Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl244i24.5.5                         43 END     1           1        2                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl244i24.5.5                         43 PI      89         77      757                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:8539202.5                       5 PI      78        414      672                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012837311 Xl3.1-IMAGE:6949234.5 - 96 ESTs
                                                                       ...0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6949234.5    GTATCTGTTTAAGCACAGACGCCATTAAACAAAAGGTTCCGGAGAGGGTCGAGAGCTTGAAGAGCGTGTAGTAGAGCAGGGCAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCGGCTTTGGCCCTACTCACTTCTTTGCCAATGGGATTATTGCAAGCACCTCTGCCCATCAGCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCAAGGAGGACAAGAATGGCCATGACGGGGACCCGCGGCCTGATGATGATGGTGACAAGTCTGATTAAGCAAAGAGTTGGGGGCGGATAAAGGTGCAGCGTAGCAGTGACCTTAGCACCGAATAAGAGAGGTGCAACAATGTGCATTATCCAGACATGCTGTTGAGGAAACTGGTTTGAGAATGCAGAGTACCGGCAGCCAATGGGTTAATGCACATTAGTTTGAACACATGTAAATGCATACGTATTATAAATGGAGTTAACTAAAAACCTTATTGTAAATTAATTGGTTATTTGTAACAGAAAAAGCACAAGCCACTCTGATTTTGATTAATTTTTTTGCCCTCCAATATTAGTGACCATACACTACATTAAATTGTAGCAGCTTCCTGACGCACCTCGACAATTGGCAAGTGTGTAAATCATTAGCTGAACTTACTCAGCAGTGATAAGGCTGTTGGAAAGAGGGGATGTTATCTCCCCAAAGTATCTCTGTTTGCATTTTTCCTTCAAGCTGAAACATATAGGGCTCACAAGGCACCAACTCATTTTAAAGACTGCTTTATGGCTTAAAAGCAAGGCCTGGTAACCCTTTGGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATCCTCTGAATTTTCTCAAACATATCAGCATTGCACTTGGGGTTGCCACCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATATATAGGAAGGCCGGTATTTTTTTTTCAGAAAAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAATTGTATTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGTGAACGTGCCTTTTACAATAAATTGTTACAATGCCTGCTCAA
                                                  Xl3.1-CHK-1012721720          GTTTAAGCACAGACGCCATTAAACAAAAGGTTCCGGAGAGGGTCGAGAGCTTGAAGAGCGTGTAGTAGAGCAGGGCAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAACTxCxxxxGGCTTTxxxxCxACTCACTTCTTTGCCAATxxxxxxATTGCAAxCAxCTCTGCCCATCAGxxxxxxAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCAAGGAGGACAAGAATGGCCATGACGGGGACCCGCGGCCTGATGATGATGGTGACAAGTCTGATTAAGCAAAGAGTTGGGGGCGGATAAAGGTGCAGCGTAGCAGTGACCTTAGCACCGAATAAGAGAGGTGCAACAATGTGCATTATCCAGACATGCTGTTGAGGAAACTGGTTTGAGAATGCAGAGTACCGGCAGCCAATGGGTTAATGCACATTAGTTTGAACACATGTAAATGCATACGTATTATAAATGGAGTTAACTAAAAACCTTATTGTAAATTAATTGGTTATTTGTAACAGAAAAAGCACAAGCCACTCTGATTTTGATTAATTTTTTTGCCCTCxxAxxTTAGTGACCATACACTACATTAAATTGTAGCAGCTTCCTGACGCACCTCGACAATTGGCAAGTGTGTAAATCATTAGCTGAACTTACTCAGCAGTGATAAGGCTGTTGGAAAGAGGGGATGTTATCTCCCCAAAGTATCTCTGTTTGCATTTTTCCTTCAAGCTGAAACATATAGGGCTCACAAGGCACCAACTCATTTTAAAGACTGCTTTATGGCTTAAAAGCAAGGCCTGGTAACCCTTTGGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATCCTCTGAATTTTCTCAAACATATCAGCATTGCACTTGGGGTTGCCACCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATATATAGGAAGGCCGGTATTTTTTTTTCAGAAAAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAATTGTATTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGTGAACGTGCCTTTTACAATAAATTGTTACAATGCCTGCTCAAAAAAAA
                                                      consensus depths         2     2     2     2     2     2     3     3     7     8     9    11     9    12    13    15    16    19    19    21    19    22    25    28    29    34    30    35    31    36    32    37    36    40    36    40    36    40    36    41    36    41    36    41    36    41    36    41    34    41    35    40    35    40    33    39    37    39    37    39    36    38    36    38    38    39    38    39    38    39    38    39    38    39    38    39    38    39    38    39    38    39    37    38    36    38    37    38    37    38    37    38    39    40    40    42    40    42    42    43    38    41    38    41    37    38    37    38    35    36    34    37    35    37    32    36    28    37    31    37    30    36    14    36    15    36    13    35    12    36    12    36    12    36    11    31    11    31    11    31    11    28    12    28    12    24    11    21    11    21    12    18    12    18    11    14    12    14    12    14    10    14    10    14    10    15    10    13    10    13    10    14    10    14     9    13    10    12    10    13     9    12     9    12     8    12     7    12     7    12     6    12     6    14     6    15     7    16     7    17     7    18     7    18     6    18     6    18     6    17     6    17     9    17     9    17     9    18     9    18     9    17     9    17     9    17     9    17     9    17     9    17     9    17     8    17     8    17     9    17     9    17    10    18    10    17    10    17    11    17    11    17    11    17    11    17    11    18    11    20    12    20    12    22     9    22    10    23    12    23    12    23    12    22    10    23    12    25    15    27    13    28    17    28    13    29    16    31    21    30    24    31    24    30    25    30    25    30    24    31    27    32    28    33    28    32    28    32    27    32    29    32    29    32    28    32    28    32    30    33    29    33    31    34    32    34    32    34    32    33    32    33    32    33    31    33    30    31    30    31    30    31    29    30    31    32    31    32    31    32    31    32    31    32    30    32    30    32    29    32    29    31    26    31    21    30    18    28    11    16    10    14     7    11     4     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAGCAGCTTCAGGTGCATCAACTCTCCCAACTTCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGGCCCTTCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCACTCACTTCTTTGCCAATGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAAGCACCATC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCTCTGCCCAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATTAGTTTGAACACATGTAAATGCATACGTATTATAAATGGAGTAAACTAAAAACCTTATTGTAAATTAATTGGTTATTTGTAACAGAAAAAGCACAAGCCACTCTGATTTTGATTAATTTTTTTGCCCTCCAATATTCGTACATTAGTTCAGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCGTACATTAGTTCAGTTTAGTGACCATACAGCTTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----G------
                                               BLH ATG     355     907    
