Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL422o09ex.3                          7 END     4           5       57                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6643728.5                      76 PI      90         11     1870                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012837324 Xl3.1-IMAGE:5078690.5.5 - 73 ESTs
                                                                       ....-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:5078690.5.5                                   GGTGGTGCCGTAGTTGCGCTTCCGGCTGCAAGGTAGCGCTGGTGCGGGTGTGAGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAAGACAAGAAGCTTCGTGTAATAGATCCACGAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGAGCCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCAAAAACAAAAAAACAAAAAAAAAACAGTCCACTCCCTTTATTTCATTGAGACTTTCCAAATACCCCTCCAACCAGGTNCCTCTCTTAAAACCCTAATTGTNCCACTTCAAGTATTGCTTGAGAGTCCAACTACTGAGGTG
                                                  Xl3.1-CHK-1012721270                                         GCCGTAGTTGCGCTTCCGGCTGCAAGGTAGCGCTGGTGCGGGTGTGAGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAAGACAAGAAGCTTCGTGTAATAGATCCACGAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGAGCCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCAAAAACAAAAAAACAAAAAAAAAACAGTCCACTCCCTTTATTTCATTGAGACTTTCCAAATACCCCTCCAACCAGGTNCCTCTCTTAAAACCCTAATTGTNCCACTTCAAGTATTGCTTGAGAGTCCAACTACTGAGGTGTCGTAA
                                                      consensus depths                                        3     4     5     8     6     8     7     9     9    10    18    19    18    19    26    28    28    30    30    32    31    34    33    35    34    36    34    36    34    36    34    36    36    37    38    39    38    39    38    39    37    39    38    39    39    40    39    40    39    40    39    39    39    39    39    39    38    38    38    38    38    38    37    37    36    36    35    36    35    36    35    36    36    37    36    37    36    37    35    36    32    36    31    36    32    36    31    35    30    34    30    34    30    34    29    34    29    34    29    34    28    33    29    33    29    33    26    33    27    33    26    33    22    32    23    32    24    33    19    32    22    31    16    28    14    25    13    25    10    23     8    21     9    21     9    20     9    18     7    17     5    15     5    16     6    16     6    16     7    17     7    16     8    16     8    14     8    14     8    14     9    14     9    15    11    15    12    16    12    16    12    16    13    16    15    18    17    20    17    20    15    19    15    21    16    21    17    21    17    21    22    23    20    23    20    23    22    23    22    23    19    24    21    25    21    25    24    26    24    26    25    25    24    25    24    25    26    26    26    26    24    26    25    26    25    26    23    25    23    25    23    25    21    25    24    25    24    25    23    25    23    25    20    24    21    24    21    24    21    24    23    26    21    26    23    26    22    26    22    26    23    27    24    27    23    26    22    26    23    26    22    26    22    26    22    26    21    26    19    25    19    23    14    17    12    15     8    11     5     6     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
  5   1   2       e50                            Xl3.1-IMAGE:5078690.5                                     TGGTGCCGTAGTTGCGCTTCCGGCTGCAAGGTAGCGCTGGTGCGGGTGTGAGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAAGACAAGAAGCTTCGTGTAATAGATCCACGAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGAGCCAATTGCACT
  5   1   2       e50                              Xl3.1-xlk135g12ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCGTGTAATAGATCCACGAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGAGCCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCAAAAACAAAAAAACAAAAAAAAAACAGTCCACTCCCTTTATTTCATTGAGACTTTCCAAATACCCCTCCAACCAGGTNCCTCTCTTAAAACCCTAATTGTNCCACTTCAAGTATTGCTTGAGAGTCCAACTACTGAGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------C-
                                               BLH ATG     196    2195                                   
                                               BLH MIN     190     260                                   
