Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL446i18ex.3                        152 END     2           2        1                (no blast hit)
     2   1.0    0Xl3.1-IMAGE:6869655.5                     103 END     2           2        1                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:6869655.5                     103 PI      93          8     1854                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012837331 Xl3.1-IMAGE:6859775.5.5 - 67 ESTs
                                                                       .......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6859775.5.5                                                                                                            TTTTCCTTCACCGGGGTCATTGGTCCGGCCCTGTTTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGAATTGCACAGCGTCTGAAAGAAGCACAGAACACATGCGCCATGCTGACAACTTTCAATGAAGTTGATATGAGTAACATTCAGCAGATGAGATCCATACACAAAGACGCCTTCCTGAAGAAACATGGTGGCTTGAAATTAGGATTCATGGTCTTTGTTAAAGCTTCAGCCTTTGCTCTGCAGGATCAGCCAGCTGTCAATGCAGTGATCGATGATACAACCAAGGAGATTGTGTACAGAGACTATATAGATATCAGTGTGGCGGTGTCTACCCCCCGGGGTCTTGTAGTTCCTGTGCTGAGAAATGTGGAATCTATGAACTTTGCAAATATAAGAGGACAATTAACCGAGCTAGGGGAAAAGGCTCGGAAGAATGAACTGGCTATAGAAGATATGGATGGAGGGACCTTCACAATTAGTAACGGTGGGGTGTTTGGCTCCATGTTCGGGACACCGATCATTAATCCCCCACAGTCTGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATTGCCATTGTATGGAGCTAACTACAATATTTAATTATATTGATTTTAAATGTTAAATAAATTCTATAAAAAGTTAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012721271                                                                                                                  TTCACCGGGGTCATTGGTCCGGCCCTGTTTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGAATTGCACAGCGTCTGAAAGAAGCACAGAACACATGCGCCATGCTGACAACTTTCAATGAAGTTGATATGAGTAACATTCAGCAGATGAGATCCATACACAAAGACGCCTTCCTGAAGAAAxAxxxxGGCTTGAAATTAGGATTCxxxGxCTTTGTTAAAGCTTCAGCCTTTGCTCTGCAGGATCAGCCAGCTGTCAATGCAGTGATCGATGATACAACCAAGGAGATTGTGTACAGAGACTATATAGATATCAGTGTGGCGGTGTCTACCCCCCGGGGTCTTGTAGTTxxxGxxxTxxxxAATGTGGAATCTATGAACTTTGCAAxxxxxAGAGGAxxAxTxACCGAGCTAGGGGAAAAGGCTCGGAAGAATGAACTGGCTATAGAAGATATGGATGGAGGGACCTTCACAATTAGTAACGGTGGGGTGTTTGGCTCCATGTTCGGGACACCGATCATTAATCCCCCACAGTCTGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATTGCCATTGTATGGAGCTAACTACAATATTTAATTxxxTxxxTTTxAAATGTTAAATAAATTCTATTAAAAGTTAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                 4     4     4     5     7     9     9    10    11    13    15    16    21    22    24    26    25    29    28    32    29    32    30    33    31    34    33    35    35    36    35    36    35    36    35    36    35    36    35    36    35    36    35    36    35    36    36    36    36    36    36    36    36    36    36    36    36    36    36    36    36    36    36    36    36    36    35    36    36    36    37    37    37    37    37    37    36    37    35    36    34    36    34    36    33    36    32    36    30    36    29    35    29    34    30    35    27    33    29    34    29    33    28    32    27    32    25    29    25    29    23    29    22    28    20    27    20    27    18    25    16    22    13    21    13    21    10    19     9    18     8    18     9    17     9    16     5    14     5    14     4    12     4    11     3    10     2     8     2     7     3     6     2     4     2     4     2     4     2     4     3     5     2     4     3     4     2     5     2     5     2     4     2     4     2     4     3     6     3     6     3     7     4     8     5     8     5     8     6     9     6     9     7    10     7    10     7    10     9    12     9    12    10    13    10    14    13    16    16    17    16    18    18    19    17    18    16    18    18    19    16    19    16    19    18    19    18    19    18    19    17    19    18    19    17    19    19    19    21    21    21    21    21    21    20    21    22    24    23    24    23    24    24    24    24    24    25    26    26    26    25    26    25    26    25    26    25    26    24    26    23    24    21    24    21    24    21    24    20    24    21    24    21    24    21    23    21    23    16    22    17    22    18    21    17    21    17    21    11    21     9    17     7    16     6    14     6    13     4    10     4     5
  5   1   2      ests                            Xl3.1-IMAGE:6859775.5                                                                                                            TTTTCCTTCACCGGGGTCATTGGTCCGGCCCTGTTTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGAATTGCACAGCGTCTGAAAGAAGCACAGAACACATGCGCCATGCTGACAACTTTCAATGAAGTTGATATGAGTAACATTCAGCAGATGAGATCCATACACAAAGACGCCTTCCTGAAGAAACATGGTGGCTTGAAATTAGGATTCATGGTCTTTGTTAAAGCTTCAGCCTTTGCTCTGCAGGATCAGCCAGCTGTCAATGCAGTGATCGAT