                                               BLH MIN     301     101    
                                               BLH OVR     355    1100    
                                               EST CLI      70       4    
                                               ORF LNG     355      30    
  5   1   2       bld Ov1       in                    IMAGE:5047833.5p TGTGTATCTGTTTAAGCACAGACGCCATTAAACAAAAGGTTCCGGAGAGGGTCGAGAGCTTGAAGAGCGTGTAGTAGAGCAGGGCAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACT
  5   1   2       bld Ov1  5g                         IMAGE:6318317.5p    GTATCTGTTTAAGCACAGACGCCATTAAACAAAAGGTTCCGGAGAGGGTCGAGAGCTTGAAGAGCGTGTAGTAGAGCAGGGCAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGGCCNTTCCACTCACTTNCTTTGCCAATGGGGATTGCAAGGCACCCATTCTCTGCCCAATCAGTGGCAAGGCAAGCGGGCCTTTTCTCTCCCCTGTTCAGGCAC
  5   1   2       bld Emb1 5g                         IMAGE:6866415.5p                                 CAAAAGGTTCCGGAGAGGGTCGAGAGCTTGAAGAGCGTGTAGTAGAGCAGGGCAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAAAGGAGCAAAGCAAGTGACTGCTCCAGAGTTGGAATTCCATCATCCGTCAACAGCTTCNAGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCTCATGCAGCACGGCTTCTTCCTGTCACCTAGCTCTCGGTCATCTCCAGAGACAA
  5   1   2       bld Emb1 5g3  in                    IMAGE:3402678.5p                                           CACGCGTCCGCGAGAGCTTGAAGAGCGTGTAGTAGAGCAGGGCAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAA
  5   1   2       bld Ga15      in                       XL468b12ex.5p                                            GAGAGGGTCGAGAGCTTGAAGAGCGTGTAGTAGAGCAGGGCAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACACGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGANAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAANCGCAGANGGAGCCTGGACTTGGATCNTGAGCCTGTGCGTAGC
  5   1   2       bld Emb9 5g                         IMAGE:7977149.5p                                            GGAGAGGGTCGAGAGCTTGAAGAGCGTGTAGTAGAGCAGGGCAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCC
  5   1   2       bld Ga15 5g3  in                       XL462i24ex.5p                                                AGGGTCGAGAGCTTGAAGAGCGTGTAGTAGAGCAGGGCAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATANTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTC
  5   1   2       chi Sp1                             IMAGE:5511221.5p                                                    TCGAGAGCTTGAAGAGCGTGTAGTAGAGCAGGGCAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGACAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTGTACGTGAGAACACTTTTGGGATGCAGTATTCATATACATATACAGTGGAGAGCAGGTGGGGAAGAGGGGGGAAAGTGAANGAGACAGATTCAATATCATAGGCAACCATACTCCCAGGTCACTGCCAAAG
  5   1   2       bld Ga18      in                      xlk125a07ex.5p                                                      TCGAGAGCTTGAAGAGCGTGTAGTAGAGCAGNNNGGNCTNAGNNTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGNNGNCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGNACAATATCACAGTCTAAAACTGGAGTGTGATAAGNNNNCGGNGAGAAATCTGAGATGNAACGTCACTATNTCATGTACTATGAGANGTCATATGGACTGAACATTGAAATGCNNNAACNGGCTGAAATAGNAAAACGGNNNNNTGGNANNNG
  5   1   2       bld Em10 5g                         IMAGE:7980193.5p                                                        GAGCTTGAAGAGCGTGTAGTAGAGCAGGGTAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCATCATCCGTCAGCTCAGGTGCATCACTCTCCCACTTCAGGCTTGGCCCTTCACTCACTTCTTGCAATTGGATGCAGCACATCTTGCCATCATGCAACAGCGCCTCTCTCCTGTACCTAGCTCCAGGTCATCTCCAGAGA
  5   1   2       bld Emb1 5g                         IMAGE:6863882.5p                                                          GCTTGAAGAGCGTGTAGTAGAGCAGGGCAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCCAACTTCAGGCTTTGGCCCTTTCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCCAGGAAGGACAAGAATTGGCCATGAACGGGGACCCGCGGCCC
  5   1   2       bld Neu7 5g3  in                         XL005n13.5p                                                                          CGAGGGCAGGGCAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGNCTAAAACTGGAGTG
  5   1   2       bld Eye1 5g3  in                    IMAGE:4743324.5p                                                                             GAGCAGGGCAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCCGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAAATATAAAACCGTTACATGGAATA
  5   1   2       bld Emb1 5g3  in                    IMAGE:3402853.5p                                                                                 AGGGCAGGCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAA
  5   1   2       bld Ga12 5g                              XL161m10.5p                                                                                        GCCTTAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCANAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACA
  5   1   2       bld Neu4 5g3  in                    IMAGE:4085493.5p                                                                                            TAGCCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGA
  5   1   2       bld Eye1 5x3                        IMAGE:6949234.5p                                                                                              AATTCCCGGGGATGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCCAAGGAGGACAAGAATGGCCATGACGGGGAACCGCGGGCCTGATGATGATGGGTGACCAGTCTGATTAAGCAAAAGAGTTGGGGGGCGGATAAAGGTGGCAGCGGTACCAGTG
  5   1   2       bld Ooc3 5g3  in                    IMAGE:3437405.5p                                                                                               CCTTAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCANAGCAAGGTGATGTTTCAGAGTTGAATTCCATCATCCGTCAGCTTTAGGTGCATCAACTCTCCCAACTTCAGGGCTTTGGCCCTTCCACTCACTTCTTTCCAATTGGATTGCAG
  5   1   2       bld Ga18 5g                           xlk166p01ex.5p                                                                                                   TNAGGGGTGGGGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCNNNGNCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGNACAATATCACAGTCTAAAACTGGAGTGTGATAAGNTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAANATGTGCACAGGTGTTGNCTTATCTCTCACAGGAGCNCCAGCAGCAAGNCCTGGGAGCGATTGAACGAGCAAANNAAGTGACTGCTCCAGNNTTGAANTCCATCATCCGTCAGCAGNTTCAGGTNCATCAACTCTNCCAANTTCAGGCTTTGGCCCNTCCACTCNNTTCTTTNCCNATGGGNTT
