Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xlk77g21ex.3                         39 PI      85       1708     2291                (no blast hit)
     2   0.0    0Xl3.1-XL450l07ex.5                          9 PI      91         12      908                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012837346 Xl3.1-IMAGE:6956293.3.5 - 66 ESTs
                                                                       .-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6956293.3.5                                                                                  AATTAGTTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTTCCCCGATTCCAGATCCTCTCTCTGCTGTGACTAATCCCTGCATGCAGAGGTCAACTGGCTACCCAATGACCTATAGTCAGGCCCCCTGCTATACTCAGAGCTATGGAGGATCTTCATCTTATTTCACAGGGCTGGACTGTGGATCCTATCTGTCTCCTATGCACCCACAACTCTCTGCTCCTGGTGCCACCTTGAGCCCAATTGCCACACCTACAATGGGTAGCCACCTCAGCCAATCTCCGGCATCCCTTTCTGCCCAGGGATATGGAGCTGCCAGTCTTGGCTTCACCTCAGTGGATTGCTTAGACTACAAGGACCAAACTGCTTCATGGAAGCTTAATTTCAATGCCACTGACTGCCTTGATTATAAAGACCAGAGCTCATGGAAATTTCAAGTCTTGTAAATCTGATCAAGTCAAAGCCTCATTTTCAGCATCCTTCACTTCAGCATCAACTGTGCTTCATATTCCAGCTCTAAGAGTGTCTGGATTGGAAATCTAATAATGGAACAAACACAAAAACATTTATAACTTTATGGCCTTTTGCCATTTAATCTTTTAGAACAAATTGCATGTACAACTCAACAGTTTGAACCTACACAATGTAATTTCTTCTAAAAACTCAGCACACAAAGTTAATTTACTCATTTCCATTATTAAAAACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCACTTTGGATTGAGGCTATGATAACACAGTCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATATAAATGTGCAAAATATTAAAATTATTGTGTTAAACCA
                                                  Xl3.1-CHK-1012721730                                                                                        TTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTTCCCCGATTCCAGATCCTCTCTCTGCTGTGACTAATCCCTGCATGCAGAGGTCAACTGGCTACCCAATGACCTATAGTCAGGCCCCxxxxTATACTCAGAGCTATGGAGGATCTTCATCTTATTTCACAGGGCTGGACTGTGGATCCTATCTGTCTCCTATGCACCCACAACTCTCTGCTCCTGGTGCCACCTTGAGCCCAATTGCCACACCTACAATGGGTAGCCACCTCAGCCAATCTCCGGCATCCCTTTCTGCCCAGGGATATGGAGCTGCCAGTCTTGGCTTCACCTCAGTGGATTGCTTAGACTACAAGGACCAAACTGCTTCATGGAAGCTTAATTTCAATGCCACTGACTGCCTTGATTATAAAGACCAGAGCTCATGGAAATTTCAAGTCTTGTAAATCTGATCAAGTCAAAGCCTCATTTTCAGCATCCTTCACTTCAGCATCAACTGTGCTTCATATTCCAGCTCTAAGAGTGTCTGGATTGGAAATCTAATAATGGAACAAACACAAAAACATTTATAACTTTATGGCCTTTTGCCATTTAATCTTTTAGAACAAATTGCATGTACAACTCAACAGTTTGAACCTACACAATGTAATTTCTTCTAAAAACTCAGCACACAAAGTTAATTTACTCATTTCCATTATTAAAAACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCACTTTGGATTGAGGCTATGATAACACAGTCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATATAAATGTGCAAAATATTAAAATTATTGTGTTAAACCACAAAAA
                                                      consensus depths                                                                                       8    12    10    16    10    16    13    18    15    19    15    19    15    19    16    20    17    21    17    21    20    21    20    21    20    21    20    21    20    21    20    21    16    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    20    21    21    21    21    21    21    21    21    21    21    21    21    21    20    21    15    21    16    21    16    21    16    21    16    21    15    20    15    20    14    20    14    20    16    21    15    21    15    20    14    18    13    17    13    17    13    17    13    17    12    16    11    15    11    15    11    15    11    14    11    14    11    14    11    13    11    12    10    11     7     9     7     9     5     7     3     5     3     5     3     4     3     4     2     4     2     4     2     3     2     3     1     2     1     2     1     2     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     4     2     5     2     6     2     6     2     8     2     8     2     8     2     8     2     8     2     9     3    11     3    11     3    11     3    11     3    11     7    11     8    13     8    13     8    13    10    14    11    15    10    16    10    17     9    18    12    19    12    20    14    20    13    20    15    23    16    24    17    26    20    27    20    27    23    29    23    30    24    30    24    30    25    31    25    31    27    34    27    34    27    34    26    34    26    34    26    35    26    36    26    36    26    35    26    36    26    36    25    35    26    36    26    36    24    35    25    35    25    35    25    35    24    35    33    35    32    35    34    35    34    35    32    35    34    35    33    35    33    35    36    37    35    36    35    36    35    36    36    37    36    38    36    38    36    38    36    39    37    37    37    37    36    37    34    36    34    36    36    36    36    36    35    36    35    36    35    36    35    36    33    34    27    33    17    21    11    13     9     9     7     9
  5   1   2      ests                               Xl3.1-XL492j14ex.5                                                                                  AATTAGTTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTTCCCCGATTCCAGATCCTCTCTCTGCTGTGACTAATCCCTGCATGCAGAGGTCAACTGGCTACCCAATG