                                               BLH OVR     196      26                                   
                                               EST CLI      53      10                                   
                                               ORF LNG     196       2                                   
  5   1   2       e50                            Xl3.1-IMAGE:5078690.5                                     TGGTGCCGTAGTTGCGCTTCCGGCTGCAAGGTAGCGCTGGTGCGGGTGTGAGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAAGACAAGAAGCTTCGTGTAATAGATCCACGAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGAGCCAATTGCACT
                                                  Xl3.1-CHK-1012686984                                           CGTAGTTGCGCTTCCGGCTGCAAGGTAGCGCTGGTGCGGGTGTGAGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAAGACAAGAAGCTTCGTGTAATAGATCCACGAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGAGCCAATTGCACTGCATGA
  5   1   2       bld Egg3 5g                         IMAGE:6323946.5p GGGCGGCTACGTCAGTCAGGAGCGGCGGGAGGGAGGTGGTGCCGTAGTTGCGCTTCCGGCTGCAAGGTAGCGCTGGTGCGGGTGTGAGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTCATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCNCAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGGTGCGATAATGTCGTCATCATTTTGGAACGTGGGCACTGGNAGAGGCCTTGGATAACTTGGGAGGATATGCACAATGATATGGATATACAGTGGTTTGCCTGGAACCGGTAAAGGGGAAGCCTCATTTTGCACAGCCTTCCCAAAGGACAAGAAAGCTTTCCGTGGTAAATAGAATCCACAAAAAGGATGGGAAGGTGGGTTATCC
  5   1   2       bld Bla1 5g3  in                    IMAGE:3379827.5p                       CCGGGGGAGGGAGGTGGTGCCGTAGTTGCGCTTCCGGCTGCAAGGTAGCGCTGGTGCGGGTGTGAGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAAACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCCAAATCATTAGGCGTGTGGTGCGACCAAGCAAGTTCCGGCACGTCTTTGGGCAGCTGTGAGGAATACCAATGCTCGATGATATACTGGTTCTCGTGTACTTGGGCAGCTTTTCTGTGC
  5   1   2       bld Ov1       in                    IMAGE:8328109.5p                         cggacgcgtgggtGGTGCCGTAGTTGCGCTTCCGGCTGCAAGGTAGCGCTggtgcgggtgtgagtgatacagtgctgagtgtgcgggaagggtggagtgtgagtgCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGANTATGTCGTCATCATTTGGAACGTGGG
  5   1   2      seed DMZ  5g3  in                         xl251l02.5p                                  TNCNTCNNTTCNAATTCNNNACGAGGCTGCAAGGTAGCGCTggtgcgggtgtgagtgatacagtgctgagtgtgcgggaagggtggagtgtgagtgCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACC
  5   1   2       bld Spl  5g                         IMAGE:8460985.5p                                    AAANNNTCCCATTCNNNGCGGACCATCGATTGAATTGTCCCTGCGGGTGTGAGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGTATGCACATGATATGATATACAGTGTTTGCTGGAACGTAATGGAGCTCATTTGCACAGCTCCAAGACAGAGCTCGTGTATAGATCACAAGATGAGTGTATCGAAAAGAAAGCTCTGAGGTGCAGCAATAAACATCTTTA
  5   1   2       bld Oo1  5g                         IMAGE:5084711.5p                                          CCGTAGTTGCGCTTCCGGCTGCAAGGTAGCGCtggtgcgggtgtgagtgatacagtgctgagtgtgcgggaagggtggagtgtgagtgcTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGNCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTNTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGNATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAAGACAAGAAGCTTCCGTGTAATAGATCCCGNAAAAGATGGAAGNTGGGTATCGGGAGAAAGATAAAGGCTCATGAAGGGTGCCAAGGCCAATGGAGAGCAATCTTTTTATCCTGGAG
  5   1   2       bld Int2 5g                         IMAGE:8824595.5p                                           ACGCCCGATTTATAACCCAGGACCCCTCCAATTCAAAATCGTCCCGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAGACAAGAAGCTTCGTGTATAGATCCACGAAAGATGGAAGTGTAATCGGAGAAGATAAAGCTCATGAAGGTGCCAGGCATGAAAGCAATCTTTTATCTGATGGGAAACGTCTTTACTACAGGTTCATTCGGAAGAGATGAACGTTCGCG
  5   1   2       bld DMZ  5g3  in                         xl341j06.5p                                               GTTGCGCTTCCGGCTGCAAGGTAGCGCTGGTGCGGGTGTGAGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGA
  5   1   2       bld Tad2 5g                         IMAGE:6932797.5p                                                             GGGAAGGTAGCGCTGGTGCGGGTGTGAGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCNCACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGANTATGTCGTCATCATTTGGAAACGTGGGCACTGGAGAGGCCTTTGATTAACTTGGGAAAGAATGGCACAANTGGATATGATATACAAGTGTTTGGCTGGAAACCCGTAATGGGGAAGCCCTCATTTTGCCACAGCCCTCCNAAAAGACCAAGAAACCTTTCCGTGGTAATNTAGATTCCCACGCAAAAAGATTGGAAAAGTTGGTGATTCCGGGAAGAAAAGGAATAAAAGCCTCCATTGGAAAAGGTGGGCCCAACGGCCCCAAATGGGAGC