  5   1   2       chi Ga15      in                       XL417c06ex.5p                                                                                                           GGGAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCANAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTGTACGTGAGAACACTTTTGGGATGCAGTATTCATATACATATACAGTGGAGAGCAGGTTGGGGAGGTGGGGAA
  5   1   2       bld Brn2                             Brn2-za52h06.5p                                                                                                             GAGCATTACCGGGTTAGAGATCAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCACAGGGAGCCTGGACTTG
  5   1   2       bld Ga18 5g3  in                       xlk67e19ex.5p                                                                                                                     ATTACCGGTTAGAGATCAAGAAAGGACGAGGCCAANNNACAGGAGAGGNCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGNNGNCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGNACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCNAANNAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCAGCTTCAGGTGCATCAACTCTCCCNACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCNATGGGNTT
  5   1   2       bld Ga15 5g3  in                       XL466k11ex.5p                                                                                                                                  CAAGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCAGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCCAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTT
  5   1   2       bld Lmb1 5g                         IMAGE:8534371.5p                                                                                                                                    AGAAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTNCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCAAGGAGGGACAGAATGGCATGACGGGA
  5   1   2      seed Ga15 5g3  in                       XL506b21ex.5p                                                                                                                                      AAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGG
  5   1   2       bld Em10 5g                         IMAGE:8322316.5p                                                                                                                                      GAAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCA
  5   1   2       bld DMZ  5g3  in                         xl293n20.5p                                                                                                                                       AAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTC
  5   1   2       bld DMZ  5g3  in                         xl256n02.5p                                                                                                                                       AAGGACGAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGG
  5   1   2       chi Ov1                             IMAGE:6315933.5p                                                                                                                                           TCCAGGCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGGACTGCTCCAGAGTTTGAATTCCATCCTCCGTCAGCTTTCAGGTGCAATCAAACTTCTCCCCAACTTTCAGGGCTTTTGGGCCCCTCCACCTTCACtttttttttGGCCAAATGGGGGAATTTGGCCAAGGGAACCCCATTTCTTCTGGGCCCCCATTTCAAGGTGGCCAAAAGGCCAAggggggggCCCCTTTTCCTTCCC
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959240.5p                                                                                                                                               gacgcgtgggtcgacccacgcgtccgcccacgcgtccgcccacgcgtccgAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGCTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATT
  5   1   2       bld FaB  5g                         IMAGE:8070432.5p                                                                                                                                                GCCAAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAAGCAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAAGTGCATCAACTCTCCCAACTTCAGGCTTGGCCCTTCACTCACTTCTTTGCCATGGGATGCAAGCACATCTTTGCCATCAGTGCAAGCAGCGGCCTTTTTCCCGTCAGC
  5   1   2       bld FaB  5g                         IMAGE:8073978.5p                                                                                                                                                 GCCAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTACAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCAGCTTCAGGTGCATCAACTCTCGAAGCTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCATCAGTGCTAGCAGCGGCCTTCTCTCCCTGTCACACTAGGCTCTCAGGTCATCTTCCAAGGAGACAGAATGCCATGACGGGAC
  5   1   2       bld Ooc3 5g                         IMAGE:3472570.5p                                                                                                                                                   AAAGGTACAGGAGAGGCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATA
  5   1   2       bld Ga18 5g3  in                      xlk146a08ex.5p                                                                                                                                                    CAAAGGTACAGGAGAGGNCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCNNNGNCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGNGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAANNAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGNTTTGNNCCTTCCACTCACTTCTTTGCCAATGGGANTNCAANCACCATCTCTGCCCATCAGTGCAAGCAGCNNNCTTCTCTCCCTGTCAGCACTAGNNTCTCAGGGNCATCTTCCCAAGGAGGANANAATGGCCATGACGGGGNNCCNNNGCCTGNNGA
  5   1   2       bld Ga18      in                       xlk61h12ex.5p                                                                                                                                                               GAGAGGNCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCNNNGNCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGNCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGNTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGNCTTATCTCTCACAGGAGCAGCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTNCAAGCACCNTCTCTGCCCATCAGT