  5   1   2      ests                            Xl3.1-IMAGE:6956293.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCAATTGCCACACCTACAATGGGTAGCCACCTCAGCCAATCTCCGGCATCCCTTTCTGCCCAGGGATATGGAGCTGCCAGTCTTGGCTTCACCTCAGTGGATTGCTTAGACTACAAGGACCAAACTGCTTCATGGAAGCTTAATTTCAATGCCACTGACTGCCTTGATTATAAAGACCAGAGCTCATGGAAATTTCAAGTCTTGTAAATCTGATCAAGTCAAAGCCTCATTTTCAGCATCCTTCACTTCAGCATCAACTGTGCTTCATATTCCAGCTCTAAGAGTGTCTGGATTGGAAATCTAATAATGGAACAAACACAAAAACATTTATAACTTTATGGCCTTTTGCCATTTAATCTTTTAGAACAAATTGCATGTACAACTCAACAGTTTGAACCTACACAATGTAATTTCTTCTAAAAACTCAGCACACAAAGTTAATTTACTCATTTCCATTATTAAAAACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCACTTTGGATTGAGGCTATGATAACACAGTCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATATAAATGTGCAAAATATTAAAATTATTGTGTTAAACCACAAAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                              CAAGTGACAAGCCCAGCTCTACCTGCACTCCTCGCTCCTCGTCCTCTCTTCTCTGAGAAAACAGCAGGACTGCATATTAGATTCACTGTGGCTGAAACTGCTGCTAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAAAACTCAGCACACAAAGTTAATTTACTCATTAT
                                                                   SNP                                                                                                                                                                                                          T-----------
                                                                   SNP                                                                                                                                                                                                                                  ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                  --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------G
                                               BLH ATG     243    1225                                                                                  
                                               BLH MIN     243     145                                                                                  
                                               BLH OVR     243      93                                                                                  
                                               EST CLI      -4      58                                                                                  
                                               ORF LNG     243       4                                                                                  
                                                                       PROTEIN --- Ce ---- 2e-026     NP_001024213.1 abnormal ThermoTaXis family member (ttx-1) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 1e-029     NP_001014727.1 CG12154-PB, isoform B [Drosophila melanogaster] --------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN -== Ag ==== 2e-030     XP_310918.4 AGAP000215-PA [Anopheles gambiae str. PEST] =======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Ci ==== 2e-040     NP_001027662.2 Otx [Ciona intestinalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Sp ---- 4e-054     NP_001027540.1 orthodenticle-related protein isoform beta [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = ?? ==== 2e-118     XP_876837.3 PREDICTED: similar to orthodenticle homeobox 2 isoform 4 [Bos taurus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Gg ==== 4e-120     NP_989851.2 homeobox protein OTX2 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 2e-120     NP_659090.1 orthodenticle homolog 2 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Bt ==== 1e-120     XP_876928.1 PREDICTED: similar to orthodenticle 2 isoform b isoform 5 [Bos taurus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 1e-120     NP_758840.1 orthodenticle 2 isoform b; homeobox protein OTX2 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Cf ==== 7e-121     XP_547830.2 PREDICTED: similar to orthodenticle 2 isoform b isoform 1 [Canis familiaris] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Dr ==== 1e-131     NP_851848.2 orthodenticle homolog 5 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 4e-165     AAI61339.1 Cone-rod homeobox [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 1e-168     NP_001081916.1 OTX5b protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                               Xl3.1-IMAGE:6956293.3.5                                                                                     