  5   1   2      ests                                 Xl3.1-xl290l07.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTGCTGAGAAATGTGGAATCTATGAACTTTGCAATATAGAGAGGACCAATTACCGAGCTAGGGGAAAAGGCTCGGAAGAATGAACTGGCTATAGAAGATATGGATGGAGGGACCTTCACAATTAGTAACGGTGGGGTGTTTGGCTCCATGTTCGGGACACCGATCATTAATCCCCCACAGTCTGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATTGCCATTGTATGGAGCTAACTACAATATTTAATTAATTGATTTTAAAATGTTAAATAAATTCTATTAAAAATTAAAAAAAAAAAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------C-A
                                               BLH ATG      66     790                                                                                                            
                                               BLH MIN      60     224                                                                                                            
                                               BLH OVR      66      34                                                                                                            
                                               EST CLI      55      17                                                                                                            
                                               ORF LNG      66       1                                                                                                            
  5   1   2      ests                            Xl3.1-IMAGE:6859775.5                                                                                                            TTTTCCTTCACCGGGGTCATTGGTCCGGCCCTGTTTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGAATTGCACAGCGTCTGAAAGAAGCACAGAACACATGCGCCATGCTGACAACTTTCAATGAAGTTGATATGAGTAACATTCAGCAGATGAGATCCATACACAAAGACGCCTTCCTGAAGAAACATGGTGGCTTGAAATTAGGATTCATGGTCTTTGTTAAAGCTTCAGCCTTTGCTCTGCAGGATCAGCCAGCTGTCAATGCAGTGATCGAT
                                                  Xl3.1-CHK-1012687224                                                                                                                  TTCACCGGGGTCATTGGTCCGGCCCTGTTTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGAATTGCACAGCGTCTGAAAGAAGCACAGAACACATGCGCCATGCTGACAACTTTCAATGAAGTTGATATGAGTAACATTCAGCAGATGAGATCCATACACAAAGACGCCTTCCTGAAGAAAxAxxxxGGCTTGAAATTAGGATTCxxxGxCTTTGTTAAAGCTTCAGCCTTTGCTCTGCAGGATCAGCCAGCTGTCAATGCAGTGATCGATGATACA
  5   1   2       bld Gas9 5g                              BG409927.5p gnnnncctttttganaanctgctacttgttctttttgcaggatcccatcgattcgaattcgtcgacccacgcgtccgcggacgcgtgggcggaAGTGACGATTCTCGTTTTCCTTCACCGGGGTCATTGGTCCGGCCCTGTTTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCAAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGTTCCTCATCTGGGCCCATTCCTACTGTCA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048884.5p                                                                        ACCCACGCGTCCGCCCACGCGTCCGGACGATTCTCGTTTTCCTTCACCGGGGTCATTGGTCCGGCCCTGTTTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAAATGTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATC
  5   1   2       bld Oo1  5g                         IMAGE:6859775.5p                                                                                                  ACGATTCTCGTTTTCCTTCACCGGGGTCATTGGTCCGGCCCTGTTTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGAATTGCACAGCGTCTGAAAGAAGCACAGAACACATGCGCCATGCTGACAACTTTCCATGAAGTTGATATGAGTAACCATTCACCAGATGAGATCCATACCCCAAAGACGCCCTTCCTG
  5   1   2       bld Oo1  5g                         IMAGE:6639931.5p                                                                                                    GATTCTCGTTTTCCTTCACCGGGGTCATTGGTCCGGCCCTGTTTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCNGTCAAGAATTGCACAGCGTCCTGAAGAAGCACAGGACACATGGCGCATGCTGACAACTTTTCATGAAGGTGAATATGGAGTAACATTCANGCCGATGAGAATCCCNTACCCCAAGAACGCCCTTTCCTGAAAGAAAACATGGGCTTGGGAAATTAA
  5   1   2       bld Em10      in                    IMAGE:7980456.5p                                                                                                                      CGGGGTCATTGGTCCGGCCCTGTTGTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATATG
  5   1   2       bld Egg5 5g                         IMAGE:3430702.5p                                                                                                                            TCATTGGTCCGGCCCTGTTTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGATGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAATGTGGAGCTGCTCCTTCTAAGGCTCAGTCAGCTGAGACAGGTGCGGCTTCACCTGCT