  5   1   2       bld DMZ  5g3  in                         xl298e20.5p                                                                                                                                                                        GTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGG
  5   1   2       bld Kid  5g                         IMAGE:7012459.5p                                                                                                                                                                                CACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTTCCAAGGAGGACCAGAATGGCCATGACGGGAACCCGCGCCTGATGATGATGG
  5   1   2       bld Kid  5g                         IMAGE:7010649.5p                                                                                                                                                                                            ACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCAAGGAGGACAAGAATGGCCATGACGGGGACCCGCGGCCTGATGA
  5   1   2       bld Eye1 5g3  in                    IMAGE:4743539.5p                                                                                                                                                                                              ATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAACAAGTGACTGCTCCAGAGTTGAATTCC
  5   1   2       bld Neu7 5g3  in                         XL048l17.5p                                                                                                                                                                                                CAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGG
  5   1   2       bld Em10 5g                         IMAGE:7980016.5p                                                                                                                                                                                                 AACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGTGCGTAGCGCCATACACCGGGGCCTGGGTTGGATATGATGTTTCCTCAAAGCAGCAGCCGGCACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCAATGGGATTGCAAGCACATCTCTGCCATCAGTGCAGCAGCGGCTTCTCTCCTGTCAGCACTGGCTCTCAGGTCATCTTCCCAGAGACAGATGGCATGACGGGACCGCGCCTGATATATGTGACATCGATAGCAGAGTGGGGCGATANGGCGCTACATGACTACACGAATAAAGGCACAGTGCTTCAACTCTGTAGAACTGTAATGCAACG
  5   1   2       chi Em10                            IMAGE:7980017.5p                                                                                                                                                                                                                                      GCCCTGGTTGACAGCACACGGCCAGAACATCAACTGGGATTGCAGATCACATATCCGGGCCTAGAGCAGTGGAGCCGATTGAGAAGCACAGGGAAGCCTTTCCTAAAGTACACTGAGCCCTGGATAAAGCGCAGAGGGAGCCTGGACTTGGATCGTGAGCCTGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCAGGAGGACAAGATGGCATGACNGGGACCGCGGCTGATGATGAGGTGACAGTCTGATTAGCGAGAGTGGGGGCGATAAGTGCACGTACATGACTTACACGATAGAGAGTCACATGGCATATCAACTGCGTGAGACTGTTGAATCAATACGCGCATGGTATGCCTATGACAGTATGA
  5   1   2       bld Ga12      in                         XL186k15.5p                                                                                                                                                                                                                                                                                                                                                                                                  GACTCGGGCTCGTCACATATGCCCCAGCAACTCAAATTCACAACCTCAGATTCATGTGATAGAATTAAGGATGAATTCCAACTGCTGCAGGCACAATATCACAGTCTAAAACTGGAGTGTGATAAGTTGGCCGGTGAGAAATCTGAGATGCAACGTCACTATGTCATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCAAGGAGGACAAGAATGGCCATGACGGGGACCCGCGGCCTGATGATGATGGTGACAAGTCTGATTAAGCAAAGAGTTGGGGGCGGATAAAGGTGCAGCGTAGCAGTGACCTTAGCACCGAATAAGAGAGGTGCAACAATGTGCATTATCCAGACATGCTGTTG
  5   1   2       bld Tad1                            IMAGE:6940069.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGAGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCAAGGAGGACAAGAATGGCCATGACGGGGACCCGCGGCCTGATGATGATGGTGACAAGTCTGATTAAGCAAAGAGTTGGGGGCGGATAAAGGTGCAGCGTAGCAGTGACCTTAGCACCGAATAAGAGAGGTGCAACAATGTGCATTATCCAGACATGCTGTTGAGGAAACTGGTTTGAGAATGCAGAGTACCGGCAGCCAATGGGTTAATGCACATTAGTTTGAACACATGTAAATGCATACGTATTATAAATGGAGTTAACTAAAAACCTTATTGTAAATTAAATTGGTTATTTGTAACCAGAAAAAGCACCAGCCCACTCCTGATTTTGGATTAAtttttttttGCCTTCCAATAATTCGTACCTTTAGTTTCAGTTTTAGTGAACCATACAGCCTTCCTGAAGCCACCTTCGACCAATTGGGCCAGTTGTGGTAAAATCCATTAAGCTGA
  5   1   2       bld Tad2      in                    IMAGE:6872319.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATGTACTATGAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCAAGGAGGACAAGAATGGCCATGACGGGGACCCGCGGCCTGATGATGATGGTGACAAGTCTGATTAAGCAAAGAGTTGGGGGCGGATAAAGGTGCAGCGTAGCAGTGACCTTAGCACCGAATAAGAGAGGTGCAACAATGTGCATTATCCAGACATGCTGTTGAGGAAACTGGTTTGAGAATGCAGAGTACCGGCAGCCAATGGGTTAATGCACATTAGTTTGAACACATGTAAATGCATACGTATTATAAATGGAGTTAACTAAAAACCTTATTGTAAATTAATTGGTTATTTGTAACAGAAAAAGCACAAGCCACTCTGATTTTGATTAAttttttttGCCCTCAAATATTCCGTACATTTAGNTTCAGTTTTAGTGACCATACAAGCTTTCCTGGACGCACCCTCCGACAATTTGGNCAAGTTGGTGTAAAATTCT
  5   1   2       bld Em10                            IMAGE:8321178.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGATGTCATATGGACTGAACATTGAAATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCAAGGAGGACAAGAATGGCCATGACGGGGACCCGCGGCCTGATGATGATGGTGACAAGTCTGATTAAGCAAAGAGTTGGGGGCGGATAAAGGTGCAGCGTAGCAGTGACCTTAGCACCGAATAAGAGAGGTGCAACAATGTGCATTATCCAGACATGCTGTTGAGGAAACTGGTTTGAGAATGCAGAGTACCGGCAGCCAATGGGTTAATGCACATTAGTTTGAACACATGTAAATGCATACGTATTATAAATGGAGTAAACTAAAAACCTTATTGTAAATTAATTGGTTATTTGTAACAGAAAAAGCACAAGCCACTCTGATTTTGATTAATTTTTTTGCCCTCCAATATTCGTACATTAGTTC
  5   1   2       bld Kid                             IMAGE:4031013.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGCAAACGCGACCACGCGTCCGAATTCTCAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCAAGGAGGACAAGAATGGCCATGACGGGGACCCGCGGCCTGATGATGATGGTGACAAGTCTGATTAAGCAAAGAGTTGGGGGCGGATAAAGGTGCAGCGTAGCAGTGACCTTAGCACCGAATAAGAGAGGTGCAACAATGTGCATTATCCAGACATGCTGTTGAGGAAACTGGTTTGAGAATGCAGAGTACCGGCAGCCAATGGGTTAATGCACATTAGTTTGAACACATGTAAATGCATACGTATTATAAATGGAGTTAACTAAAAACCTTATTGAAAATTAAATGGTTATTTGTAACAGAAAAAACACAAGCCACTCTGATTTTGATTAATTTTTTTGCCCTCCAATATTCGGACATTAATTCAGTTTAGGGACCATACAGGGTTCCCGGACGCCACCCTCCAAAAATTGGCAAATTGGTGGAAAACCTTTAAGCTGGAACTTACCTCCCCCGGGGATAAAAGGCTGTCTGGGAAAAAAAGGGGATAGGTAATCTCCCCCCAAAGGATCCCCCGGTTTGGCATTTTCTTCCCTTCCAGGGCGTAAACACATATTAGGGGGCTTATCCAGAGGGGCAGCCC