TAG---------------------------------------TGA------------------------------TAG------------------------TGA---------------------TGA------------------------TGA---TAA------------------------------------------------------------TGA---------------ATGATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---TGA---------------------------------------------------------------------------------------------ATG---------------------TAA------------------------------------------------------------------------------------TAA------------------TAA------------------TAA---------ATG---------------------------------------TGA---------------------------------------TGA---------------TGATAA---------------------------------------------------------------------------------TAA------------------------TAA---------------------------------------------ATG------------------------------------------------TGA---------------------------------------------------------------------------TGA------------------------TGA------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------TGA---------------------------------TGA------TGAATG---------------------------------------------TGA---------------------------------------------------------------------TAG---------ATGTAG---------------------------------------------------------------TAA---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2      ests                               Xl3.1-XL492j14ex.5                                                                                  AATTAGTTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTTCCCCGATTCCAGATCCTCTCTCTGCTGTGACTAATCCCTGCATGCAGAGGTCAACTGGCTACCCAATG
                                                  Xl3.1-CHK-1012689625                                                                                        TTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTTCCCCGATTCCAGATCCTCTCTCTGCTGTGACTAATCCCTGCATGCAGAGGTCAACTGGCTACCCAATGACCTAT
  5   1   2       bld Brn1 5g3  in                    IMAGE:6956293.5p                                                          CGCCTTGTAGCGTCCCATGCTGCAAACCCTCCAAGCCAAGTGACAAGCCCAGCTCTACCTGCACTCCTCGCTCCTCGTCCTCTCTTCTCTGAGAAAACAGCAGGACTGCATATTAGATTCACTGTGGCTGAAACTGCTGCTAATTGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCaaaaaaaaCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTTTCCCGATTCCAGATCCTCTCTCTGCTGTGACTAATCCCTGCATGCAGAGGTCAACTGGCTACCCAATGACCTATANGTCAGGCCCCTGCTTATACTCAGAANCTATGGGAGGGATCTNTTCATCTTATTTTCACA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4970214.5p                                                          TCGACCACGCGTCCGCATGCTGCAAACTCTCCAAGCCAAGTGACAAGCCCAGCTCTACCTGCACTCCTCGCTCCTCGTCCTCTCTTCTCTGAGAAAACAGCAGGACTGCATATTAGATTCACTGTGGCTGAAACTGCTGCTAATTGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTTCCCGATTCAGATCTCTCTCTGCTGTGACTATCCTGCATGCAAGTCACTGCTACCATG
  5   1   2       bld Ga15 5g                            XL481p18ex.5p                                                                     TCCGCTCACCTGCAATTAGTTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCAGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCaaaaaaaaaCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTANAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATG
  5   1   2       bld DMZ  5g3  in                         xl244j22.5p                                                                         CTCACCTGCAATTAGTTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTTCC
  5   1   2       bld Ga18 5g3  in                      xlk116b12ex.5p                                                                           CACCTGCAATTAGTTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGNACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGNNGTNGNTATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAANTTACCAGAATCCCGAGTGCAGGNCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGNNNNTGGACAAGCTAAGNCTCGACCAGCTNAGAAGAAGACATCCCCTGCCAGGGAGANAAACTCAGAGGCAAGNNCCAATGGGCAGTACAGNCCTCCTCCT
  5   1   2       bld Brn1 5g3  in                    IMAGE:6951484.5p                                                                            CCGGAATTCCCGGGATGCCAAGTGACAAGCCCAGCTCTACCTGCACTCCTCGCTCCTCGTCCTCTCTTCTCTGAGAAAACAGCAGGACTGCATATTAGATTCACTGTGGCTGAAACTGCTGCTAATTGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCaaaaaaaaCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTTCCCCGATTCCAGATCCTCTCTCTGCTGTGACTAATCCCTGCATGCAGAGGTCAACTGGCTACCCAATGACCTATAGTCAGGCCCCCTGCTATACTCAGAGCTATGGGAGATCTTCATCTTATTTCACAGGGCTGGGACTGGGGATCCCATCGGTCTCCTAAGCACCCACAACTCT
  5   1   2      seed Ga15 5g3  in                       XL492j14ex.5p                                                                              CTGCAATTAGTTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCaaaaaaaaCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTTCCCCGATTCCAGATCCTCTCTCTGCTGTGACTAATCC
  5   1   2       bld Ga18 5g3  in                      xlk142g13ex.5p                                                                                TGCAATTAGTTTCTGTCCCAGCCTTGGACTACTGGNTAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCaaaaaaaaCCCATCAAGNTTATTGAAGTCCCTTGATACTTGGNCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGNACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACNAGGGNGNNGNNGNNTATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATNAGGG
  5   1   2       bld DMZ  5g3  in                         xl247n07.5p                                                                                GCAATTAGTTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTT
  5   1   2       bld DMZ  5g3  in                         xl284d22.5p                                                                                GCAATTAGTTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTC
  5   1   2       bld DMZ  5g3  in                         xl244g08.5p                                                                                GCAATTAGTTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTTCCCCGATTCCAGATCCTCTCTCTGCTGT
  5   1   2       bld Ga18 5g3  in                      xlk107n24ex.5p                                                                                 CAATTAGTTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCNCAGTNGNTATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGNGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGNNCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGANNACTGGACAAGCTAAGNCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAANCACCAATGGGCAGTACAGTCCTNCTCCTCCTGGCACTGNAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATAT
  5   1   2       bld Gas3 5g3  in                      xlnga002p23.5p                                                                                     AGTTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCaaaaaaaaCCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATNTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAAGGCAAAATGTCGCCAGCAACAACAGCAGAGCA
  5   1   2       bld DMZ  5g3  in                         xl259a08.5p                                                                                      AGTTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCAGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCaaaaaaaaaCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTTCCCCGATTCCAGATCCTCTCTCTGCTGT
  5   1   2       bld Ga18 5g3  in                      xlk133b06ex.5p                                                                                        TTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAANNNNACCAGGGCGNNNNNGNTATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGNGGCTCTAAAGATAAATTTACNAGAATCCCGAGTGCAGGNCTNGNTTTAAAAACAGAAGGNNAAAATGTCGCCAGCAACAAC
  5   1   2       bld Ga15 5g3  in                       XL443m09ex.5p                                                                                             TCCCAGCCTTGGACTACTGGTATAAGACACAGTTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCaaaaaaaaCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTANCCTTAGCTGGTACTGGAATGGACCTTCTGCNCTCAGCTGTAGGATACCCANCAAACCCACGGAAACNAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCANAATCCCGAGTGCNGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAG
  5   1   2       bld DMZ  5g3  in                         xl241f03.5p                                                                                                              CTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCAGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCaaaaaaaaaCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTTCCCCGATTCCAGATCCTCTCTCTGCTGTGACTAA
  5   1   2       bld Brn1 5g                IMAGE:4740548-IMAGp.IMAGp                                                                                                                GGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTATTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCaaaaaaaaCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACACAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAAC
  5   1   2       bld Brn1 5g                         IMAGE:4740548.5p                                                                                                                              TTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCATAAAAAACCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCAGCTGGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATTCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCC
  5   1   2       bld Ga18 5g3  in                      xlk122o05ex.5p                                                                                                                                                                   TTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGCGCNNTNGNTATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGTGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGNTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGNNNNTGGACAAGCTAAGNCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGANAAACTCAGNNGNAAGCACCAANTGGGCAGTACAGTCCTNCTCCTCCTGGNACTGCAGTTACCCCTAGNTCCTCAGCTAGTG
  5   1   2       bld Ga18      in                      xlk148a09ex.5p                                                                                                                                                                             TGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCTGAGGCTAGCATACCAAAAAAACCCCATCAAGTTTATTGAAGTCCCTTGATACTTGGTCACTGAAATGATGTCCTACATCAAACAGCCTCATTATGCAGTCAATGGACTAACCTTAGCTGGTACTGGAATGGACCTTCTGCACTCAGCTGTAGGATACCCAACAAACCCACGGAAACAAAGAAGAGAGAGAACAACTTTTACCAGGGNGCNNNNGATATTTTGGAATCCCTCTTTGCTAAAACACGTTACCCTGACATTTTTATGAGGGAGGAGGNGGCTCTAAAGATAAATTTACCAGAATCCCGAGTGCAGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGNNNNTGGACAAGCTAAGNCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGNACAGTCCTCCTCCTCCTGGCACTNCAGTTACCCCTAGNTNCCTCAGCTAGNGCAACAGTGTCCATATGGAGNCCAGCCTCCATTTCCCCGANTCCAGATCCTCTCTCTGCTGTGANTNANNCCTGCATGCAGAGGNCAACTGGCTACCCNANNGACCTATAGTCNGNNCCTGCTTATACTCAGAGCTATGG