  5   1   2       bld Egg5 5g3  in                    IMAGE:3431906.5p                                                                                                                               TCTTGGTCCGGCCCTGTTTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTGTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACT
  5   1   2       bld Tail 5g3  out                   IMAGE:8541629.5p                                                                                                                                  GTCCGGCCCTGTTTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTT
  5   1   2       bld Em10 5g                         IMAGE:8321197.5p                                                                                                                                    CCGGCCCTGTTTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCA
  5   1   2       bld Emb4 5g                         IMAGE:5542668.5p                                                                                                                                         CCTGTTTCCGGCTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACCAGCCCTCTGGAGTCCAAACCCTGGTGTCTGCAGTAAAGCCATCTTCTGCTTCCCTTTGGTGGCTGATGCTACCCAGCCTACNAGTGCGCGATCAGAGCATATAGGGTGAAGATGGACCGGGATGCGGTCAAAGAAATTGCACAAGCGTCTGGAAAGAAGCACAGAACACATGGCGCCATGCTGACNACTTTTCCATGGAAGTTGGATATGGAGTTACCCTTCAGGCAGGATGAAGATTCCTTACACCAAAGGACGC
  5   1   2       bld He1  5g3  in                    IMAGE:4407267.5p                                                                                                                                                    CTTGTCCTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCAAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCA
  5   1   2       bld Brn3 5g                         IMAGE:8539259.5p                                                                                                                                                          CTTGAGCTGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATANGGTGAAGATGAACCGGATGCGTCNAAGAATGCACAGCGTCTGAAAGAGCACAGACACATGCGCATGCTGACA
  5   1   2       bld Egg1 5g                            PBX0148H04.5p                                                                                                                                                           CACGAGGGTGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCAAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCT
  5   1   2       bld Emb4 5g                         IMAGE:4971083.5p                                                                                                                                                                   TGTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGAATGCACAGCGTCTGAAAGAGCACAGACACATGCGCCATGCTGACACTTTCATGAGTTGATTGAGTACATTCGCGATGAGATCATACCAGACGCTTCTGAGAACATGC
  5   1   2       bld DMZ  5g3  in                         xl246n03.5p                                                                                                                                                                    GTCCGCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTANAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATC
  5   1   2       bld Emb4 5g                         IMAGE:4680018.5p                                                                                                                                                                        GCAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCT
  5   1   2      seed Em10 5g                         IMAGE:8322350.5p                                                                                                                                                                         CAGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAA
  5   1   2       bld Oo1  5g                         IMAGE:6638146.5p                                                                                                                                                                          AGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCAAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGACAAAGAATTGCACAGCGTCTGAAAGAAGCACAGAACACATGCGCCATGCTGACAACTTTCAATGAAGTTGATATGAGTAACATTCAGCAGATGAGATCCATACACAAAGACGCCCTTCCTGAAGGAACATGGCTTTGAAATTAAGGATTCATGGTCAGCC
