAAATTGAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGCGGCTCTGGATGAGAGTGACCCAGACTGGTGCAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGCGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTAAAACACATGGCCGACTACCCCGACTACAAGTACCGGCCCAGGAAAAAACCTAAAGTGGATCCTACCGCCTCCAAGTCGCCGACCCTGGCTCAATCCCCGGAGAAAAGCCCCAAGAGCCGCAGCGCGGGCAAGAAATGCCCCAAACTGAAACCCAGTCACAGCGGCAACAGCTCCAAGTCGCTCAGCATCAAGTCCGAGTACGGGGTCGGCGGCGACTATGTGTTCGGCAGCCCCAAGTCGTCCGGCAAAGCGGCCGTGATGAAATGCGTCTTTATGGACG
  5   1   2       bld Tbd7 5g                              XL102n07.5p                                  CACGAGGGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTNCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTAT
  5   1   2       bld Ga12 5g3  out                        XL212p24.5p                                    CAGGAGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGT
  5   1   2       bld Tbd7 5g                              XL055c10.5p                                     GGGAGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCC
  5   1   2       bld Tbd7 5g                              XL077g22.5p                                       GGCACGAGGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGA
  5   1   2       bld Tbd7 5g                              XL063p10.5p                                        GGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGNTNCAAGTCGCTCAGTATCAAGTTCCGAGTACAGCGGCGGCAGCGACGAG
  5   1   2       bld Ga12 5g   ?                          XL183e12.5p                                        AGAGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAA
  5   1   2       bld Gas6 5g                         IMAGE:3473800.5p                                         GTGAGAGGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGCGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCG
  5   1   2       chi Ga18      in                       xlk61h16ex.5p                                         GAGAGAGGGGNTCTATGTGAGGAANTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGNNCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGNACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGNGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGNNNNGNAGNAATGCCCCAAACTCAAGCCCAGTCACAGCGNNNNNNNCCAAGTCNNTCAGTATCAAGNCCGAGTACAGCGGCNNNANNACNAGNATGTNTTCGGCAGCCCCNAA
  5   1   2       bld Neu7 5g                              XL036i02.5p                                               AGGGCTCTATGTGAGGAACTGGCAGTAACAGTAGCGTCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCC
  5   1   2       bld Neu7 5g   ?                          XL017m18.5p                                                  GCTCTATGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCC
  5   1   2       bld Neu7                                 XL033k17.5p                                                       CTCTATGTAAGGCGCTGGCACAGGAGTGCAACAGTAGCAACAGCAACAGCAGCAGTGAAATTGAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGCGGCTCTGGATGAGAGTGACCCGGACTGGTGCAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGCGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTAAAACACATGGCCGACTACCCCGACTACAAGTACCGGCCCAGGAAAAAACCCAAAGTGGATCCTACCGCCTCCAAGTCGCCGACCCTGGCTCAATCCCCGGAGAAAAGCCCCAAGAGCCGCAGCGCGGGCAAGAAATGCCCCAAACTGAAACCCAGTCACAGCGGCAACAGCTCCAAGTCGCTCAGCATCAAGTCCGAGTACGGGGTCGGCGGCGACTATGTGTTCGGCAGCCCCAAGTCGTCCGGC
  5   1   2       bld Tbd7 5g                              XL090g05.5p                                                        GGTGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAG
  5   1   2       bld Ga12                                 XL191i11.5p                                                         AGGGCTCTATGTAAGGCGCTGGCACAGGAGTGCAACAGTAGCAACAGCAGCAGTGAAATTGAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGCGGCTCTGGATGAGAGTGACCCGGACTGGTGCAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGCGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTAAAACACATGGCCGACTACCCCGACTACAAGTACCGGCCCAGGAAAAAACCCAAAGTGGATCCTACCGCCTCCAAGTCGCCGACCCTGGCTCAATCCCCGGAGAAAAGCCCCAAGAGCCGCAGCGCGGGCAAGAAATGCCCCAAACTGAAACCCAGTCACAGCGGCAACAGCTCCAAGTCGCTCAGCATCAAGTCCGAGTACGGGGTCGGCGGCGACTATGTGTTCGGCAGCCCCAAGTCGTCCGGCAAAGCGGCCGTGATGAAATGCGTCTTTATGGACGAGG