  5   1   2       chi DMZ       in                         xl231m22.5p                                                                              GCGGGTGTGAGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAANACNACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCNAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAANCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGNACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCNGCTAGCACTGTGGAATCCAAAAAATCTGGAAGAGCCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTA
  5   1   2       bld Oo1  5g                         IMAGE:5078690.5p                                                                                    GTGAGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGCGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAAGACAAGAAGCTTCGTGTAATAGATCCACGAAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTTATCTGATGGAAACGTCTTTTACTACAGGGTTCAATCGGGATGGAATGAACGTCAGCTTAGCACTGTGGGAATCCAAAAAAATCTGGAAA
  5   1   2       bld FaBN 5g                         IMAGE:8078507.5p                                                                                    GTGAGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGCGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGNGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCANCATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAGACAGAAAGCTCGTGTAATAGATCACGAAAGATGAAGTGGTATCG
  5   1   2       bld Brn3 5g                         IMAGE:8539303.5p                                                                                    GTGAGTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTGCACAGCCTCAAAGACAAGAGCTTCG
  5   1   2       bld Eye1 5g                         IMAGE:6946786.5p                                                                                     CGAATGGATAAGTGCTGAGTGTTTTGCAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAAGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCCCCCTGATATGATATACAGTGTTTGCCTGGAACCGTAATGGGGAGCCTCATTTGCAAAATCCTCCAAAGACAAAAAAAGCTTTCGTGGTAATAAGATTCCCCCAAAAAAATTGGAAAGTTGGGTTATTCTGAAGAAAAGCAATATAAAGCCTCCCTTGAAAAGGGTTGCCCCAGGTGTCCCCTAATTGTAGGAAGTCCCCAACTCCtttttttttATTCTCCCTGGAAGGGGGAAAAAAACCAGCTTCCCTAA
  5   1   2       bld Emb4 5g                IMAGE:5571610-IMAGp.IMAGp                                                                                        GTGATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCA
  5   1   2       bld Ov1  5g                         IMAGE:6317338.5p                                                                                          GATACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACCATGATATGATATACAGTGTCTTGCTGGAACCGTAATGGGAGCCCTCATTTGCACAGCCCTCCAAAGACAAGAAAGCTTCCTGGTAATAAATCCACCAAAAGATGGAAGGGGGCATCCGGAAAAAAGATAAAGCCTCCTGGAAAGGTGCCCACGGCCCAATGAAGAACCAATCCTTTTTTATCCTGATGGGACAACCCTCTTTTAACTACACGGGGTTCCACCCCCGGATAGGACTGGAACGCCTCCGTCTTAACCCCCTGGTGGGAAAATCCCCAAGACAACCCTGGGAAAAGAAACCCCAATTCCCACCTCGGCTCTGTAA
  5   1   2       bld Egg1 5g                            PBX0021E02.5p                                                                                             ACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATGTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTA
  5   1   2       bld Egg1 5g                            PBX0021F02.5p                                                                                             ACAGTGCTGAGTGTGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAAT
  5   1   2       bld Ov1  5g                IMAGE:6317338-IMAGp.IMAGp                                                                                               CGCTCGAGTCGCGCGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAAT
  5   1   2       bld Tad2 5g                         IMAGE:6872412.5p                                                                                                            CGGGAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGGGGTTTTGCTGGAACCCGAAATGGGAAACCTCAATTTGCACAACCCCTCCAAA