  5   1   2       bld Oo1  5g                         IMAGE:6642555.5p                                                                                                                                                                          AGCCATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCAAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGGTGAAGATGAACCGGATGCGACAAAGAATTGCACAGCGTCTGAAAGAAGCACAGAACACATGCGCCATGCTGANCACTTTCAATGAAGTTGATATGAGTAACATTCAAGCAGATGAGATCCATACACAAAGACGCCTTCCTGAAAGAACATGGGCTTGAAATTAGGATTCATGGTCAGCCCTTTGTTAAAGCTTCAGCCTTTTGCTCTGCAGGATCAGCCAGCTGGGTCAATGGCAGTGC
  5   1   2       bld Ov1  5g                         IMAGE:6316904.5p                                                                                                                                                                             CATGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTNCCTCATCTGGGCCCATTCCTACTGTCATCCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGGTGTCTGCAGTAAAGCCATCTTCTGGCTTCCATTGTGGCTGATGCTAACCAGCCTACAAGTGGCGCGATCCGAACATAGGGTGGAAGATGAACCCGGATGGCGTCCAAGAATTTGGCCCGGCGTCTGGAAAGAAAGCCCGGAAACCCATTGGCCCCCATGGCTGGCCAAACATTTTCAATGGGAAGGTT
  5   1   2       bld Ov1                             IMAGE:8332252.5p                                                                                                                                                                               TGCTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCCAAA
  5   1   2       bld Tbd7      in                         XL055k06.5p                                                                                                                                                                                 CTGTCCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCC
  5   1   2       bld Ga12      in                         XL208c16.5p                                                                                                                                                                                     CCCGTTGCCTTACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCAAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAG
  5   1   2       bld Te2N                            IMAGE:7204718.5p                                                                                                                                                                                        TTCCCGCGAATTTTCCCGGGTATCTTTGACTGCACNTTAGACGAGGGCCCTGTGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTAGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGAATTGCACAGCGTCTGAAAGAAGCACAGAACACATGCGCCATGCTGANCACTTTCAATGAAGTTGATATGAGTAACATTCAGCAGATGAGATCCATACACAAAGACGCCTTCCTGAAGGAACCATGGCTGAAATTAGGATTCATGTCAGCCTTTGTTAAAGCTTCAGCCTTTGCTCTGCAGGATCAACCAGCTGTCAATGCAGTGATCGATGAACAACCCAAGGAAATTGGGTACGAAAACTATTAAAAATTTCAGGGGGGCGGGGTTT
  5   1   2       bld Egg3                            IMAGE:3378731.5p                                                                                                                                                                                            CTTTACCCGGTCCCTACGTCGGCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGGTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTGCCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTGTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAGACCAGCTGAGACTGTGGCAACTCCATCTGCTCAAGTACCTGGACCTGCTCCAGCTTCTGACTGCTCATGTGTGCCCATTCCTACTGTGATGCGACCGGTGCCTTCTGTATCTCAC
  5   1   2       bld Neu7      in                         XL026h03.5p                                                                                                                                                                                               TACCCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTT
  5   1   2       bld Em10                            IMAGE:8319948.5p                                                                                                                                                                                                  CCGGTCCCTACGTCGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACTGGATGCGTCAAAGATTGCACAGCGTCTGAAAGAGCACAGACACATGCGCATGCTGACACTTTCATGAAGTGATTGAGTACATCAGCAATGAATCCTACACAGACGCTTCCTGAGACATGCTGAATTAGA
  5   1   2       bld Emb4      in                    IMAGE:4202872.5p                                                                                                                                                                                                     CACGCGTCCGCCCACGCGTCCGGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCAAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTTTGCT
  5   1   2       bld Em10                            IMAGE:8321324.5p                                                                                                                                                                                                         TACGTCGCCCTTTGACTGCACTTATGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAAGCCATCTTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGGATGCGTCAAAGATTTGCACAGCGTCTGAAAGAAGCACAGAAACACATGCGC
  5   1   2       bld FaBN                            IMAGE:8076408.5p                                                                                                                                                                                                               CGCCCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGAATTGCACAGCGTCTGAAAGAAGCACAGAACACATGCGCCATGCTGACAACTTTCAATGAA
  5   1   2       bld Em10                            IMAGE:8317511.5p                                                                                                                                                                                                                   CTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGAATTGCACAGCGT
  5   1   2       bld FaBN                            IMAGE:8077791.5p                                                                                                                                                                                                                       CCTTTGACTGCACTTAGACGGGGCCCTGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGATTGCACAGCGTCTGAAAGAACACAGACACATGCGCATGCTGNACACTTCATGAAGTGATTGAGTACATCAGCAATGGATCATACCAAGACGCTTCTG
  5   1   2       bld DMZ       in                         xl243e19.5p                                                                                                                                                                                                                                            TGGTGAGACACAGAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCNCCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGNCAGGATGCANNTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCNGGTGGGAAAAGGCTGNTGGTGACACTGTCTCTGANGATGAAGNGGTTTGTGAGANTGAAACTGATAAGACCTCATTTCANGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTTCTAAGGNNAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGA
  5   1   2       bld DMZ       in                         xl290l07.5p                                                                                                                                                                                                                                                   CACAGAAGTCGCCCTCTTGTTGAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGAATTGCACAGCGTCTGAAAGAAGCACAGAACACATGCGCCATGCTGACAACTTTCATGAAGTTGATATGAGTAACATTCAG
  5   1   2       bld Emb9                            IMAGE:7977104.5p                                                                                                                                                                                                                                                                        GAGATATCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGAATTGCACAGCGTCTGAAAGAAGCACAGAACACATGCGCCATGCTGACAACTTTCAATGAAAGTTGATATGAGTAACATTCAGCAGATGAGATCCATACACAAAGACGCCTTTCCTGAAGAAACATGGGCTTGAAATTAGGATTCATGTCAGCCTTTTGTTAAAGCTTCAGCCCTTTGCTTCTGCAGG
  5   1   2       bld Neu7      in                         XL040f17.5p                                                                                                                                                                                                                                                                              TCTGGGTGCTGTATATCACCAGCAACTGACTACAAGCCCAGAGTATCTAGCTTTGTTTTGAGCCAAGTCCGATTCTACAGAACCTCTCTTGTCTACCGGCAGGATGCAGTTACTGTTAATACTCCAGCATTTGCAGAGTCTGTAACGGAAGGAGATGTCAGGTGGGAAAAGGCTGTTGGTGACACTGTCTCTGAGGATGAAGTGGTTTGTGAGATTGAAACTGATAAGACCTCAGTTCAGGTACCATCCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCAAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCT
  5   1   2       bld Tbd7      in                         XL066n10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCATCTGCAGGGGTAATTGAGGCTCTTCTTGTCCCAGATGGAGGAAAAGTTGAAGGTGGAACGCCACTTTTTGTGCTGAGAAAGTCTGGAGCTGCTCCTTCTAAGGCCAAACCAGCTGAGACTGTGGCAACTCCACCTGCTCAAGTACCTCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCTATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGAATTGCACAGCGTCTGAAAGAAGCACAGAACACATGCGCCATGCTGACAACTTTCAATGAAGTTGATATGAGTAACATTCAGCAGATGAGATCCATACACAAAGACGCCTTCCTGAAGAAACATGGTTTGAAACTAGGATTCATGTCAGCCTTTGTTAAAGCTTCAGCCTTTGCTCTGCAGGATCAGCCAGCTGTCAATGCAGTGATCGATGATACAACCAAGGAGATTGTGTACAGAGACTATATAGATATCAGTGTGGCGGTGTCTACCCCCCGGGGTCTTGTAGTTCCTGTGCTGAG
  5   1   2       bld He1                             IMAGE:4407722.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAACCTGCTCCACCTTCTGCTCCCTCATCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCAGCCTACAAGTGCGCGATCAGAGCATAGGGTGAAGATGAACCGGATGCGTCAAAGAATTGCACAGCGTCTGAAAGAAGCACAGAACACATGCGCCATGCTGACAACTTTCAATGAAGTTGATATGAGTAACATTCAGCAGATGAGATCCATACACAAAGACGCCTTCCTGAAGAAACATGGCTTGAAATTAGGA
  5   1   2       bld Ga15                               XL510b02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTGGGCCCATTCCTACTGTCATCCCACCGGTGCCTCCTGTATCTACACAGCCTCTGGAGTCCAAACCTGTGTCTGCAGTAAAGCCATCTTCTGCTTCCATTGTGGCTGATGCTACCCANCCTACAAGTGCGCGATCANAGCATANGGTGAANATGAACCGGATGCGTCAAANAATTGCACANCGTCTGAAAGAANCACANAACACATGCNCCATGCTGACAACTTTCAATGAA
  5   1   2      ests                                 Xl3.1-xl290l07.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTGCTGAGAAATGTGGAATCTATGAACTTTGCAATATAGAGAGGACCAATTACCGAGCTAGGGGAAAAGGCTCGGAAGAATGAACTGGCTATAGAAGATATGGATGGAGGGACCTTCACAATTAGTAACGGTGGGGTGTTTGGCTCCATGTTCGGGACACCGATCATTAATCCCCCACAGTCTGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATTGCCATTGTATGGAGCTAACTACAATATTTAATTAATTGATTTTAAAATGTTAAATAAATTCTATTAAAAATTAAAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012688335                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAGAAATGTGGAATCTATGAACTTTGCAAxxxxxxGAGGACxAxTxxCCGAGCTAGGGGAAAAGGCTCGGAAGAATGAACTGGCTATAGAAGATATGGATGGAGGGACCTTCACAATTAGTAACGGTGGGGTGTTTGGCTCCATGTTCGGGACACCGATCATTAATCCCCCACAGTCTGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATTGCCATTGTATGGAGCTAACTACAATATTTAATTAxxTxxxTTTxAAATGTTAAATAAATTCTATTAAAAAxTxxxxAAAAAAAAAAAA
  3   1   2       bld Emb9      out                   IMAGE:7976580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGTAAATATATCTAAAACTTAGAAAGTAATAAATATACTTATACTCCCTCTATGATTCAATTATGATTATGTGACACCAGGTGGTATGTATATAGAATTGAAGGGGTTTACCCAGGGTTGTGTCCTAGGTGAAATAGATTTATGAACTTGCAATATAGGGGAAATTAACAAGTGGGATAAGCTGGAGGATGAACTGCATTCGAAGTATGATGAGAGACCTTCACAATAGAAACGGTGAGGGTTTGGTCCATGTTTGGGACACCGATTCATTAATCCCCCACAGTCTGCTATACTTGGGAATGCACGGCATATTTGATAGTCCCGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACTTATGATCACAGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGAGTCCTCAATGGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATGCCATTGTATGGAGCTAACTACAATATTA
  5   1   2       bld Emb4                            IMAGE:5572111.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAATGCAGTGATCGATGATACAACCAAGGAGATTGTGTACAGAGACTATATAGATATCAGTGTGGCGGTGTCTACCCCCCGGGGTCTTGTAGTTCCTGTGCTGAGAAATGTGGAATCTATGAACTTTGCAAATATAGAGAGGACAATTACCGAGCTAGGGGAAAAGGCTCGGAAGAATGAACTGGCTATAGAAGATATGGATGGAGGGACCTTCACAATTAGTAACGGTGGGGTGTTTGGCTCCATGTTCGGGACACCGATCATTAATCCCCCACAGTCTGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCCAATAGTGTCCTCAATGGGGCAAGGCTGGCACACCCTCAANTTTGGGGGGCAGACACTGGCTCCCATTTTTGGTTTGGCCCCGAAAA
  5  -1   2       bld Egg3                            IMAGE:6870556.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACGGGTGGGCCGGTGTCCTAACCCCCCCGGGGGTTCTTGTTAGTCTCCCTGTGCCTGAGACAATGTGGAATCTTATGAACCTTCCCCAAATATAGAGAGGACAATTTACCGAGCTAGGGGAAAAGGCTCGGAAGAATGAACTGGCTATAGAAGATATGGATGGAGGGACCTTCACAATTAGTAACGGTGGGGTGTTTGGCTCCATGTTTGGGACACCGATCATTAATCCCCCACAGTCTGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATTGCCATTGTATGGAGCTAACTACAATATTTAATTATATTGATTTTAAATGTTAAATAAATTCTATTAAAAAGTTTCCCGTaaaaaaaaaaaaaaaCCGGGG
  5  -1   0       chi Te2N                            IMAGE:7205107.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCttttttttttttttttttttttttGGCTTCATGTGCGTTTATTATGACACAACTCTACCCTCTACCTTTTCTTGCAGGCTCGGAAGAATGAACTGGCTATAGAAGATATGGATGGAGGGACCTTCACAATTAGTAACGGTGGGGTGTTTGGCTCCATGTTTGGGACACCGATCATTAATCCCCCACAGTCTGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTCTCAGTGAGCAGAGAAATGGCAGCAGAAGAGTATCTGGAAAAGGAACCTGCATGTAAGCGTTAACTCCAGAACTTAAACTGTCAAAGAGAGACTGTCCAGTTAGCATCTCATACAGCAGGACTCCCAGAATCCACCAATTGCAGGCTTCATTCACTGTGCCCACTCCCAGGACCTAGTTTAGGCTGTGTTCTTGTTCGGGTGTCTATGGTGGTATGGGACATGCAGTTCTGCAGGTTTTTCAACTCAATGTCAAAATTCTTTTCTTCCAGATACTGATCCCACTCCAGATCGAAGACATCGTTGACATCCTGAACTGCATTATTTACATATTGGTTTAGTCCACTAATCTCCTCTGTTGTTTCCTTAATCTCCAGACAGAAGGAGAGAAGGCTTTCAGACTCTACCCTCAGCTGTCTCTTTTCCTCCTCGCTGCAAACTTGGAGACAAACTTTGCTATTCCAGGCTTTCAGATCATCCAGTTCCTTTTGCAAATCTGCAATTTGTATCACAGC