  5   1   2       bld Neu7 5g                              XL021g24.5p                                                          GGAGGAACTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAG
  5   1   2       bld Tbd7 5g                              XL057d16.5p                                                                 CTGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGC
  5   1   2       bld Neu7 5g                              XL001p03.5p                                                                   TGGCAGTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGA
  5   1   2       bld Neu7 5g                              XL023p23.5p                                                                       GTAACAGTAGCGCCTATACGCGTCACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAG
  5   1   2       bld Emb3 5g                IMAGE:3399663-IMAGp.IMAGp                                                                                              CACCGGCAGCCAAATCCAAAGTAGTCCCGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACCTGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGCGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTatggacgaggacgaggaggaagaagaagaggaggaggatgatgaagaaaaagaggaCGAGCTCCCTCTTTCGATCTCAGCTTGAACTCACCCAGCAGAAACCCTCAGCTCCCCCGACCCCAACTCAGGAAAACGTCTCCCTCTCCATCAACATCTCGGGAACAGATTTTAAAGGGGCTG
  5   1   2       bld Ga15 5g                            XL450n14ex.5p                                                                                                                           CGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCAGCACGGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTatggacgaggacgaggaggaagaagaagaggaggaggatgatgaagaagaagaggaCGAGCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTACCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACG
  5   1   2       bld Ga15                               XL490e08ex.5p                                                                                                                               CGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGCGGCTCTGGATGAGAGTGACCCAGACTGGTGCAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGCGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTAAAACACATGGCCGACTACCCCGACTACAAGTACCGGCCCAGGAAAAAACCTAAAGTGGATCCTACCGCCTCCAAGTCGCCGACCCTGGCTCAATCCCCGGAGAAAAGCCCCAAGAGCCGCAGCGCGGGCAAGAAATGCCCCAAACTGAAACCCAGTCACAGCGGCAACAGCTCCAAGTCGCTCAGCATCAAGTCCGAGTACGGGGTCGGCGGCGACTATGTGTTCGGCAGCCCCAAGTCGTCCGGCAAAGCGGCCGTGATGAAATGCGTCTTTATGGACGAGGACGATGAGGAGG
  5   1   2       bld Ga15                               XL492h10ex.5p                                                                                                                               CGCGTTGCAGTGACAGCCATGGTGCAGCGAGCAGACATGGACAGCAGCCAGCACACTGAGCCCGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGCGGCTCTGGATGAGAGTGACCCAGACTGGTGCAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGCGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTAAAACACATGGCCGACTACCCCGACTACAAGTACCGGCCCAGGAAAAAACCTAAAGTGGATCCTACCGCCTCCAAGTCGCCGACCCTGGCTCAATCCCCGGAGAAAAGCCCCAAGAGCCGCAGCGCGGGCAAGAAATGCCCCAAACTGAAACCCAGTCACAGCGGCAACAGCTCCAAGTCGCTCAGCATCAAGTCCGAGTACGGGGTCGGCGGCGACTATGTGTTCGGCAGCCCCAAGTCGTCCGGCAAAGCGGCCGTGATGAAATGCGTCTTTAtggacgaggacgatgaggaggaggaggaggaTGAAGAAGAAGAGGACGAGCTGCAGATCAGGATCAAACAGGAGGAAGACGACGAGTCGCTGCGACTTTACAATGTGGCCAAAGTGCCGGCCAGTCCGA
  5   1   2       bld Ga15                               XL455f16ex.5p                                                                                                                                                                                     ACTGAGCCCGACACGGAGGAAGGGGAGTTCATGGCGTGCAGCCCGGCGGCTCTGGATGAGAGTGACCCGGACTGGTGCAAAACGGCCACCGGGCACATAAAACGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGCGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTAAAACACATGGCCGACTACCCCGACTACAAGTACCGGCCCAGGAAAAAACCCAAAGTGGATCCTACCGCCTCCAAGTCGCCGACCCTGGCTCAATCCCCGGAGAAAAGCCCCAAGAGCCGCAGCGCGGGCAAGAAATGCCCCAAACTGAAACCCAGTCACAGCGGCAACAGCTCCAAGTCGC