  5   1   2       bld Ov1  5g                         IMAGE:8330806.5p                                                                                                               GAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATTCATTTGGAACGTGGGCACTGGAGAAGCCTTGATAAACTTGGAAGATATGCACAT
  5   1   2       bld Ga18 5g                           xlk104f16ex.5p                                                                                                               GAAGGGTGGAGTGTGAGTNCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCANTNNNNAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGNATTGTCACATGGNCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGNTNNGATAATGTCGTCATCATTTGGAACGTGGGCNCTGGAGAGGNCTTGATAAACTTGGAAGATATGCACNATGATATGATATACAGTGTTTGCTGNAACCGTAATGGGAGNCTCATTTGCACNNNCTCCAAAGACAAGAAGCTNCGNGTAATAGATCCACGAAAGNNGGAAGTGGNATCGG
  5   1   2       bld DMZ  5g3  out                        xl232h09.5p                                                                                                               GAAGGGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTC
  5   1   2       bld Ga18 5g3  in                       xlk72n05ex.5p                                                                                                                GAAGNTGGAGTGTGAGTNCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCANNNNNNAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGNTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGNGATAATGTCGTCATCATTTGGAACGTGGNNNCTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCNTAATGGGAGCCTCATTTGCACAGNCTCCAAAGACAAGAAGCTTCNNNNNATAGATCCACGAAAGNNGNAA
  5   1   2       bld Tbd7 5g3  in                         XL101h22.5p                                                                                                                   GGTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTT
  5   1   2       bld DMZ  5g3  in                         xl239p23.5p                                                                                                                    GTGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATG
  5   1   2       bld Ga15 5g                            XL511g14ex.5p                                                                                                                     TGGAGTGTGAGTGCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAAGACAAGAAGCTTCGTGTAATAGATCCACGAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGAA
  5   1   2       bld Ga18      in                      xlk105g10ex.5p                                                                                                                     TGGAGTGTGAGTNCTGCTTTCCTAAGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCANNNNNNAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGNGATAATGTCGTCATCATTTGGAACGTGGGCNCTGGAGAGNNCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGNAGNCTNANTTGCACNGNNTCCNAAGACNAGAAGNTTCGTGTAATAGATCCACGAAA
  5   1   2       bld Neu7 5g                              XL035d09.5p                                                                                                                               GGTGCTGCTTTCCTAAGCCCAGTCGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCAGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACA
  5   1   2       bld Ooc1 5g3  in                      xlnoc001c07.5p                                                                                                                                   CGGCCGCCTAGGCCCAGTCAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCAT
  5   1   2       bld Ga14 5g                            Ga14-p4b10.5p                                                                                                                                    CTTTCCTAAGCCCAGACAGGAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGNAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAA
  5   1   2       bld Neu7 5g3  in                         XL048e02.5p                                                                                                                                        GCCTAAGCCCAGTCAGGAAGACGACAGANACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGAACATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCAGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACA
  5   1   2       bld Ga12 5g3  in                         XL146b21.5p                                                                                                                                                        GAAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATATTTTGGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTAATTTGCACAGCCT
  5   1   2       bld Ooc3 5g                         IMAGE:3472684.5p                                                                                                                                                         AAGACGACAGAGACCAATTTCTGCTATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAACCAAGGGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCCACCCATGACAATGTTATTGCCAGTGGCTCAAAAGATTGCACAGTTATG
  5   1   2       bld Neu7 5g                              XL037c13.5p                                                                                                                                                                       AATTTCTGCTATAAACAAGGCTCCTCAAGGNAGGGCACCAAGNAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCAGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGNCACATGGCATCCAACTGCTCGTAATGTATTGCTTANTGCAGGNTGCGANAATGTCGTCATCATTNGGAACGTGGNCNCTGGAGAG
  5   1   2       bld Ga15 5g                            XL439h07ex.5p                                                                                                                                                                                 TATAAACAAGGCTCCTCAAAGGAGGGCACCAAGAATAGACCATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAAGACAANAAGCTTCGTGTAATANATCCACGAAAGATGGAAGTGGTATCGGGANAAAGATAAAGCTCATGAANGTGCCANGCCAATGANAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAG
  5   1   2       bld Ga12 5g3  in                         XL197f23.5p                                                                                                                                                                                                                          ATTGAGCCAGATACAATGAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCAAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAA
  5   1   2       bld Tbd3      in                    IMAGE:3548570.5p                                                                                                                                                                                                                                           GAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCCAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTG
  5   1   2       bld Sp1       in                    IMAGE:4175471.5p                                                                                                                                                                                                                                           GAGGCGTGTGGTGCGACAAAGCAAGTTCCGTCACGTCTTTGGGCTAGCTGTGAAGAATGACCAATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAG
  5   1   2       bld DMZ       in                         xl231i02.5p                                                                                                                                                                                                                                                                                                          ATGCTACGATGATATACGGGTCTCTCGTGTTACTTGGGACAGCTCTTTCTGTGCTGTCAACCCCAATTTTGTTGCCATAATTATTGAAGCAAGTGGTGGAGGGGCCTTCCTGGTGTTGCCTCTACAGAAGTCTGGAAGAATTGACAAATCCTACCCTACCGTGTGTGGCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAAGACAAGAAGCTTCGTGTAATAGATCCACGAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGAGCCAATTGCACTGCATGAAAT
  3   1   2       bld Ov1       in                    IMAGE:8328109.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCGTGTTGNCCACACAGGACCAGTGCTGGACATTGACTGGTGTCCACACAATGACAATGTTATTGCCAGTGGCTCAGAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAAGACAAGAAGCTTCGTGTAATAGATCCACGAAAGATGGAAGTGGTATCGGTAGGTCTATAGGAGCCAACTGAAAAACCCAAGAATTTTTGAGAAACAATATGAATAAAACATTTATTGAACTATAGATTGTAAAGGGACAGCAGTGGCATAGCTTTGCCACATTTTCAGTCCAAGTCTCGCAAAAGAAATTCCCATGCTAGCAATGGACTCCTCGAGGGGAGGGTGGTGTTATTTACGTAGTAATTAGCTTGGTGTAATGTGGAATTTTATATGGAATATTAAAACATATTTATTATTGTGACTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Oo1                             IMAGE:3404731.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGTTATTGCCAGTGGCTCATAAGATTGCACAGTTATGGTATGGCAGATCCCGGAGAATGGCTTGACTATCCCACTTACAGATGCTGTGGTTGTGCTGGAAGGACATTCCAAGCGAGTTGGCATTGTCACATGGCATCCAACTGCTCGTAATGTATTGCTTAGTGCAGGTTGCGATAATGTCGTCATCATTTGGAACGTGGGCACTGGAGAGGCCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAAGACAAGAAGCTTCGTGTAATAGATCCACGAAAGATGGAAGTGGTCTCGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAAT
  5   1   2       bld Ga18      in                      xlk135g12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAGAGGNCTTGATAAACTTGGAAGATATGCACAATGATATGATATACAGTGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAAGACAAGAAGCTTCGTGTAATAGATCCACGAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGAGCCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTNGNTTTGATGGGAAAAATGCAGACCCCATCTTGNTCTCCTTAAAGCAGGGGTNTGTNCCAACCAAAGGCAGAGANC
  5   1   2       e50                              Xl3.1-xlk135g12ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCGTGTAATAGATCCACGAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGAGCCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCAAAAACAAAAAAACAAAAAAAAAACAGTCCACTCCCTTTATTTCATTGAGACTTTCCAAATACCCCTCCAACCAGGTNCCTCTCTTAAAACCCTAATTGTNCCACTTCAAGTATTGCTTGAGAGTCCAACTACTGAGG
                                                  Xl3.1-CHK-1012688112                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAATAGATCCACGAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGAGCCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCAAAAACAAAAAAACAAAAAAAAAACAGTCCACTCCCTTTATTTCATTGAGACTTTCCAAATACCCCTCCAACCAGGTNCCTCTCTTAAAACCCTAATTGTNCCACTTCAAGTATTGCTTGAGAGTCCAACTACTGAGGTGTCGT
  3   1   2       bld Ga18      in                      xlk135g12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAGANGNCNTTGATAAACNNGNANANNTGCACAATGATATGATATACAGTGTTTGCTGGANCNTAANGGGANCCTCATNNNNCAGCCTCNAAAGANAAGAAGCTTCGTGNAATAGATCCNCGAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGNAGGNNNCAGGCCAATGAGAGCANTCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGANCCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAANCCGAGCCANCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTNCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGNTCCCACTNCCAGATCAGNTTCCNCC
  5   1   2       bld Em10                            IMAGE:8318270.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGTTTTTTCGGGTCCGGATTCCCGGGATGTTTGCTGGAACCGTAATGGGAGCCTCATTTGCACAGCCTCCAAAGACAAGAAGCTTCGTGTAATAGATCCACGAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGAGCCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTTGATCTCCTTAAAGCAGGGGTAATGTGCCAACCAAAGGGCAGAGACCTTTAATGTGGTTAAAATAATTGTCCTTGGCAGTCATCCAGCACCCATAAAAAAG
  5   1   2       bld Ov1       in                    IMAGE:5048730.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        tcgacccacgcgtccgcccacgcgtccggaAGCTTCGTGTAATAGATCCACGAAAGATGGAAGTGGTATCGGAGAAAGATAAAGCTCATGAAGGTGCCAGGCCAATGAGAGCAATCTTTTTATCTGATGGAAACGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGAGCCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCT
  3   1   2       chi Ga18      in                      xlk105g10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ANCTNATnnnnnTnnnnnnCCANTNAGANNAATCTTTTTNTCTGATGNNNNNNCTTTNCTACANNNNCAGTCGGATGAGTGNACNTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGANCCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAANTCACAGACGANNCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATNCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGANCCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAANNGAGCCANCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTNCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATNCTTCTCACTGAGCTGGAGGATCCCACTNCCAGATCAGNT
  3   1   2       chi Ga18 5g3  in                       xlk72n05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTNCCAGNCNAATGAGAGCANTCNTTTTTATNNGATGGAANNNTCTTNCTACNNGGNTTCAGTNGGATGAGTNNACGTCAGCTAGCNCNNGTNGNANCCAAAAAATCTGGNNGANCCAANTTNNNNGCNTGAATGGACNCTAGCAATGGAGTTTTGCTGNCATTTTANGNNCCAGNCNCTAATNTCATTTTNNNGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAANTCACAGNCGAGTCCCCATNCGTCCACTNCCTCANNACATTCAGCAGTAAGGNACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACNANCTACATGAGAGGAAGTGTGANCCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAANCCGAGCCANCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCAAAAACAAAAAAACAAAAAAAAAACAGTCCACTCCCTTTATTTCATTGAGACTTTCCAAATACCCCTCCAACCAGGTNCCTCTCTTAAAACCCTAATTGTNCCACTTCAAGTATTGCTTGAGAGTCCAACTACTGAGGTGTCGTAATCTACNTTNCAGCTT