  5  -1   2       add Brn2                             Brn2-zb03c05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTGCTGAGAAATGTGGAATCTATGAACTTTGCAAATATAGAGAGGACAATTACCGAGCTAGGGGAAAAGGCTCGGAAGAATGAACTGGCTATAGAAGATATGGATGGAGGGACCTTCACAATTAGTAACGGTGGGGTGTTTGGCTCCATGTTCGGGACACCGATCATTAATCCCCCACAGTCTGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGGAGCTGTCCTGTTCTTGCGCAAGATCAAATaaaaaaaaaCACATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATT
  3   1   2      seed DMZ       in                         xl290l07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGCTGAGAAATGTGGAATCTATGAACTTTGCAAATATAGAGAGGACAATTACCGAGCTAGGGGAAAAGGCTCGGAAGAATGAACTGGCTATAGAAGATATGGATGGAGGGACCTTCACAATTAGTAACGGTGGGGTGTTTGGCTCCATGTTCGGGACACCGATCATTAATCCCCCACAGTCTGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATTGCCATTGTATGGAGCTAACTACAATA
  3   1   2       bld DMZ       in                         xl243e19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGAGAAATGTGGAATCTATGAACTTTGCAAATATAGAGAGGACAATTACCGAGCTAGGGGAAAAGGCTCGGAAGAATGAACTGGCTATAGAAGATATGGATGGAGGGACCTTCACAATTAGTAACGGTGGGGTGTTTGGCTCCATGTTCGGGACACCGATCATTAATCCCCCACAGTCTGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGNTNTGGCTGCTGGATTTGTGAGGTTCNTCCCGTTCACAAGGACTTTTTCATTANGTACCATCTCCCTANTTTTANGNTTNNNNANGTGATACAACTGGGACCGCACAACTACCCCTCNAGAATCCAGGNGGTGGANGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGNTGGCACACCTCAGTTTGGGNGCAGACACTNNTCCATTTTNGTTTGCCCTGAGAGATGGGTGATTTTGACCTCNCCCTCACAAGCCGCTTCTTCTNGCCAATAANGAGGGTGTATACACTTTACTGCTGGCACCNTGCTANATCGCCATTGTATGGAGCTAACTACAATATTTAATTATATNGATTNAAAT
  3   1   2       chi Em10      in                    IMAGE:7980456.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTATTGAACGTTGCAAATATAGAGAGGACAATTACCGAGCTAGGGGAAAAGGCTCGGAAGAATGAACTGGCTATAGAAGATATGGATGGAGGGACGTTCACAATTAGTAACGGTGGGGTGTTTGGCTGCCATGTTCGGGACACCGATCATTAATCCCACACAGTATGCTATACTGTGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCATGACCTATGATCACCGTCTTATTGATGGCAGAGAAGCTGTCCTGTTCGTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTAGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAATTGAAGCATGTATGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTATAGCCATTATTGAGGGCGTAAACAAGGGTGTATACGCACCATGGTAGGCACCCTGCTATATTGCCAAGTACGGAGCTAAATACTAATGATTAAAAATGTTGATTAAATCGTTAAATAAGTAG
  3   1   2       bld DMZ  5g3  in                         xl246n03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAATATAGAGAGGACAATTACCCGAGCTAGGGGAAAAGGCTCGGAAGAATGAACTGGCTATAGAAGATATGGATGGAGGGACNTTCACAATTAGTAACGGTGGGGTGTTTGGCTCCATGTTCGGGACACCGATCATTAATCCCCCACAGTCTGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGANGTATATAGCCCTGACCTATGATCACCGTCTNATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCNGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTNTATGTTTCTTTATGNGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTNNTAGCCAATAATGAGGGNGTATACACTTTACTGCTGGCACCTTGCTATATTGCCATTGTATGGAGCTAACTACAATATT
  3   1   2       bld Tbd7      in                         XL066n10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGAAGATATGGATGGAGGGACCTTCACAATTAGTAATGGTGGGGTGTTTGGCTCCATGTTCGGGACACCGATCATTAATCCCCCACAGTCCGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGGGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATGCCATTGTAGGAGCAACTACAA
  3   1   2       bld Neu7      in                         XL026h03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGGTGTTTGGCTCCATGTTCGGGACACCGATCATTAATCCCCCACAGTCTGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATTGCCATTGTATGGAGCTAACTACAATATTTAATTATATNATTTTAAATGTCAAATAAATTCTATTAAAAAGTTTCCC
  3   1   2       bld Oo1                             IMAGE:3403720.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGTTTGGCTCTATGTTTGGACACGATCCATAAATCCCCCACAGTCCGGCATTTTGGGGAATGCACGGCATATTTGATCGTCTTGTGGCTGTGTGGGGCAAGGTGCAGATCCGTCTTATGATGTATATAGCCCTGACTTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCCCCTTGCTATATTGCCATTGTATGGAGCTAACTACAATATTTAATTATATTGATTTTAAATGTTAAATAAATTCTATTAAAAAGAAAAAAAAAAA
  3   1   2       bld Tbd7      in                         XL055k06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGACACCGATCATTAATCCCCCACAGTCTGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACCTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATTGCCATTGTATGGAGCTAACTAC
  3   1   2       bld Neu7      in                         XL040f17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTAATCCCCCACAGTCCGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATGCCATTGTATGGAGCTAACTACAATATTTAATTATATNATTTTAAATGTTAAATAAATTCTATTAAAAA