  5   1   2       bld Ga15                               XL454f21ex.5p                                                                                                                                                                                                                   ATGGCGTGCAGCCCGGTGCCTCTGGACGAAAGTGACCCGGACTGGTGTAAAACGGCCACCGGGCACATCAAGCGGCCAATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTATggacgaggacgaggaggaagaagaagaggaggaggatgatgaagaagaagaggACGAGCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTACCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGC
  5   1   2       bld Neu7                                 XL024b14.5p                                                                                                                                                                                                                                                                                                 ATGAACGCCTTTATGGTCTGGTCCAAGATCGAGCGGAGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCAT
  5   1   2       bld Ga15      ?                        XL460k23ex.5p                                                                                                                                                                                                                                                                                                                                                 ATCGAGCGGCGGAAGATTATGGAACAATCCCCGGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTAAAACACATGGCCGACTACCCCGACTACAAGTACCGGCCCAGGAAAAAACCTAAAGTGGATCCTACCGCCTCCAAGTCGCCGACCCTGGCTCAATCCCCGGAGAAAAGCCCCAAGAGCCGCAGCGCGGGCAAGAAATGCCCCAAACTGAAACCCAGTCACAGCGGCAACAGCTCCAAGTCGCTCAGCATCAAGTCCGAGTACGGGGTCGGCGGCGACTATGTGTTCGGCAGCCCCAAGTCGTCCGGCAAAGCGGCCGTGATGAAATGCGTCTTTAtggacgaggacgatgaggaggaggaggaggatgaagaagaagaggacgagCTGCAGATCAGGATCAAACAGGAGGAAGACGACGAGTCGCTGCGACTTTACAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGATATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCCCAAGCCACCATCACCCTGGCCCCCCGACCCCTCCTCGCCACTACCTCACCCGCCGGCAGCCACGAGCTCCTTCTTCGATCTCAGTTTGAACTTCA
  5   1   2       bld DMZ                                  xl297g18.5p                                                                                                                                                                                                                                                                                                                                                                           CGAGATCTCCAAGCGCCTGGGGAAACGCTGGAAAATGCTCAACGACAGCGAGAAAATCCCCTTCATCAGGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCAGGAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCNGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCNGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAG
  5   1   2       bld Ga15                               XL422g17ex.5p                                                                                                                                                                                                                                                                                                                                                                                          CTGGGGAAACGCTGGANAATGCTCAACGACAGCGAGAAAATCCCCTTCATCANGGAAGCCGAGCGGCTGCGGCTCAAACACATGGCCGACTATCCCGACTACAAGTACCGGCCCANNTAAAAAGCCCAAAGTGGATCCTTCAGCCTCGTCTAAACCCCCGGCTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACANCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGNAGCGACGAGTATGTGTTCGGCAG