  5   1   2      ests                            Xl3.1-IMAGE:6956293.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCAATTGCCACACCTACAATGGGTAGCCACCTCAGCCAATCTCCGGCATCCCTTTCTGCCCAGGGATATGGAGCTGCCAGTCTTGGCTTCACCTCAGTGGATTGCTTAGACTACAAGGACCAAACTGCTTCATGGAAGCTTAATTTCAATGCCACTGACTGCCTTGATTATAAAGACCAGAGCTCATGGAAATTTCAAGTCTTGTAAATCTGATCAAGTCAAAGCCTCATTTTCAGCATCCTTCACTTCAGCATCAACTGTGCTTCATATTCCAGCTCTAAGAGTGTCTGGATTGGAAATCTAATAATGGAACAAACACAAAAACATTTATAACTTTATGGCCTTTTGCCATTTAATCTTTTAGAACAAATTGCATGTACAACTCAACAGTTTGAACCTACACAATGTAATTTCTTCTAAAAACTCAGCACACAAAGTTAATTTACTCATTTCCATTATTAAAAACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCACTTTGGATTGAGGCTATGATAACACAGTCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATATAAATGTGCAAAATATTAAAATTATTGTGTTAAACCACAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012686901                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCCACACCTACAATGGGTAGCCACCTCAGCCAATCTCCGGCATCCCTTTCTGCCCAGGGATATGGAGCTGCCAGTCTTGGCTTCACCTCAGTGGATTGCTTAGACTACAAGGACCAAACTGCTTCATGGAAGCTTAATTTCAATGCCACTGACTGCCTTGATTATAAAGACCAGAGCTCATGGAAATTTCAAGTCTTGTAAATCTGATCAAGTCAAAGCCTCATTTTCAGCATCCTTCACTTCAGCATCAACTGTGCTTCATATTCCAGCTCTAAGAGTGTCTGGATTGGAAATCTAATAATGGAACAAACACAAAAACATTTATAACTTTATGGCCTTTTGCCATTTAATCTTTTAGAACAAATTGCATGTACAACTCAACAGTTTGAACCTACACAATGTAATTTCTTCTAAAAACTCAGCACACAAAGTTAATTTACTCATTTCCATTATTAAAAACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCACTTTGGATTGAGGCTATGATAACACAGTCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATATAAATGTGCAAAATATTAAAATTATTGTGTTAAACCACAAAAAAAAAAAAA
  5   1   2       bld Brn1                            IMAGE:7018454.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAGGGTCTGGTTTAAAAACAGAAGGGCAAAATGTCGCCAGCAACAACAGCAGAGCACTGGACAAGCTAAGCCTCGACCAGCTAAGAAGAAGACATCCCCTGCCAGGGAGACAAACTCAGAGGCAAGCACCAATGGGCAGTACAGTCCTCCTCCTCCTGGCACTGCAGTTACCCCTAGTTCCTCAGCTAGTGCAACAGTGTCCATATGGAGTCCAGCCTCCATTTCCCCGATTCCAGATCCTCTCTCTGCTGTGACTAATCCCTGCATGCAGAGGTCAACTGGCTACCCAATGACCTATAGTCAGGCCCCTGCTTATACTCAGAGCTATGGAGGATCTTCATCTTATTTCACAGGGCTGGACTGTGGATCCTATCTGTCTCCTATGCACCCACAACTCTCTGCTCCTGGTGCCACCTTGAGCCCAATTGCCACACCTACAATGGGTAGCCACCTCAGCCAATCTCCGGCATCCCTTTCTGCCCAGGGATATGGAGCTGCCAGTCTTGGCTTCACCTCAGTGGATTGCTTAGACTACAAGGACCAAACTGCTTCATGGAAGCTTAATTTCAATGCCACTGACTGCCTTGATTATAAAGACCAGAGCTCATGGAAATTTCAAGTCTTGTAAATCTGATCAAGTCAAAGCCTCATTTTCAGCATCCGTCACTTCAGCATCAACTGTGCTTCATATTCCAGCTCTACAAGAGTGTCTGGATTGGAAATCTAATAATGGAACAAACACAAAAAACATTTATAACTTTATGGCCTTTTGCCATTTAATCTTTTAGAACAAATTGCATGTACAACTCAACAGTTTGAACCTACACCATGTAAATTTCTTCTAAAAAACTCC
  5   1   2       bld Ga15      in                       XL402a05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCAATTGCCACACCTACAATGGGTAGCCACCTCAGCCAATCTCCGGCATCCCTTTCTGCCCAGGGATATGGAGCTGCCAGTCTTGGCTTCACCTCAGTGGATTGCTTAGACTACAAGGACCAAACTGCTTCATGGAAGCTTAATTTCAATGCCACTGACTGCCTTGATTATAAAGACCAGAGCTCATGGAAATTTCAAGTCTTGTAAATCTGATCAAGTCAAAGCCTCATTTTCAGCATCCTTCACTTCAGCATCAACTGTGCTTCATATTCCAGCTCTAAGAGTGTCTGGATTGGAAATCTAATAATGGAACAAACACAAAAACATTTATAACTTTATGGCCTTTTGCCATTTAATCTTTTAGAACAAATTGCATGTACAACTCAACAGTTTGAACCTACACAATGTAATTTCTTCTAAAAACTCAGCACACAAAGTTAATTTACTCATTTCCATTATTAAAAACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCACTTTGGATTGAGGCTATGATAACACAGTCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGA
  5   1   2       bld Ga15      in                       XL488c18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGATTGCTTAGACTACAAGGACCAAACTGCTTCATGGAAGCTTAATTTCAATGCCACTGACTGCCTTGATTATAAAGACCAGAGCTCATGGAAATTTCAAGTCTTGTAAATCTGATCAAGTCAAAGCCTCATTTTCAGCATCCTTCACTTCAGCATCAACTGTGCTTCATATTCCAGCTCTAAGAGTGTCTGGATTGGAAATCTAATAATGGAACAAACACAAAAACATTTATAACTTTATGGCCTTTTGCCATTTAATCTTTTAGAACAAATTGCATGTACAACTCAACAGTTTGAACCTACACAATGTAATTTCTTCTAAAAACTCAGCACACAAAGTTAATTTACTCATTTCCATTATTAAAAACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCACTTTGGATTGAGGCTATGATAACACAGTCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGAACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCAC
  5   1   2       bld Ga15                               XL450h02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCTACAAGAGTGTCTGGATTGGAAATCTAATAATGGAACAAACACAAAAACATTTATAACTTTATGGCCTTTTGCCATTTAATCTTTTAGAACAAATTGCATGTACAACTCAACAGTTTGAACCTACACAATGTAATTTCTTCTAAAAACTCAGCACACAAAGTTAATTTACTCATTATTAAAAACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCACTTTGGATTGAGGCTATGATAACACAGTCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTATTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAA
  3   1   2       bld Ga18 5g3  in                      xlk133b06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TNCAGCTCTNNNNNANNNTCTGANNGNAATCTANNAATGNANNAAACANAAAANNTTTANACTTNATGGCNTTTTNCNATTTAANNTTTTAGAACAANTTGCATGTACAACTCAACAGTTTGAACCTACANAATGTANTTTCTTCTAAAANCTCAGNNNACAAAGTTAATTTNCTCATTATTAAAANNGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCNCTTTGGATTGAGGCTATGATAACACAGNCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAANCNNNNNNGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTATTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAANNNNCAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATATAAATGTG
  3   1   2       bld Ga18      in                      xlk148a09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCNGATTNGAAANNNANNNNNAACNANNNNAAAAACATTNANACTTTANGNCCTTTTGCCATTTAATCTTTTAGNACAAATTGNATGTACACTCAACAGTTTGANCCTACACAATGTANTTCTNCTAAAANCNCAGNACACAAAGTTAATTTACTCNTTTCCATTATTAAAACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCNCTTTGGATTGAGGCTATGATAACACAGNCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAANCTTCAGGTTATCAGCATCAANCCTNNTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAANNNACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAANCTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATATAAA
  3   1   2       bld Ga18 5g3  in                      xlk122o05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNANAANNNNAAAANNNTTNNNACTTNNNNNNTTTTGCCATTTAATNTTTAGAANAANTTGCATGTACNACTCAACAGTTNGNNCCTACACAATGTANTTTCTTCTAAAACTCAGCACACAAAGTTAATTTNCTCATTATTAAAACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCACTTTGGATTGAGGCTATGATAACACAGTCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAANCTTCAGGTTATCAGCATCAANCCTNNTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTATTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCANCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAANNACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTNCCTNCCCNCCACTGTATGNNTNNCNNNCCA
  3   1   2       bld Ga18 5g3  in                      xlk142g13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ANNNNAAAACNTTNNNNCTTNANGNNTTTGCCANTNANNTTTAGAANAANTNCATGTACAACTNANNAGTTTNNACCTACNNATGTAATTTCTTCTAAAACTCAGNANACAAAGTNANNTTNCTCNTTNCCATTATTAAAAACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCNCTTTGGATTGAGGCTATGATAACACAGNCCTCACTCCTNCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAANCTTCAGGTTATCAGCATCAAACCTNNTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAANNNNCAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATATAAATGTNNAAAA
  5   1   2       bld Brn1                            IMAGE:4740617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAACTCAACAGTTTGAACCTACACAATGTAATTTCTTCTAAAAACTCAGCACACAAAGTTAATTTACTCATTATTAAAAACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCACTTTGGATTGAGGCTATGATAACACAGTCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTATTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTT
  3   1   2       bld Ga18 5g3  in                      xlk116b12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ANAGTTTGNACCTACACAATGTANTTTCTCTAAAACTCAGNACNNAAAGTTAANTTNCTCNTTTCCATNANTAAAACGTACAATGNCAGCAAATGTAGGGAGATCATTAAAAGNNCTTTGGATTGAGNCTATGATAACACAGNCCTNACTNCCTTCATCTTGTTGTTGATTGGGAAATTTCTNGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTNNTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCNCCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCANCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAANNNNNAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATATAAATGTGNAAAA
  5   1   2       bld Ga18      in                       xlk53g19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGAACCTACACAATGTAATTTCTTCTAAAAACTCAGCACACAAAGTTAATTTACTCATTTCCATTATTAAAAACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCACTTTGGATTGAGGCTATGATAACACAGTCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGNTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGNTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGNCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGNTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGNTAATTTNTTTTATAAAATGTTTCTACNTACCCACCACTGTNTGATTTNTCATACCATG
  3   1   2       bld Neu4                            IMAGE:4084624.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAAAACTCAGCACACAAAGTTAATTTACTCATTATTAAAAACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCACTTTGGATTGAGGCTATGATAACACAGTCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTATTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAA
  3   1   2       bld Brn1 5g3  in                    IMAGE:6951484.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACGTACAATGACAGCAAATGTAGGGGAGATCATTAAAAAGCACTTTGGATTGAGGGCTATGATAACACAGTCCTCACTCTTTCATCTTGTTGTGNATTGNGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTATTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTGGTA
  3   1   2       bld Brn1 5g3  in                    IMAGE:6956293.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACAATGACAGCAAATGTAGGGGAGATCATTAAAAGCACTTTGGATTGAGGCTATGATAACACAGTCCTCACTCTTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTATTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGGACAAGAAATATA
  5   1   2       bld DMZ       in                         xl229a11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGCACTTTGGATTGAGGCTATGATAACACAGTCCTCACTCCTTCATCTTGTTGTTGATTGGGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTC
  3   1   2       bld Ga15      in                       XL488c18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATAACACAGTCCCTCANTCCTTCATCTTGTTGGTTGATTGGGGAAATTTCTTGTGATAAAGTAAACTTTCAGGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAGTCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGGACAAAAAATATA
  3   1   2       bld Emb4 5g3  in                    IMAGE:4970214.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       NATGATAACACAGTCCTCACTCNTTCATCTGTGTNNGATNGGGAAATTTCTTGTGATAAGTNAAACTTCAGGTTATCAGCATCAAACCTGCTNTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTATTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAAT
  3   1   2       bld Ga18      in                       xlk53g19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTNCTTCNNCTNTTGNTGATNNGGAANTTNCNTGTGANAAAGNAANNNAGNNNTCAGCATCAAACCNNNTTTGCTGAACATTTTNCTNNTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTANTCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCANCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAANNACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAANCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATANAA
  3   1   2       bld Ga15                               XL430i08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGAAATTTCTTTGTGATAAAGNTAAANCTTCNAGGGNTTATCCAGCATCAAAACCTGGNTTTGGNTGAACCATTTTTGCTTGTTCTTTCCCCAGCCACCAAAAGATTTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATAT
  3   1   2      seed DMZ  5g3  in                         xl259a08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAAATTTCTTGTGATAAAGTAAACTTCAGGTTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTATTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATA
  3   1   2       bld DMZ       in                         xl229a11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGATAAAGTAAACTTCAGGNTATCAGCATCAAACCTGCTTTGCTGAACATTTTGCTTGNTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAAT
  3   1   2       bld DMZ  5g3  in                         xl247n07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGCTGAACATTTTGCTTGTTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGGACAAAAAATA
  3   1   2       bld Ga15      in                       XL402a05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAACATTTTGGCTNGTTNTTCCCCAGNCCNCCAAAGGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATATAAANGGCAAAATATA
  3   1   2       bld DMZ  5g3  in                         xl244j22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGAACATTTNGCTTGNTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCNGGAGTTAAAGTATTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTGGACAAAAAATA
  3   1   2       bld Ga18 5g3  in                      xlk107n24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GNACATTTTGCTTGTCTTCCCCANCCACCAAAGNTTTTTNAGNATCTCTGGAGTTAAAGNACTCTCAGTAATCTCTGNAGTTAAAGTATTCTCCAGCTATCTNNCAAAGTTTCAAAANNNGAAGTGAATCAACACAGCCATNCTTTGTCCTTCATGTTACAATTACTTGNCCTCCGAAAATATCTGATCNCNTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAANCCTGTATTTGAACCCCTNCCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAANNNACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCCTAGTCCTATGCAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATATAAA
  3   1   2       bld DMZ  5g3  in                         xl284d22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCTTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGGACAAAAAAT
  3   1   2       bld Ga15 5g3  in                       XL443m09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCCCCAGCCACCAAAGATTTTTCAGTAATCTCTGGGAGTTAAAGTACTCTCAGTAATCTNTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACNTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAANTATGAAAAGTATTCTGNTCTGTCCACTTAAGGACACAANGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCANGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGNTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTNTTCCGTGTNGTGCTTTCGTCTTNGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCNTAGTTCTGTAATATTAA
  3   1   2       bld DMZ  5g3  in                         xl244g08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCCACCAAAGATTTTTCAGTAATCTCTGGAGTTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGGACAAAAAATA
  5   1   2       bld Ga15      in                       XL404p15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGtaatattaattaattaatgttgtgacaaaaaatataaatgtgcaaaatattanaattattgtgttaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL404p15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAAAGTACTCTCAGTAATCTCTGCAGTTAAAGTATTCTCCAGCTATCTACCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGGACAAAAAATA
  3   1   2       bld DMZ  5g3  in                         xl241f03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCAGTNATCTCTGCAGTTAAAGTATTCTCCAGCTATCTANCAAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCNTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACNCAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTNGTGTCTGNTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGGACAAAAAAT
  5   1   2       bld Ga15      in                       XL475n03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCGAAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGAcaaaaaatataaatgtgcaaaatattaaaattattgtgttannaaaa