  5   1   2       bld Kid                    IMAGE:4031013-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATGCACAAACAGGCTGAAATAGTAAAACGGTTACATGGAATATGTGCACAGGTGTTGCCTTATCTCTCACAGGAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCAAGGAGGACAAGAATGGCCATGACGGGGACCCGCGGCCTGATGATGATGGTGACAAGTCTGATTAAGCAAAGAGTTGGGGGCGGATAAAGGTGCAGCGTAGCAGTGACCTTAGCACCGAATAAGAGAGGTGCAACAATGTGCATTATCCAGACATGCTGTTGAGGAAACTGGTTTGAGAATGCAGAGTACCGGCAGCCAATGGGTTAATGCACATTAGTTTGAACACATGTAAATGCATACGTATTATAAATGGAGTTAACTAAAAACCTTATTGTAAATTAATTGGTTATTTGTAACAGAAAAAGCACAAGCCACTCTGATTTTGATTAATTTTTTTGCCCTCCAATATTCGTACATTAGTTCAGTTTAGTGACCATACAGCTTCCTGACGCACCTCGACAATTGGCAAGTGTGTAAATCATTAGCTGAACTTACTCAGCAGTGATAAGGCTGTTGGAAAGAGGGGATGTTATCTCCCCAAAGTATCTCTGTTTGCATTTTTCCTTCAAGCTGAAACATATAGGGGCTCACAAGGCACCAACTCATTTTAAAGACTGCTTTATGGGCTTAAAAGCAAGGGCCTGTAACCCTTTGGGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATA
  5   1   2       bld Tbd7      in                         XL058o03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTACATGGNATATGTGCACAGGTGTTGCCTTATCTCTCACAGGNAGCACCAGCAGCAAGTCCTGGGAGCGATTGAACGAGCAAAGCAAGTGACTGCTCCAGAGTTGAATTCCATCATCCGTCAGCAGCTTCAGGTGCATCAACTCTCCCAACTTCAGGCTTTGGCCCTTCCACTCACTTCTTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCAAGGAGGACAAGAATGGCCATGACGGGGACCCGCGGCCTGATGATGATGGTGACAAGTCTGATTAAGCAAAGAGTTGGGGGCGGATAAAGGTGCAGCGTAGCAGTGACCTTAGCACCGAATAAGAGAGGTGCAACAATGTGCATTATCCAGACATGCTGTTGAGGAAACTGGTTTGAGAATGCAGAGTACCGGCAGC
  5   1   2       bld Ga18      out                     xlk115k01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGAGCACCAGCAACAAGTCCTGGGAGCAATTGAAAGAGCAANNAAGTGACTGCTCCGGAGCTAAACTCCATCATCCGTCAGCTTCAGGTGCATCAACTCTCCCAGCTTCAGGCTTTGGNCTCCCGCTCACTCCTTTGCCAGTGGGATTGCAAGCTCCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTATCAGCACTAGGCTCTCAGGGCCATCTTCCCAAGGAAGACAAGAATGGCCATGACGGGGACCCGCGGCCTGATGACGATGGTGACAAGTCTGATTAAGCAAAGAGTCGGGGCGGATAAAGGTGCAGCGNNNNNTGACCTTAGCACTGAATAAGAGAGGGGCAACAACGTGCATTATCCAGACATGCAATTGAGGAAACTACGGNTTCAGAATGCAGGGTACCGTCAGCCAATGGGTTAATGCACATTTGTTTGATCACACATGTAAATGCATACGTATTATATATGGAGTAAACTGAAAACCTTATTGTAAATTNNNTATTTGTAACAGAAAAAGCACAAGCCACTCTGATTTTGAATAAATTTCTGCCCTCCAATATGAATGCATTAGNTTAGNTACCATACACTTCATTAAATTGTAGAAGCTCACCTTGACAATTGCCAAGCTTCCCAAAAAACCTGCGTAAATCATCACTTACTCAGCAGNGATAGNNTTTGGNAAGNNGGGGNATGGNTTANNT
  5   1   2       bld Eye1                            IMAGE:6946984.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGATATCCTGAGTTGATTCTCCCTCATATGCAAGGGCCAATCGTATCCAGCAGGACTGGAGCCGAGTCCGAGAATTTCCAGAAATCTTGCACTCACTTCTTTGCTTTTCCGATTGCAAGCACCATCATCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCAAGGAGGACAAGAATGGCCATGACGGGGACCCGCGGCCTGATGATGATGGTGACAAGTCTGATTAAGCAAAGAGTTGGGGGCTGATAAAGGTGCAGCGTAGCAGTGACCTTAGCACCGAATAAGAGAGGTGCAACAATGTGCATTATCCAGACATGCTGTTGAGGAAACTGGTTTGAGAATGCAGAGTACCGGCAGCCAATGGGTTAATGCACATTAGTTTGAACACATGTAAATGCATACGTATTATAAATGGAGTAAACTACAAACATTATTGTAAATTAATTGGCTATCTGTAACAGAAAAAGCACAAGCCCCTCTGATTTTGATTAATTTTTTTGCCCTCCAATATTCGTACGATTATTTCCAGTTTAGTGGACCCCTACTCTACATTAAATCTGTAGACAGCCTCTCCTAGACTGCACCCTCCGACATAATTTGGCCAAAGCTGTGGTCAACATTCCACTCTATACCTGTATACTCTTACCTGCACGTCCAGTTGAAACCACACGGCCATAGTTTCCGGCAAACAATAACGGGGGGTAAATGGTTTTTATTCCATAccccccccAAAACACAACAACTCCCCTCTCCATCGCAATACTTTAGGACCACCCTTATTTATATCTTCGCCCAATACTACCCAAGAGGTACTATTTTCCACCCAACCACTCATTCTATCTTTATCGCGCTGGGACCTTTCAAACTATTAAAAGAGGCTTCACGCGCTCAACACACTTTCCATAACTTTATTTTTCCAAATATAAGAATACTGCGGCCTCCttttttttACAGTGGACGCGCCTTTCCAACTAGACGCACCAAAAGATGACCCCCCCTTGGATAATGAAAAACCCACCCCANATATTGGGGCGCCAGTGCCCCCACTATCTTCCGCCCCGCCCATGAACTATAATCTACACGCCCCTGTGCGCCTCTTATTAAATAGTGGGGCGCTCCACTCGAGGCAACGCACGCCTTACAGAAACACACCCTCCGTGGGCGCAGCTAGTTAGAATTCCCCTCTATTAAGAAAATTCTATATCGCCACCATAATACCACATCGCTACACAACTCATTACTGCCCCTC
  5   1   2       bld Brn1                            IMAGE:6954769.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGAAAATCAGGCTTTGGCCCTTCCTTCACTTCCTTGCCAATGGGATTGCAAGCACCATCTCTGCCCATCAGTGCAAGCAGCGGCCTTCTCTCCCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCAAGGAGGACAAGAATGGCCATGACGGGGACCCGCGGCCTGATGATGATGGTGACAAGTCTGATTAAGCAAAGAGTTGGGGGCGGATAAAGGTGCAGCGTAGCAGTGACCTTAGCACCGAATAAGAGAGGTGCAACAATGTGCATTATCCAGACATGCTGTTGAGGAAACTGGTTTGAGAATGCAGAGTACCGGCAGCCAATGGGTTAATGCACATTAGCTTTGAACACATCGTAAATGCACTACGTATTATAAATGCGAGTTGACTACCAAACACTTAATGGAAATCAAATTGGTGTATTTTGTAATCCTAGAAAAACACACAGCCCACTTCTGAATTTTGAATTAAATTGTTTTTTGCCCCTCCCACAATTTCCGTACAATAAAGTTACCAATTACCACCGCACCAATTACATACTTCCCTGGACCCCAACCCTCGAACCATATGGGCCAACCTGCTGTCAAATTCCTTTACTCTTGACACTTCTTCTCCGCCCAGTTGACAAAACGGCCTCGTTTGGAACAAGGAGGGGGAAATGTTTTATCCATTACCCCCCACAGTCTCCCCTCTTCATCCTACGAAATTGTTTTTCGTATTATCAAAGTCCTGAAACAGCCTATAATGGCCGGCCTTCCCATCACTGGGACTCCCAAAAACCATCACGTCTTTGAAAACACACTGGGTTATTAAAGAGGAATTTTCGAAACAGTTTAGGGGCCCCTGCGCTGACGATCCGCGTGTTTAACAAACGCCGCCAGTTTCACCCCTAAACGCACAAAACGCCTGCTTGAAACTCTGACTATCGGTCTACCACCATTCCATAACTCTCACCAGAAATGACACACTATGAGATGATGGTAAACAACTACTGCTGTGAAATACTCTACGTCCCCTATACAACCACATCAATACAAGAGACGGTTCGCGCGCTATATCATCGCGCGCGAG
  3   1   2       bld Ga15 5g3  in                       XL466k11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTGTCAGCACTAGGCTCTCAGGGTCATCTTCCCAAGGAGGACAAGAATGGCCATGACGGGGACCCGCGGCCTGATGATGATGGTGACAAGTCTGATTAAGCAAAGAGTTGGGGGCGGATAAAGGTGCAGCGTAGCAGTGACCTTAGCACCGAATAAGAGAGGTGCAACAATGTGCATTATCCAGACATGCTGTTGAGGAAACTGGTTTGAGAATGCAGAGTACCGGCAGCCAATGGGTTAATGCACATTAGTTTGAACACATGTAAATGCATACGTATTATAAATGGAGTTAACTAAAAACCTTATTGTAAATTAATTGGTTATTTGTAACAGAAAAAGCACAAGCCACTCTGATTTTGATTAATTTTTTTGCCCTCCAATATTCGTACATTAGTTCAGTTTAGTGACCATACAGCTTCCTGACGCACCTCGACAATTGGCAAGTGTGTAAATCATTAGCTGAACTTACTCAGCAGTGATAAGGCTGTTGGAAAGAGGGGATGTTATCTCCCCAAAGTATCTCTGTTTGCATTTTTCCTTCAAGCTGAAACATATAGGGCTCACAAGGCACCAACTCATTTTAAAGACTGCTTTATGGCTTAAAAGCAAGGCCTGGTAACCCTTTGGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATCCTCTGAATTTTCTCAAACATATCAGCATTGCACTTGGGGTTGCCA