  5   1   2       chi Emb4                            IMAGE:5537033.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGACGCGTGGGTGCGGCTAAAACACATGGCCGACTACCCCGACTACAAGTACCGGCCCAGGAAGAAACCCAAAGTGGATCCTACCGCCTCCAAGTCGCCGACCCTGGCTCAATCCCCGGAGAAAAGCCCCAAGAGCCGCAGCGCGGGCAAGAAATGCCCCAAACTGAAACCCAGTCACAGCGGCAACAGCTCCAAGTCGCTCAGCATCAAGTCCGAGTACGGGGTCGGCGGCGACTATGTGTTCGGCAGCCCCAAGTCGTCCGGCAAAGCGGCCGTGATGAAATGCGTCTTTATggacgaggacgatgaggaggaggaggaggaggatgaagaagaagaagaggacgagCTGCAGATCAGGATCAAACAGGAGGAAGACGACGAGTCGCTGCGACTTTACAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGATATTCGCAACGGCACCCGCCCTCTACTACAACTTTCAAGAACATCACCCAAGCAAAGCACAATCCCCCCCAAGCCACCATTCACCCTGGGCCCCCCGGACCCCTCCTCGCCAACTACCTCAACCCGGCGGGCAGGCCACGAGCCTCCTCTTTCGAATCTCAGTTTGAAACTTCCACCCAACCAGGAACCCTCCGTTTCCCCCGAACCCCCCACTCACGGAAAAAGGGCCTCCCCTCATACCCTGGGTGGGGACAAAGGGACCTTGGCACCTCCTTGGGAAGCGAAGGGGAAAGCCCTCGAGGTCTCCCCCGCTTCCAACCTTTCCCCGCGAATTGACTTGCGACACCCTCCGGAAACTTCCACTGAAGATGGAATCCCCACGGGGACCCCGCGGTTGTGAAACTCCCCACCTTTCTCCCCAACTCCTGGGTGCTGCCCCTTGTTACTGGGAAACCGCCGCGTGGGGAACCCTGCCCTGATCGCTCAGGTCTCTCCCGCAGCCGCAGTCCG
  5   1   2       bld Ga15                               XL491e08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCGAGCGGCTGCGGCTAAAACACATGGCCGACTACCCCGACTACAAGTACCGGCCCAGGAAAAAACCTAAAGTGGATCCTACCGCCTCCAAGTCNCCGACCCTGGCTCAATCCCCGGAGAAAAGCCCCANNAG
  3   1   2       bld Ga18      in                       xlk69j22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATNNCNACTNNCCNNNCTACNANNNCCGGCCNAGNAAAAANNCNAANNGNTCCTTCAGCCTCGTCTAANCCCCNGNTNNNNNNTNANTCTCCNGAGAAGANTCCNAAGANNNNCAGNGCCGNNAGGNAATGCCCCAAACTCAAGNCCAGTCACAGNNGNNAGCGNCTNCAAGTCGCTCAGTATNNAGTCCGAGTACAGCGGCGGNAGCGACGAGTATGTGTTCGNCAGCCCCAAANCGTCCGNNAAANGCTGCGGCAGCGGCGGTGAAATGCGTCTTTATGGACGAGGACGAGGAGGAAGAAGAAGAGGAGGAGGATGATGAAGAAGAAGAGGNCGAGCTGCAGATCAGGATTAAACAGGAGGAAGACGACGANNCGCTGCGACAATATAATGTGGNCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGNACCCGCCTCTACTACAACTTCAAGAACATCACCAANCAAAGCACAATCCCACAAGCCACCATCACCCTGGCCCCCCGACCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTATTCATGTTAATAATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGAGGGCCACATTGGACATAGGGGAANGAAGNA
  3   1   2       bld Ga18 5g3  in                      xlk145b01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTACAAGTNCCNNCCNANNAAAAAGCCCAANGTGGATCCTNNANCCTCGTCTAAACCCCGGCTNTNACTCAATNNCNNNAGAAGANTNCCAAGAGCNCAGCGCNNGCAGNAAAATGCCCNAACTCAAGNCNAGTCACANNGNNAGCGGCNNNAANTCGCTCAGTATNANGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCNGCAGNCCCCAAAAGCGTCCCGNCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTATGGACGAGGACGAGNAGGAAGNAGAAGAGGAGGAGGATGATGAAGAAGAAGAGGNCGAGCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTACCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGNACCCGCCTCTACTACAACTTCAAGAACATCACCAANCAAAGCACAATCCCACAAGCCACCATCACCCTGGCCCCCCGACCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTAATTCATGTTAATAATTATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGAGGNNCACATNGGACA
  5   1   2       bld DMZ       out                        xl249p08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAACCCCCGGCTCTCACTCAATCTCCGGAGAANAGTCCCAAGAGCCGCANCGCCGGCNGGAAATGCCCCAAANTCAAGCCCNGTCNCAGCGGCNGCGGCTCCNAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCNGCGACNAGTATGTGTTCGGNA
  5   1   2       bld Emb4                   IMAGE:5537033-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACCGCCTCCAAGTCGCCGACCCTGGCTCAATCCCCGGAGAAAAGCCCCAAGAGCCGCAGCGCGGGCAAGAAATGCCCCAAACTGAAACCCAGTCACAGCGGCAACAGCTCCAAGTCGCTCAGCATCAAGTCCGAGTACGGGGTCGGCGGCGACTATGTGTTCGGCAGCCCCAAGTCGTCCGGCAAAGCGGCCGTGATGAAATGCGTCTTTATGGACGAGGACGATgaggaggaggaggaggaggaTGAAGAAGAAGAAGAGGACGAGCTGCAGATCAGGATCAAACAGGAGGAAGACGACGAGTCGCTGCGACTTTACAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGATATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCCCAAGCCACCATCACCCTGGCCCCCCGACCCCTCCTCGCCACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGTTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGT
  5   1   2       bld Ga15                               XL428c05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCTCACTCAATCTCCGGAGAAGAGTCCCAAGAGCCGCAGCGCCGGCAGGAAATGCCCCAAACTCAAGCCCAGTCACAGCGGCAGCGGCTCCAAGTCGCTCAGTATCAAGTCCGAGTACAGCGGCGGCAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTatggacgaggacgaggaggaagaagaagaggaggaggatgatgaagaagaagaggaCGAGCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTACCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATcccccaagccaccatcaccctggccccccgacccgcccccaCGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCttttttttAATTC
  3   1   2       bld Ga18 5g3  in                      xlk143p03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GNANNAAGANNNCNANGANNNNANNNNCNGCANNAAATNNCCNAAACTCAAGCCNAGTCANANNGGNANCNGCTCCAANTCGCTCAGTATNAAGTCCGAGTANANNGGNGGNAGCGACGAGTATGTGTTCGGCAGCCCCAAAGCNTCCNNNAAAGCTGCGGCAGCGGCGGTGAAATNNNTCTTTATGGACGAGGNCGAGGAGGNAGAAGNAGAGGAGGAGGATGATGAAGAAGAAGAGGNCGAGCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGNCGCTGCGACAATATAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCANCGGNACCCGCCTCTACTACAACTTCAAGAACATCACCAANCAAAGCACAATCCCACAAGCCACCATCACCCTGGCCCCCCGACCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTATTCATGTTAATAATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGAGGGCCACATTGGACATAGGGGAATGAAGAAAGGAAATTGTTTAAAAAAAAANCTCAAAACTNAAAA
  5   1   2       bld Ga15      ?                        XL404n15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCCAAGAGCCGCAGCGCGGGCAAGAAATGCCCCAAACTGAAACCCAGTCACAGCGGCAACAGCTCCAAGTCGCTCAGCATCAAGTCCGAGTACGGGGTCGGCGGCGACTATGTGTTCGGCAGCCCCAAGTCGTCCGGCAAAGCGGCCGTGATGAAATGCGTCTTTATggacgaggacgatgaggaggaggaggaggatgaagaagaagaagaagaGGACGAGCTGCAGATCAGGATCAAACAGGAGGAAGACGACGAGTCGCTGCGACTTTACAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGATATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCCCAAGCCACCATCACCCTGGCCCCCCGACCCCTCCTCGCCACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGTTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATCACTGGGACCttttttttttttNGT
  5   1   2       bld Brn2                             Brn2-za42e06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGTGTTCGGCAGCCCCAAAGCGTCCGGCAAAGCTGCGGCAGCGGCGGTGAAATGCGTCTTTAtggacgaggacgaggaggaagaagaggaggaggacgatgatgaagaagaagaggacgagCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGCCCCCCGACCC
  5   1   2       chi Ga15                               XL499l23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGACTATGTGTTCGGCAGCCCCAAGTCGTCCGGCAAAGCGGCCGTGATGAAATGCGTCTTTAtggacgaggacgatgaggaggaggaggaggatgaagaagaagaggacgagCTGCAGATCAGGATCAAACAGGAGGAAGACGACGAGTCGCTGCGACTTTACAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGATATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCCCAAGCCACCATCACCCTGGCCCCCCGACCCCTCCTCGCCACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGTTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCAccccccccATCCATTTGTCTCCCCAGCAACAACAAAAATTTTGAATAATAATATTAATTATTAACAAACAAACaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl296g18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGACGAGGACGAGGAGGAAGAAGAAGAGGAGGAGGATGATGAAGAAGAAGAGGACGAGCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGCCCCCCGACCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTATTCATGTTAATAATTATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGAT
  5   1   2       bld DMZ       in                         xl223d13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         aagaagaggaggaggatgatgaagaagaagaggacgagCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTACCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGccccccgacccgcccccACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCttttttttaattcatgttaataattattattattattattccaatggggagggggaggggCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAG
  5   1   2       bld DMZ       in                         xl241d23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         aagaagaggaggaggatgatgaagaagaagaggacgagCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTACCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGccccccgacccgcccccACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCttttttttaattcatgttaataattattattattattattccaatggggagggggaggggCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCA
  3   1   2       bld Ga18      in                       xlk61h16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGAGGAGGATGATGNAGAGNAGAGGNCGANCTGCAGNNCAGGATTAAACAGGAGGAAGNNGNCGAGCCGCTGNGNCAATATANTGTGNCCAAAGTNCCGGCCAGTCCNGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGNAGGCGCCAGTATGTACGAGGACATTCGNANNNNNNCCGCCTCTACTACANCTTCAAGAACATCNCCNNNNNAGCACAATCCCACAANCCACCATCACCCTGNCCCCCCGACCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTAATTCATGTTAATAATTATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGAGGNCCACATTGGACATAGGGGAANGAAGA
  5   1   2       bld Tbd7                                 XL108k07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGATGATGAAGAAGAAGAGGACGAGCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGccccccgacccgcccccACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCttttttttATTCATGTTAATAATTATTATTATTATTCCAATggggagggggaggggCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAG
  5   1   2       bld Gas3      in                      xlnga002m24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCTGCAGATCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTACCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGccccccgacccgcccccACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTTGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTNTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCttttttttaattcatgttaataattattattattattattccaatggggagggggaggggCACAAAAATTCTTTGAGCTCCATCAACATCTCCGTACAGATTTAAAAGGCTGGTCTTGCATCTGGTTTTTATATATCTATCTC
  5   1   2       bld Gas5      in                    IMAGE:3747634.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAGGATTAAACAGGAGGAAGACGACGAGCCGCTGCGACAATATAATGTGGCCAAAGTACCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGccccccgacccgcccccACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTTGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGNGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCANGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTT
  3   1   2       bld DMZ       in                         xl241d23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGACGACGAGCCGNTGCGACAATATAATGTGGCCAAAGTACCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGCCCCCCGACCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTNTTCGATNTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTAATTCATGTTAATAATTATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGAGGGCCACAT
  5   1   2       bld Tbd7                                 XL102f24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGAGCCGCTGCGACAATATAATGTGGCCAAAGTGCCGGCCAGTCCGACCCTGAGTTCATCCTCGGCCGAGTCGGTGGAAGGCGCCAGTATGTACGAGGACATTCGCAACGGCACCCGCCTCTACTACAACTTCAAGAACATCACCAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGccccccgacccgcccccACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCCTTTTTTTATTCATGTTAATAATTATTATTATTATTCCAATggggagggggaggggCACAAAAATTNTTTGAGCTC
  3   1   2       bld Gas3      in                      xlnga002m24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCAAGTCAGACCTGAGTTCATTCTTGGGCGAAGTCGGTGAAGGCCGCCAGTATGTACGAGACATTTGGCACGGGCACCCGCCTCTACTTCAAACTCAAAGAACATCACCAAGCAAAGCACAATCCCCCAAGCCACCATCACCCTGGCCCCCCGACCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTTGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCNTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTAATTCATGTTAATAATTATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGAGGGCCACATTGGACATAGGGGAATGAAGAAAGGAAATTGTTTAAAAAAAAAAACTCAAAACTAA
  3   1   2       bld Neu4                            IMAGE:4084128.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGGCATTGGGCAACGGCCCCGGCTTTATTTACACTTCAAGAACATCGCAAAGCAAAGCACAATCCCACAAGCCACCATCACCCTGGCCCCCCGACCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTATTCATGTTAATAATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTGGGGAAATCACTGTAGGAGGAAGAGGATGAGGAGGGCCACATTGGACATAGGGGAATGGAGAAAGGAAATTGTTAAAAAAAAACTCAG