  3   1   2       bld Ga15      in                       XL475n03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGTTTCAAAATGAGAAGTGAATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTNGTGACAAAAAATA
  3   1   2       bld Unk3                                 546_4F07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGTGAATCAACCCAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCCCCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTCCCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGCCCCAATGCCTGAACTTGAGGAAAGACTCCCAACCAGTACAAAGGCCCAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAAAGCTAACCCAATCCCTGTAGTTCATTCCAAGCATTGCCCATTTATTTGAACAAACATAAACTCAAGACTCCCAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCCCCCCTGTATGATTTATCATCCCATGGAATCCTATAAATGAAAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCCCCGAATCAGTCCAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGCCAAAAAATATAAATGTGCAAAATATTAAAATTATTGTGTTAAACCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGCGCGCC
  5   1   2       bld Ga18      in                      xlk143j24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCCTAGTCCTATGCAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAAttaattaatgttgtgacaaaaaatataaatgtgcaaaatattaaaattattgtgttaaaccacaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk143j24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATCAACACAGCCATCCTTTGTCCTTCATGTTACAATTACTTGACCTCCGAAAATATCTGATCACCTTCACAGGAGGTTCAAAAGATGCATACCAGCCACCTGCTGCAAAACCTGTATTTGAACCCCTACCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAANNNNNAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCCTAGTCCTATGCAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATATAAATGTGNAAAAT
  5   1   2       chi Ga15      in                       XL480e13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCACCTGCAATTAGTTTCTGTCCCAGCCTTGGACTACTGGTATAAGACACAGTTGAGCACAAAGTACCATCCTTTGCATCTTCGATTAGTTTAGTGGAGTGGATCTCAGATTTTGATGTGTACTTTACAGATTCAGCTGAGAAAAGACCTCTATTCGGATCAACTGAGAATAAAGAAACTCTAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATAttaattaattaatgttgtgacaaaaaatataaatgtgcaaaatattaaaattattgtgttaaaccacaaaaaaaaaa
  3   1   2       bld Ga18                              rxlk63p14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAGGAGGNCAAAAGATGCANNCAGCCNCTGCTGCNAAANCCTGTATTNGANCCCCTNCCATAAANTGAAAAATTANGNAAAAGTATTCTGCTCTGTCCNCTTAANGACACNANTGCCTGNANCTTGAGGAAAAGACTCNCAANNAGTANAAANGNACAGCCCTCTTTAGATATGGGAATCCANTCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAANANA
  5   1   2       bld Ga15                               XL506c04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCNAAACCTGTATTTGAACCCCTANCATAAATGAAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCGTGAACTTGAGGAAAGACTCACAACCAGCTACAAAGGCACAGCCCTCTTTANATATGGGAATCCAATCTAGCTGAAGACTTANACGGCTCTTCATGNACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATANACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATANAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAANTGAGAAGTGTTTTTCCGTGNTGTGCTTTCGNCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGNGAcaaaaaatataaatgtgcaaaatattaaaattattgtgttaaaccaaaaaaaaaa
  3   1   2       bld Gas3 5g3  in                      xlnga002p23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAATTATGAAAAGTATTCTGCTCTGTCCACTTAAGGACACAATGCCTGAACTTGAGGAAAGACTCACAACCAGTACAAAGGCACAGCCCTCTTTAGATATGGGAATCCAATCTAGCTGAAGACTTAGACGGCTCTTCATGTACTAGAGCTAACACAATCACTGTAGTTCATTACAAGCATTGCACATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCCTAGTCCTATGCAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGTGACAAAAAATATAAATGTGCAAAATATTAAAATTATTGTGTTAAAAAA
  5   1   2       bld Ga15      in                       XL507k14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATtaatgttgtgacaaaaaatataaatgtgcaaaatattaaaattattgtgttaaaccacaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL507k14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTATTTGAACAAACATAAACTCAAGACTCACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAATATTAATTAATTAATGTTGNGACAAAAAATA
  3   1   2       bld Ga15      in                       XL480e13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTNGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTNCTTAGTTCTGTAATATTAATTAACNTAATGTTTGTGA
  5   1   2       bld Emb1                            IMAGE:6633635.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGAATTTATTTTATAAAATGTTTCTACCTACCCACCACTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGTGCTTTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTCTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGTAatattaattaattaatgttgtgacaaaaaatataaatgtgcaaaatattaaaattattgtgttaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  3   1   2       bld Ga15 5g3  in                       XL492j14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CNCTGTATGATTTATCATACCATGGAATCCTATAAATGAGAAGTGTTTTTCCGTGTTGNGCTNTCGTCTTTGTGTTGACTAGCATAGTCCTATGTAGGGGTTTGTGTNTGTTCCGCCGAATCAGTACAAACTTTCTCTTAGTTCTGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)