  5   1   2       bld Ooc2      out                   IMAGE:3747052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGTCCGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTGTCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCT
  5   1   2       bld Ooc2      out                   IMAGE:3746693.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCTATCTTGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCG
  5   1   2       bld Emb4      in                    IMAGE:4201791.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGGAATGCACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTA
  3   1   2       bld Ga12      in                         XL208c16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACGGCATATTTGATCGTCCTGTGGCTGTGTCGGGCAAGGTGGAGATCCGTCCTATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATGCCATTGTATGGAGCTAACTACAATATTTAATTATATTGATTTTAAATGTAAAA
  3   1   2       bld Emb4      in                    IMAGE:4201791.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGGCTGTGTCGGGCAAGGTGGAGATCCGTCNTATGATGTATATAGCCNTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGAGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATGCCATTGTATGGAGCTAACTACAATATTTAATTATATTGATTTTAAATGTTAAATAAATTCTATTAAAAAGTTAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5048884.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGATGTATATAGCCCTGACCTATGATCACCGTCTTATCGATGGCAGAGAAGCTGTCCTGTTCTTGCGCAAGATCAAATCTGCAGTAGAAGATCCCCGTGTTTTGCTGCTGGATTTGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATTGCCATTGTATGGAGCTAACTACAATATTTAATTATATTGATTTTAAATGTTAAATAAATTCTATTAAAAAGTTTCCCTTTTAAA
  3   1   2       bld Egg5 5g3  in                    IMAGE:3431906.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTGAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGAGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATGCCATTGTATGGAGCTAACTACAATATTTAATTATATTGATTTTAAATG
  3   1   2       bld Emb4      in                    IMAGE:4202872.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGGTTCTTCCCGTTCACAAGGACTTTTTCATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATGCCATTGTATGGAGCTAACTACAATATTTAATTATATTGATTTTAAATGTTAAATAAATTCTATTAAAAAGTTAAAAAAAAAAAAAAAA
  3   1   2       bld He1  5g3  in                    IMAGE:4407267.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTATGTACCATCTCCCTATTTTTATGTTTCTTTATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATTGCCATTGTATGGAGCTAACTACAATATTTAATTATATTGATTTTAAATGTTAAATAAATTCTATTAAAAAGTAAA
  5  -1   2       bld Egg1                               PBX0011D11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAATCtttttttttttttttttATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATTGCCATTGTATGGAGCTAACTACAATATTTAATTATATTGATTTTAAATGTTAAATAAATTCTATTAAAAAGTTTCCC
  5  -1   2       bld Int2                            IMAGE:8527270.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCttttttttttttttttATGTGATACAACTGGGACCGCACAACTACCCCTCTAGAATCCAGGTGGTGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTTTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTTTTTTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATTGCCATTGTATGGAGCTAACTACAATATTTAATTATATTGATTTTAAATGTTAAATAAATTCTATTAAAAAGTTTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Neu7                                 XL022m01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTTTATGTTTCNTTATGTGATACAACTGGGACCGCACNNCTACCCCTCTAGAATCCAGGTGGTGGATGNCAGTGTATTTTAAAGACNTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGTGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACNGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACNACCCGCTTCTTCNTAGCCAANAATNAGGGTGTATACACT
  5   1   2       bld Emb4                            IMAGE:5542325.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGAGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATGCCATTGTATGGAGCTAACTACAATATTTAATTATATTGATTTTAAATGTTAAATAAATTCTATTAAAAAGTTaaaaaaaaaaaaaaaG
  5   1   2       bld Emb4                            IMAGE:5542349.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGATGCCAGTGTATTTTAAAGACTTTAAAGTATCCCTAGCAAAGTCCTTCTCTCTTCCCTGTGAAACTGAAGCATGTCTGCAAGTAGAGTCCTCAATGGGCAAGGCTGGCACACCTCAGTTTGGGTGCAGACACTGCTCCATTTTTGTTTGCCCTGAGAGATGGGTGATTTTGACCTCACCCTCACAAGCCGCTTCTTCTAGCCAATAATGAGGGTGTATACACTTTACTGCTGGCACCTTGCTATATGCCATTGTATGGAGCTAACTACAATATTTAATTATATTGATTTTAAATGTTAAATAAATTCTATTAAAAAGTTaaaaaaaaaaaaaaaG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)