  3   1   2       bld Gas5      in                    IMAGE:3747634.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCCACAACATTAGCAAGCATAGCACAATCCTACAAGCCACCATCACGTGGGCTCTCTGACCTGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGTTCCTCTTTGATCTCAGCTTGAACTTCACTCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTAATTCATGTTAATAATTATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGAGGGCCACATTGGACATAGGGGAATGAAGAAAGGAAATTGTTTAAAAAAAAAAACTCAAAACTAA
  5   1   2       bld Ga18                               xlk59j11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACCATCACCCTGGCCCCCCGACCCCTCCTCGCCACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGTTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGNCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATCACTGGGACCtttttttttttttGTTTGTTTGTTAATAATTAATATTATTATTCCAAATTTTTGTTGTTGCTGGGGAGACAAATGGATGGGGGGAGGGGTCCCCCAAAATTATTTAACTCCCATCAACTTCTCAGTACAGATTTAAAGGGCTGTTCTTGTATCtttttttttttATATCTATATCAACGTCCAGCCTTTGAATTTGGGCGATCNNTGTAGGATGANGAGGAGGGCCATGATGGACATAGANNNNNNttttttttttnttaaaaaccccagaaagctnnaaaaaaaaa
  5   1   2       bld Egg3                            IMAGE:6325116.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAATTCCCCGGGGCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCttttttttATTCATGTTAATAATTATTATTATTATTCCAATggggagggggaggggCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGAGGGCCACATTGGACATAGGGGAATGAAGAAAGGAAATTGTTTaaaaaaaaaactcaaaactaaaaaaaaaattggtctggaagatggtctggcagaacaaaaaaaaaaaGTCTTATTTCATGGCAGCTCAAGGGGAGGGGGTCACCtttttttattattttttAATGTTATTCTGCTGGAAACGAAAAAACAACTACAAGGAACTTGACAATTTTCTGGAAGAAGGaaaaaaaaaaCTGATTTCTTCTATGCATCTGATTCTCAATCTGCAGGGAGTTGCAAGACGCAGACACAACTGCTACACTTACACACAACTGTGAACTGATTCAAGAGTTTACTTCTTACAGGTCAAACAATGGGCAGGGTTATTCttttttttttttttttggttcccaatggtggatttttttttttaaataatttttttttttGCC
  3   1   2       bld Tbd2 5g3  in                    IMAGE:3200690.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCCCGACCCGCCCCCACGACTACCTCACCCGCCGGCAGCCACGAGCTCCTCTTCGATCTCAGCTTGAACTTCACCCAGCAGAACCCTCAGCTCCCCGACCCCAACTCAGGAAACGTCTCCCTCTCCCTGGTGGACAAGGACTTGGACTCTTGTAGCGAGGGAAGCCTGGGCTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCTTTTTTTTAATTCATGTTAATAATTATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGAGGGCCACATTGGACATAGGGGAATGAAGAAAGGAAATTGT
  3   1   2       bld DMZ       in                         xl223d13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGCCGGCAGCCACGAGCTCCTTTTNGATTTCAGNTTGAACTTCACCCAGCAGAACCCTCAGCTNCCCGACCCCAAATCAGGAAACGTCTCCCTNTCCCTGGTGGACAAGGACTTGGACTNTTGTAGCGAGGGAAGCCTGGGCTCCCACTTNGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCNGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGNGTTCTTTCTTTTTTTTAATTCATGnTAATAATTATTATTATTATTATTCCAATGGGGAGGGGGAGGGGCACAAAAATTNTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCNTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCAAAGTNGGAGGAAGAGGATGAGGAGGGCC
  5   1   2       bld Ga18      in                        xlk8i15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAAGNNNGGACTCTTGTAGCGAGGGAAGNCTNNNTCCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCttttttttATTCATGTTAATAATTATTATTATTATTCCAATggggagggggaggggCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGAGGGCCACATTGGACATAGGGGAATGAAGAAAGGAAATTGTTTaaaaaaaaaactcaaaactaaaaaaaaaattggtctggaagatggtctggcagaacaaaaaaaaaaaGTCTTATTTCATGGCAGCTCAAGGGGAGGGGGTCACCtttttttattattttttAATGTTATTCTGCTGGAAACGAAAAAACAACTACAAGGAACTTGACAATTTTCTGGAAGAAGGaaaaaaaaaaCTGATTTCTTCTATGCATCTGATTCTCAATCTNCAGGGAGTNNNAAGACNCAGACACAACTGCTACACTTACACACAACTGTGAACTGATTCAAGAGTTTACTTCTTNNAGGTCAAACAATGTGCANGNTNNTCNttttttttttttGGNC
  5   1   2       bld DMZ                                  xl239k18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCACTTCGACTTCCCCGATTACTGCACCCCCGAACTCAGCGAGATGATCGCAGGCGACTGGTTGGAAGCCAACTTTTCAGACTTGGTCTTCACTTACTGAATAACTGTGTTCTTTCttttttttattcatgttaataattattattattattattccaatggggagggggaggggCACAAAAATTCTTTGAGCTCCATCAACATCTCGGTACAGATTTAAAGGGCTGTTCTTGCATCTGTTTTTTATATATCTATCTCTCTATAAACGTCCAGCCTTTGAATTTGGGCGATCACTGTAGGAGGAAGAGGATGAGGAGGGCCACATTGGACATAGGGGAATGAAGAAAGGAAATTGTTTaaaaaaaaaactcaaaactaaaaaaaaaattggnctggaaaatggnctggcaaaacaaaaaaaaaaa