  5   1   2       bld Ga18      in                      xlk114h22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAANCGTCTTTACTACAGGGTTCAGTCGGATGAGTGAACGTCAGCTAGCACTGTGGAATCCAAAAAATCTGGAAGAGCCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGANTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGNTATGTGCCAACCAAAGGCAGAGANCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGNCAGCCAGCGCCCCCAAGAAGATGANCGAAACTTCCCAACCACCTAGTGATGGCAGGATGGNNGACATCATGAAAGAGCTTCGNNCNATGAAAGAGACCATTNNGTGCCAAGNGGATCGGATCGA
  5  -1   2       bld Sp1                             IMAGE:5506070.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGATGAAAGTCTTACTACAGGGTCAGTCGATGAGTGACTTCAGCTAGCACTGTGAATCCAAAAAATCTGAAAGAGCCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATCCACCCATCCATCCCCAGCCAAAACT
  3   1   2       bld DMZ       in                         xl231i02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAAAAANTCTGNAGAGCCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATCCACCCA
  3   1   2       bld Ooc1 5g3  in                      xlnoc001c07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAATCCAAAAATCTGGAGAGCCAATTGCNTGCATGAAATGGACATAGCAATGGAGTTTTGCTGCATTTTATGATCAGACACTATATCCATTTCTTGTGTGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGCGAGTCCCCCATACGTCACCTACCTCAGCACATTCAGCAGTAAGGACCNCAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGNAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAGCCGAGCCAGGCAAGCGCCCCCAAGAAGATTGCCCGGAACTTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCAAAAACAAAAA
  3   1   2       bld DMZ  5g3  in                         xl341j06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGCCAATTGCACTGCATGNAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATCCACCCATCAC
  3   1   2       bld DMZ  5g3  in                         xl239p23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAATTGCACTGCATGAAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACA
  3   1   2      seed DMZ  5g3  in                         xl251l02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAATTGCACTGCATGAAATGGACACTAGCAATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATCCACCC
  5   1   2       bld Ga18      out                     xlk103g24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGGAGTTTTGCTGCCATTTTATGATCCAGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTNCCAGTCTCACCATCNATGATGAGTCAGAAGAATGAGCAGNCCATACTTCTNACTGAGCTGGNGGATCCCACTGCCAGATCAGATTCCACCCATCA
  3   1   2       bld DMZ       in                         xl231m22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGACACTAATATCATTTTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTNCACTACCTCAGCACATTCAGCAGTAAGGAACCTCAGCGAGGGATGGGCTATNNGCCAAAGNGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAAGNTACNTGAGAGGAAGTGTGAACCACTCATCATGANTGTTCCCAGGAAGTT
  3   1   2       bld Neu7 5g3  in                         XL048e02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCTTGTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAGGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAA
  3   1   2       bld Ga12 5g3  in                         XL146b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGTGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGCTGCCAGTCTCACCATCAACGATAGTCAGAAGAATGAGCAGTCCATACTTCTCACTNAGCGGAGGATCCCACGCCAGATCAGATTCC
  3   1   2       bld Ga12                                 XL199d22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAANA
  3   1   2       bld Tbd7 5g3  in                         XL101h22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAAGGGTGATAGCAGTATTCGGTATTTTGAAATCACAGACGAGTCCCCATACGTCCACTACCTCAGCACATTCAGCAGTAAGGAACCACAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCNCCAGGCCCAAANATCAGCATTCCAAAAA