  5   1   2       bld Emb1                            IMAGE:6631236.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACCTTAGCACCGAATAAGAGAGGTGCAACAATGTGCATTATCCAGACATGCTGTTGAGGAAACTGGTTTGAGAATGCAGAGTACCGGCAGCCAATGGGTTAATGCACATTAGTTTGAACACATGTAAATGCATACGTATTATAAATGGAGTAAACTAAAAACCTTATTGTAAATTAATTGGTTATTTGTAACAGAAAAAGCACAAGCCACTCTGATTTTGATTAATTTTTTTGCCCTCCAATATTCGTACATTAGTTCAGTTTAGTGACCATACACTACATTAAATTGTAGCAGCTTCCTGACGCACCTCGACAATTGGCAAGTGTGTAAATCATTAGCTGAACTTACTCAGCAGTGATAAGGCTGTTGGAAAGAGGGGATGTTATCTCCCCAAAGTATCTCTGTTTGCATTTTTCCTTCAAGCTGAAACATATAGGGCTCACAAGGCACCAACTCATTTTAAAGACTGCTTTATGGCTTAAAAGCAAGGCCTGGTAACCCTTTGGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATCCTCTGAATTTTCTCAAACATATCAGCATTGCACTTGGGGTTGCCACCTGGCCGGTAAAAGTGATGGTTGATCCAGATGTTGTTAATAGGCAAAAAAGGATAAATATATAGGAAGGCCGGTAtttttttttCAGAAAAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAATTGNAttttttttttttttAATTAAACTCTGGCTCTCTACCCCCCCTGTGACATGGAAATAGATTACTATCAGCCAGTCCCCTGCTTTTGCTA
  5   1   2       bld Emb1                            IMAGE:6865100.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGTTAATGCACATTAGTTTGAACACATGTAAATGCATACGTATTATAAATGGAGTAAACTAAAAACCTTATTGTAAATTAATTGGTTATTTGTAACAGAAAAAGCACAAGCCACTCTGATTTTGATTAATTTTTTTGCCCTCCAATATTCGTACATTAGTTCAGTTTAGTGACCATACACTACATTAAATTGTAGCAGCTTCCTGACGCACCTCGACAATTGGCAAGTGTGTAAATCATTAGCTGAACTTACTCAGCAGTGATAAGGCTGTTGGAAAGAGGGGATGTTATCTCCCCAAAGTATCTCTGTTTGCATTTTTCCTTCAAGCTGAAACATATAGGGCTCACAAGGCACCAACTCATTTTAAAGACTGCTTTATGGCTTAAAAGCAAGGCCTGGTAACCCTTTGGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATCCTCTGAATTTTCTCAAACATATCAGCATTGCACTTGGGGTTGCCACCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATATATAGGGAAGGCCGGGTAttttttttttCAGAAAAGGTGGCAACCCCTAACCTGCCACTAGATTTTTTCACCATTAAATTGTATTCtttttttttttaattaagacctctggctctcntaccccccccTGGTGAACATGGGAATAAGATTTACTAATCAGCCCAGGTCCCTTGCCTTTTGGCTAAAAATCTTTTTCATTCCCTGCTTATTTTTTGGGGGGAGAGGGGGAAAAAAATGTTAAAATTCATTTCCCGCAAAACCTGGAAGTTTAAATCCATTTAACCCCGGCCACAGGGGGAATT
  3   1   2       bld Neu4 5g3  in                    IMAGE:4085493.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGCCAATGGGTTAATGCACATTAGTTTGAACACATGTAAATGCATACGTATTATAAATGGAGTAAACTAAAAACCTTATTGTAAATTAATTGGTTATTTGTAACAGAAAAAGCACAAGCCACTCTGATTTTGATTAATTTTTTTGCCCTCCAATATTCGTACATTAGTTCAGTTTAGTGACCATACACTACATTAAATTGTAGCAGCTTCCTGACGCACCTCGACAATTGGCAAGTGTGTAAATCATTAGCTGAACTTACTCAGCAGTGATAAGGCTGTTGGAAAGAGGGGATGTTATCTCCCCAAAGTATCTCTGTTTGCATTTTTCCTTCAAGCTGAAACATATAGGGCTCACAAGGCACCAACTCATTTTAAAGACTGCTTTATGGCTTAAAAGCAAGGCCTGGTAACCCTTTGGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATTCTCGGAATAATTCTCAAACATATCAGCATTGCACTTGGGGTTGCCACCTGGCCGGTAAAAAGGGAGGTTGATCCAAATGTTATTATGCAA
  5   1   2       bld Gas6                            IMAGE:3437917.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATTAATTGGTTATTTGTAACAGAAAAAGCACAAGCCACTCTGATTTTGATTAATTTTTTTGCCCTCCAATATTCGTACATTAGTTCAGTTTAGTGACCATACACTACATTAAATTGTAGCAGCTTCCTGACGCACCTCGACAATTGGCAAGTGTGTAAATCATTAGCTGAACTTACTCAGCAGTGATAAGGCTGTTGGAAAGAGGGGATGTTATCTCCCCAAAGTATCTCTGTTTGCATTTTTCCTTCAAGCTGAAACATATAGGGCTCACAAGGCACCAACTCATTTTAAAGACTGCTTTATGGCTTAAAAGCAAGGCCTGGTAACCCTTTGGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATTCTCTGAATTTTCTCAAACATATCAGCATTGCACTTGGGGTTGCCACCTGGCCGGTGGAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATGGATATATAGGAGGGCCGGTAtttttttttCGGGGGAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAATTGTAttttttttttAATT
  5   1   2       bld Ov1       in                    IMAGE:5074251.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATCGTCGACCCACGCGTCCGAAAAAGCACAAGCCACTCTGATTTTGATTAATTTTTTTGCCCTCCAATATTCGTACATTAGTTCAGTTTAGTGACCATACACTACATTAAATTGTAGCAGCTTCCTGACGCACCTCGACAATTGGCAAGTGTGTAAATCATTAGCTGAACTTACTCAGCAGTGATAAGGCTGTTGGAAAGAGGGGATGTTATCTCCCCAAAGTATCTCTGTTTGCATTTTTCCTTCAAGCTGAAACATATAGGGCTCACAAGGCACCAACTCATTTTAAAGACTGCTTTATGGCTTAAAAGCAAGGCCTGGTAACCCTTTGGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATTCTCTGAATTTTCTCAAACATATCAGCATTGCACTTGGGGTTGCCACCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTGATAGGCAAAAAAGGATGGATATGTAGGAAGGCCGGTAtttttttttCAGAAAAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAAT
  5   1   2       bld Egg1                               PBX0062D08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTATTGTAAATTAATTGGTTATTTGTAACAGAAAAAGCACAAGCCACTCTGATTTTGATTAATTTTTTTGCCCTCCAATATTCGTACATTAGTTCAGTTTAGTGACCATACAGCTTCCTGACGCACCTCGACAATTGGCAAGTGTGTAAATCATTAGCTGAACTTACTCAGCAGTGATAAGGCTGTTGGAAAGAGGGGATGTTATCTCCCCAAAGTATCTCTGTTTGCATTTTTCCTTCAAGCTGAAACATATAGGGCTCACAAGGCACCAACTCATTTTAAAGACTGCTTTATGGCTTAAAAGCAAGGCCTGGTAACCCTTTGGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATCCTCTGAATTTTCTCAAACATATCAGCATTGCACTTGGGGGTGCCACC
  5   1   2       bld Ga12      in                         XL217o03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACGAGGGCCACTCTGATTTTGATTAATTTTTTTGCCCTCCAATATTCGTACATTAGTTCAGTTTAGTGACCATACACTACATTAAATTGTAGCAGCTTCCTGACGCACCTCGACAATTGGCAAGTGTGTAAATCATTAGCTGAACTTACTCAGCAGTGATAAGGCTGTTGGAAAGAGGGGATGTTATCTCCCCAAAGTATCTCTGTTTGCATTTTTCCTTCAAGCTGAAACATATAGGGCTCACAAGGCACCAACTCATTTTAAAGACTGCTTTATGGCTTAAAAGCAAGGCCTGGTAACCCTTTGGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATCCTCTGAATTTTCTCAAACATATCAGCATTGCACTTGGGGTTGCCACCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATATATAGGAAGGCCGGTAtttttttttCAGAAAAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAATTGTAttttttttttttAAT
  3   1   2       bld Ga18 5g3  in                      xlk146a08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTTTNNTNNNTTTTTTNGCCCTCNNANATTCGTNCATTAGTTCANNTTTAGNGNCCNTNNNCTACNNTAAATNGTAGCANNTTCCTGNCGCACCTNGACANNNNGCAAGTGTGTAAATCATTANCTGNNCTTACTCAGCAGTGATAAGGCTGTTNGAAAGAGGGGATGTTATCNCCCCAAAGTATCTCTGTTTGCATTTTTCCTTCAAGCTGAAACATATAGGGCTCACAAGNCACCANCTCATTTTAAAGACTGCTTTATGGCTTAAAAGCAAGNCCTGGTAACCCTTTGGCTGCCAGNCCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAANCCAATGAGAGAATCCTCTGAATTTTCTCAAACATATCAGCATTGCACTTGGGGTTNCCACCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATATATAGGAAGGCCGGTATTTTTTTTTCAGAAAAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAATTGTATTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTNCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGANCCTGTTGATNCTTTGTGTGGAGGGTGTGANCNNCCTTTT