  5   1   2      4-98                               Xl3.1-xlk79k20ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAAAAAAGTCTTATTTCNTGGCAGCTCAAGGGGAGGGGGTCACCTTTTTTTATTATTTTTTTAATGTTATCTGCTGGAAACGAAAAAACAACTACAAGGAACTTGACAATTTTCTGGAAGAAGGAAAAAAAAAACTGATTTCTTCTATGCATCTGATTCTCAATCTGCAGGGAGTTGCAAGACGCAGACACAACTGCTACACTTACACACAACTGTGAACTGATTCAAGAGTTTACTTCTTACAGGTCAAACAATGTGCAGGTTATTCTTTTTTTTTTTTTGGTCACAATGTGATTTTTTTTTTATTATTTTTTTTGCCAACAACTACTTTATAATTTTATAACTGGTTCCCTTTATTATTACCTCCTTGAATCCAGACAACCCAGACCTCAGTAACAAAAAACAAAAAAGTAGAGAAAAAAAAAAGGTATTGAAACATTTTTGATACATAACAGACCTCAGTCTTTTTTTAAAAATTTAAACTATTTTCAGGCGTATTTTTGTACAGTTTAAAGAAAAGGGAACATTCCTGCTGTTTTTTTTTTTTTTATTATTGTTATGAATTTTTTTGGTTCAGNGAGACTTTCAGGCACTTCCTATCTCTTCTCTCTCTGTCTTAGCATGCAAGTATGTT------------TCCTGGTTAANGGATTAAAATTTAAAAAAAAAATGN
                                                  Xl3.1-CHK-1012709981                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGTCTTATTTCNTGGCAGCTCAAGGGGAGGGGGTCACCTTTTTTTATTATTTTTTxAxTGTTATxxxxxxGAAACGAAAAAACAACTACAAGGAACTTGACAATTTTCTGGAAGAAGGAAAAAAAAAACTGATTTCTTCTATGCATCTGATTCTCAATCTGCAGGGAGTTGCAAGACGCAGACACAACTGCTACACTTACACACAACTGTGAACTGATTCAAGAGTTTACTTCTTACAGGTCAAACAATGTGCAGGTTATTCTTTTTTTTTTTTTGGTCACAATGTGATTTTTTTTTTATTATTTTTTTTGCCAACAACTACTTTATAATTTTATAACTGGTTCCCTTTATTATTACCTCCTTGAATCCAGACAACCCAGACCTCAGTAACAAAAAACAAAAAAGTAGAGAAAAAAAAAAGGTATTGAAACATTTTTGATACATAACAGACCTCAGTCTTTTTTTAAAAATTTAAACTATTTTCAGGCGTATTTTTGTACAGTTTAAAGAAAAGGGAACATTCCTGCTGTTTTTTTTTTTTTTATTATTGTTATGAATTTTTTTGGTTCAGNGAGACTTTCAGGCACTTCCTATCTCTTCTCTCTCTGTCTTAGCATGCAAG------------GTTATGTCCTGGTTAANGGATTAAAATTTAAAAAAAAAATGNAAAAAA
  5   1   2      seed Ga18                               xlk79k20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 aaaaaaaaaGTCTTATTTCNTGGCAGCTCAAGGGGAGGGGGTCACCtttttttattattttttAATNTTATTCTGCTGGAAACGAAAAAACAACTACAAGGAACTTGACAATTTTCTGGAAGAAGGaaaaaaaaaaCTGATTTCTTCTATGCATCTGATTCTCAATCTNCAGGGAGTTGCAAGACGCAGACACAACTGCTACACTTACACACAACTGTGAACTGATTCAAGAGTTTACTTCTTACAGGTCAAACAATGTGCAGGTTATTCtttttttttttttggtcacaatgtgattttttttttattattttttttGCCAACAACTACTTTATAATTTTATANCTGGTTCCCTTTATTATTACCTCCTTGAATCCAGACAACCCAGACCTCAGTAACaaaaaacaaaaaagtagagaaaaaaaaaaGGTATTGAAACATTTTTGATACATAACAGACCTCAGTctttttttaaaaatttaaactattttcaggcgtatttttgtacagtttaaagaaaagggaacattcctgctgttttttttttttttATTATTGTTATGAATTTTTTTGGTTCAGNGAGACTTTCAGGCACTTCCTATCTCTTCTCTCTCTGTCTTAGCATGCAAGTATGTTGGTANNGTTATGTCCTGGTTAANGGATTAAAATTTaaaaaaaaaatgnaaaaaaaaaa
  5  -1   2       bld Emb4                            IMAGE:4203681.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTAATGTTATTCTGCTGGAAACGAAAAAACAACAACAAGGAACTTGACAATTTTCTGGAAGAAGGaaaaaaaaaCTGATTTCTTCTATGCATCTGATTCTCAATCTGCAGGGAGTTGCAAGACGCAGACACAACTGCTACACTTACACACAACTGTGAACTGATTCAAGAGTTTACTTCTTACAGGTCAAACAATGTGCAGGTTATTCtttttttttttttggtcacaatgtgattttttttttattattttttttGCCAACAACTACTTTATAATTTTATAACTGGTTCCCTTTATTATTACCTCCTTGAATCCAGACAACCCAGACCTCA
  5   1   1       add Ga15      ?                        XL438d05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAATCTGCAGGGAGTTGCAAGACGCAGACACAACTGCTACACTTACACACAACTGTGAACTGATTCAAGAGTTTACTTCTTACAGGTCAAACAATGTGCAGGTTATTCtttttttttttnggccncaaggggatttttttttatnatttttttNGCCANCANCNACTTTANAATTTTANANCGGGTCCCCTTTATNATTNCCCCCTNGAANCCAAACANCCCAAACCNCNGNANCaaaaancaaaaangnaaanaaaaa
  3  -1   2      skin Ga18      in                        xlk8i15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CNACTTTATAATTTTATAACTGGTTCCCTTTATTATTACCTCCTTGAATCCAGACAACCCAGACCTCAGTAACAAAAAACAAAAAAGTAGAGAAAAAAAAAAGGTATTGAAACATTTTTGATACATAACAGACCTCAGTCTTTTTTTAAAAATTTAAACTATTTTCAGGCGnATTTTTGTACAGTTTAAAGAAAAGGGAACATTCCTGCTGTTTTTTTTTTTTTATTATTGNTANNAATTTTTTTGGTTCAGNGNGNNTTTCAGGCACTTCCNATCTCTNCNCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)