  3   1   2       bld Ga18      in                      xlk114h22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGACGANNCCCNANNCNTNNNCTACCNCAGNANATTCAGCAGTAANGNACCACAGCNNNGGATNGGCTATATNNNAAANAGAGNNTTGGATGTCAACAAGTGTGAAATTNCCAGGTTCTACAAACTACATGAGAGGAAGTGNNNNCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATNNCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGNCCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGNCCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAANCCGAGCCANCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAGGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTNCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCAAAAACAAAAAAACAAAAAAAAAACAGTCCACTCCCTTTATTTCATTGAGACTTTCCAAATACCCCTCCAACCAGGTNCCTCTCTTAAAACCCTAATTGTNCCACTTCAAGTATTGCTTGAGAGTCCAACTACTGAGGTGTCGTANNCTNCNTTTCAGC
  3   1   2       bld Bla1 5g3  in                    IMAGE:3379827.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACGGTCCCCAATCGTTCACTCCGTTAGCCCATTCACAGTAAGGACCCCACGCGAGGGATGGGCAATATGCCAAAGAGAGGCTGGGATGTCACCAGGTGTGAAATTGCAGGTTTTTACAAACTCCATGAGAGCAAGTGTGACCCAATCATCATGCCTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACGCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCC
  3   1   2       bld Ga12 5g3  in                         XL197f23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGANGTCAACAAGTGTGAAATTGCCAGGTTNTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTNTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTNACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAAT
  3   1   2       bld Egg6                            IMAGE:4432969.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAGGGATGGGCTATATGCCAAAGAGAGGCTTGGATGTCAACAAGTGTGAAATTGCCAGGTTCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCAAAAAAA
  3   1   2       bld Tbd3      in                    IMAGE:3548570.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGAGGTCTACGAAATTACATGAGAGTAAGTGGGATCCAATCATCACGAGTGTTCCCAGAAAGTCTGATAGATTCCAAGATGATGTATACCATGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTTATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCAAAAACAAA
  3   1   2       bld Ov1       in                    IMAGE:5048730.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTACAAACTACATGAGAGGAAGTGTGAACCAATCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATAAAAAACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTCCCAAATCAGATTCCACCCATCACATTCCTCCA
  3   1   2       bld Sp1                             IMAGE:5461280.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCATCATGACTGTTCCCAGGAAGTCTGATCTATTCCAAGATGATCTATACCCTGACACTGCTGGACCCGATGCTCCAGTAGAGGCAGAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACTTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCAAA
  3   1   2       bld Sp1       in                    IMAGE:4175471.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTGCTGTACCCCATGCTCCAGTAGAGGCATAGGACTGGTTTGATGGGAAAAATGCAGACCCCATCTTGATCTCCTTAAAGCAGGGGTATGTGCCAACCAAAGGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCCAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCAAAAACA
  5  -1   2       bld Sp1       out                   IMAGE:4964577.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCAAATGCAGAGACCTTAATGTGGTTAAGAAGAATGTCCTTGGCAGCAAGCGAGCAGCCCATAAAAAAGCCGAGCCAGCCAGCGCCCCCAAGAAGATGACCGAACCTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAAAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCaaaaacaaaaaaaaaaaaaaaGGGCGCCGCTCG
  5  -1   2       bld Sp1                    IMAGE:4964576-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACTTCCCAACCACGTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGGCCATTAGGTGCCAAGCGGATCGGATCGACAGGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGA
  5   1   2       bld Ga15      out                      XL422o09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACTTCCCAACCACCTAGTGATGGCAAGATGGATGACATCATGAAAGAGCTTCGATCAATGAAAGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCACTGCCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCaaaaacaaaaaaacaaaaaaaaaaCAGTCCACTCCCTTTATTTCATTGAGACTTTCCAAATACCCCTCCAACCAGGNGCCTCTCTTAAAACCCTAATTGNGCCACTTCAAGTATTGCTTGAGAGTCCAACTACTGAGGNGTCGTAATCTACATTTCAGCTTGTATTTTCTTTCTTAAGCAAGACTCGTATTCCaaaagaaaaaaaTGTAACCAACGTTCCTCCCCCCGCCCTTACNTTAAAAGCCAAGtttttttttttttNNCCT
  5   1   2       bld Brn1      out                   IMAGE:4740177.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAGACCATTAGGTGCCAAGCGGATCGGATCGACAAGCTAGAAGAATTAGTTGCCAGTCTCACCATCAATGATGAGTCAGAAGAATGAGCAGTCCATACTTCTCACTGAGCTGGAGGATCCCATTGGCAGATCAGATTCCACCCATCACATTCCTCCAGGCCCAAATGATCAGCATTCCaaaaacaaaaaaaCAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)