  3   1   2       bld Ga18 5g3  in                       xlk67e19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTNGNNNNTTTTTTNNCNNNNNNTTCGTNCATTAGTTNAGNTTAGNGNCCATNNACTACATTAAATTGTAGCANNTTCCTGANNNNNCNCGANAATTGGCAAGNGTGTAAATCATTAGCTNNNCTTNCTCAGCAGTGANAAGGCTGTTGGAAAGAGGGGATGNTNTCTCCCCAAAGTATCTCTGTTTGCATTTTTCCTTCAAGCTGAAACATATAGGGCTCACAAGNCACCAACTCATTTTAAAGACTGCTTTATGGCTTAANNNNNNGNNCTGGTANTCCTTTNGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATCCTCTGAATTTTCTCAAACATATCAGCATTGCNCTTGGGGTTNNCACCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATATATAGGAAGGCCGGTATTTTTTTTTCAGAAAAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAATTGTATTTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTNCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGNCCCTGTTGATNCTTTGTGTGGAGGGTGTG
  5   1   2       bld Eye1                            IMAGE:7020380.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGACCGGTCCGGATTCCCGGGATGGCTGTTGGAAAGAGGGGATGTTATCTCCCCAAAGTATCTCTGTTTGCATTTTTCCTTCAAGCTGAAACATATAGTTTTCACAAGGCACCAACTCATTTTAAAGACTGCTTTATGGCTTAAAAGCAAGGCCTGGTAACCCTTTGGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATCCTCTGAATTTTCTCAAACATATCAGCATTGCACTTGGGGTTGCCACCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATATATAGGAAGGCCGGTAtttttttttCAGAAAAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAATTGTAttttttttttttAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAAGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTTCCATTTGTTTTTCCTTCCAAATTTTGGTTCTTTTTGGGGTCTGAATCCTTTTGACCCCTGTTTGAAACCTTTGGTC
  3   1   2       bld Tad2      in                    IMAGE:6872319.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAAAGGAGGGGGATGTTTTTTCCCCCAAAAGTATCTCGGTTTTGCATTTTTTCCTTCAAGGTGGAAACATATAGGGGCCCACAAGGGCACCAATTTCATTTTTAAAGACTGCTTTATGGTTTAAAAGCCAAGGGCCTGGTACCCTTTGGGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATCCTCTGAATTTCTCAAACATATCAGCATTGCACTTGGGGTTGCCACCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGAAAAATATATAGGAAGGCCGGTATTTTTTTTTCAGAAAAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAATTGTATTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGGTCTGATCTTTGACCCTGTTGATACTTGTGTGGAGGGGTGAACAT
  3   1   2       bld Ga18      in                      xlk125a07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCNNAAAGTnnnnnnnnTTNNATTTNNTCANGCTNAAACANNNAGGGCTCANANGGNNNACTCATTTTAAAGNCTGCTTTATGNCTTAAAANNAAGNCCTNGTAACCCTTTNGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATCCTCTGANTTTTCTCAAACATATCAGCATTGCACTTGGGGTTNCCACCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATATATAGGAAGGCCGGTATTTTTTTTTCAGAAAAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAATTGTATTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTNNTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATNCTTTGTGTNGAGGGTGTGA
  5   1   2       bld Ga15                               XL504n09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTAAAAGCAAGGCCTGGTAACCCTTTGGCTGCCAGTCCCCAAACAACAGCTTGCATTTAATGTATATTAAAAGCTCAAAACCAATGAGAGAATCCTCTGAATTTTCTCAAACATATCAGCATTGCACTTGGGGTTGCCACCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATATATAGGAAGGCCGGTAtttttttttCAGAAAAGGTGGCAACCCTAACTGCACTANATTTTTCACATTAATTGNAtttttttttttANTNAAACTCGGCTCTCTACCCCCCNG
  3   1   2       bld Ga15      in                       XL417c06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATATTAAAAGCTCAAAACCNAGGGGGGGNATCCTNTGGAATTTTNTCAAACATATCAGCNTTGCNCTNGGGGTTGCCCCCTGGGCCGGGTAAAAANGATGGTNGATCCAAANGNTATTAATNGGCAAAAAAAGNTAAATNTATNGGNNGGCCGGTATTTTTTTTTCAGAAAAGGGGGCAACCCTAACTGCNCTAGATTTTTCNCATTAATTGTATTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTNGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCNGATCTTTTGACCCTGNTGATACTTTGCGTGGAGGGTGTGAACG
  3   1   2       bld Emb1 5g3  in                    IMAGE:3402678.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATGAGAGAATTCTCTGAATTTTCTCAAACATATCAGCATTGCACTTGGGGTTGCCACCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATATATAGGAAGGCCGGTATTTTTTTTTCAGAAAAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAATTGTATTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAAAAAAAAAAAAGAAAAAAAAAAGA
  3   1   2       bld Ga15      in                       XL468b12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GNATCCTNNGAATTTTTTCAAACANATCAGCNTTGCNCTTGGGGNNGCCCCCNGGCCGGNAAAAAGGNNGGNTGATCCAAATGTTATTAATAGGCAAAAAAAGNTAAATNTATNGGNAGGCCGGTATTTTTTTTTCAGAAAAGGGGGCAACCCTAACTGCNCTAGATTTTTCNCATTAATTGTATTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGNGTGGAGGGTG
  5   1   2       add Ga15      in                       XL456k10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGAATTTTCTCAAACATATCAGCATTGCACTTGGGGTTGCCACCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATATATAGGAAGGCCGGTAtttttttttCAGAAAAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAATTGTAtttttttttttAATTAAACTCNGCTCNCTACCCCCCTGGGACATGGAATAAATTACTATCANCCAGNCCCNGCTTTGCTAAATCTTTCATCCNGCTATTTNGGGGANAGGGAAAAANGTAAATCATTCNCAAACNGAGTTAATCATTACCNGCCAGGGANCCNCTACCAGGGTTAAGGCANANGGCACTCAAAGNANCCNCTTGANACTACCATTGACTAAAAAANGGAGTTGATTAAAANAACCAGGGCTGTCNCTTTTCATCTTAAAANGTTCATACAAGTTTTGNCCNC
  3   1   2       bld DMZ  5g3  in                         xl256n02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCATTGCACTTGGGGNTGCCNCCTGGCCGGTAAAAATGATGGNTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATNTNTTGGNAGGCCGGTNTTTTTTTTTTCAGAAAAGGNGGCAACCCTAACTGCNCTAGATTTTTCACNTTAATTGTATTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCCTGNTGATACTTTGTGGGAGGGT
  3   1   2       bld DMZ  5g3  in                         xl298e20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCATTGCACTTGGGGTTGCCNCCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATATATAGGAAGGCCGGTATTTTTTTTTCAGAAAAGGTGGCAACCCTAACTGCNCTAGATTTTTCNCNTTAATTGTATTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTG
  3   1   2       bld Ga15 5g3  in                       XL462i24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CNNGGGGNTGCCCCCNGGCCGGNAAAAANGNTGGNTGATCCNAATGTTATTAATNGGNAAAAAAAGNTAAATATNTAGGNAGGCCGGTATTTTTTTTTCAGAAAAGGGGGCAACCCTAACTGCNCTAGATTTTTCNCATTAATTGTATTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTGNGTCTGATCTTTTGACCCCTGNTGATACCTTTGTGTGGAGGGTG
  3   1   2       bld Ga12      in                         XL186k15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCNCCTGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATATATNGGAAGGCCGGTATTTTTTTTTCAGAAAAGGTGGCAACCCTAACTGCNCTAGATTTTTCNCATTAATTGTATTTTTTTTTTTAATTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGTGAACGTGCCTTTTACAATAAA
  3   1   2       bld Neu7 5g3  in                         XL048l17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGCCGGTAAAAATGATGGTTGATCCAAATGTTATTAATAGGCAAAAAAAGATAAATATATAGGAAGGCCGGTATTTTTTTTTCAGAAAAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAANTGTATTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGT
  3   1   2       bld Ga15 5g3  in                       XL506b21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAAAGGNNAATNTTTNGGAAGGCCGGTNTTTTTTTTTCAGNAAAGGGGGNNACCCTAANTGCNNTNGATTTTTCNCANTAATNGTATTTNTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCCTGCTGATACCTTTGCGTGGAGGG
  3   1   2       bld DMZ  5g3  in                         xl293n20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGAAGGCCGGTNTTTTTTTTTTCAGAAAAGGNGGCAACCCTAACTGCNCTAGATTTTTCNCNTTAATTGTATTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTGTGGGAGGG
  3   1   2       bld Ga15                               XL503n09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGNAGGCCGGTATTTTTTTTTCNGAAAAGGTGGCNACCCTAACTGCNCTAGATTTTTCACNTTAATTGTATTTTTTTTTTTAATNAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTCNATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCNGATCTTTTGACCCTGTTGATACTTTGTG
  3   1   2       bld Ga12      in                         XL217o03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGCCGGTATTTTTTTTTCAGAAAAGGNGGCAACCCTAACTGCNCTAGATTTTTCNCATTAATTGTATTTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCATGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGTGAACGTGCCTTTTACAATAAAT
  3   1   2       bld Neu7 5g3  in                         XL005n13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTATTTTTTTTTCANAAAAGGTGGCAACCCTAACTGCACTAGATTTTTCACATTAATTGTATTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGGAACGTGCCTTTTACAATAAATTGTTACAATGCC
  3   1   2       bld Egg2                            IMAGE:5278877.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAACATATCAGCAACCCTAACTGCACTAGATTTTTCACATTAATTGTATTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGTGAACGTGCCTTTTACAATAAATTGT
  3   1   2       bld Ooc3 5g3  in                    IMAGE:3437405.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAACTGCACTAGATTTTTCACATTAATTGTATTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACCCCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGTGAACGTGCCTTTTACAATAAATTGTTACAATGCCTGCTCAAAAAAAAAAAAAAA
  3   1   2       bld Tbd7      in                         XL058o03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTTTCACATTAATTGTATTTTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTNANTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGNT
  3   1   2       bld Emb1 5g3  in                    IMAGE:3402853.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTTTCACATTAATTGTATTTTTTTTTTAATTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGNTGTGAACGNTGCCTTTTCACAAATAAATGTGTTACAATCGCCTGCTCAANAAAAAAAAAGAAnTATAAAAAAAGGTTAAAAAAACAnAAAAANA
  3   1   2       bld Ga18      in                       xlk61h12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TNNCACnnnnnnnnnATTTTTTTTTNNTTTAGNNTCTNCTCTCNNNNNNCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTNCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGNCCCTGTTGATACTTTGTGTGGAGGGTGTGA
  3   1   2       bld Ov1       in                    IMAGE:5074251.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGTGAACGTGCCTTTTACAATAAATTGTTACAATGCCTGCTC
  3  -1   2       bld Lu1       in                    IMAGE:4673982.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGACTCTGCTCTCTACCCCCCTGTGACATGGAATAGATTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAAGGGGGGGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAA
  5  -1   2      seed Lu1       in                    IMAGE:4673982.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTACTATCAGCCAGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGTGAACGTGCCTTTTACAATAAATTGTTACAATGCCTGCTCAAAATTa
  3   1   2       bld Emb4 5g3  in                    IMAGE:4959240.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTCCCTGCTTTGCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACTAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGTGAACGTGCCTTTTACAATAAATTGTTACAATGCCTGCT
  3   1   2       bld Ov1       in                    IMAGE:5047833.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTAAATCTTTCATCCTGCTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGTGAACGTGCCTTTTACAATAAATTGTTACAATGCCTGCTC
  3   1   2       bld Ga15      in                       XL456k10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTTTCATCCTGNTATTTTGGGGAGAGGGAAAAATGTAAATCATTCGCAAACTGAGTTAATCATTACCTGCCAGTGATCCTCTACCAGTGTTAAGGCAGATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATNTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGGAGATGCTCCATTTGTTTTCCTTNTAATTTTGTTCTTT
  3   1   2       bld Eye1 5g3  in                    IMAGE:4743324.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGGCACTCAAAGTAGCCTCTTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGTGAACGTGCCTTTTACAATAAATTGTTACAATGCCTGCTCAAAATTAAAAAAAAAAAAAA
  3   1   2       bld Eye1 5g3  in                    IMAGE:4743539.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGAGACTACCATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGTGAACGTGCCTTTTACAATAAATTGTTACAATGCCTGCTCAAAAAAAAAAAA
  5   1   2       bld Ga15                               XL424j12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGACTAAGAAATGGAGTTGATTAAAAGAACCAGTGCTGTCTCTTTTCATCTTAAAATGTTCATACAAGTTTTGTCCACATTCACTCAATTAAAAAACACCATTAAAAAAGTTAACGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGTGAACGTGCCTTTTACAATAAATTGTTACAATGCCTGCTCaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL498h14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGTGAACGTGCCTTTTACAATAAATTGTTACAATGCCTGCTCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL498h14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAAATAATAACAGCCCTCCAAATATCTTGAAGGTAGTGTTTACCAGGCAAGGTGTGTGCTCTGTACATAGTCCTGTAGAGATGCTCCATTTGTTTTCCTTCTAATTTTGTTCTTTTTGTGTCTGATCTTTTGACCCTGTTGATACTTTGTGTGGAGGGTGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)