Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk142a14ex.3                        67 END     1           1        1                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012837352 Xl3.1-XL516d06ex.5.5 - 61 ESTs
                                                                       .......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-XL516d06ex.5.5                                                                              GTTTAGTTCGATTGATATCGAGAGTTAAATATCCACTTATCGGGTATATTTTATAGACGGGAAGGTATTCGCGTCATCGCGTGAGATACTTCACGCTGTTCGCTCCCTGGGGCCTACTTATCCGTCCCGGCTGTCACTTTGTAGACGATCCCTTACGTTCAGTGCTGTTTCAGGAGGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTAAAAAAACAAAAAAATATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACACAAAACAAAAATTTTTTTTTTTTTTTTTGAATGATGCTCAATAGAATCGAAATGTCACTTAGGGGGAGGGGGTCGTATGTGTGCCATTTTCCATTTCCGCATTTTCCATTTCGTTCTAAATTTGCTGAATATCCCCCCCCCACCCCCAGTTTTTTCATACAGGGTCTCTTCCTTCAGTCTTTTTGTATTTTGATTGTTATGATGTAAAACTTGCTTTTATTTTAATATTGATGTCAGTATTTCAACTGCTGTAAAATGATAAAACTTTTATACTTCTATATAAATTCACTAGTAACCTCTTAGTTTTTTTTTTTTTGTTTTTTTTTCCTTTTGCTCTCTGATGCAGGCATGCTTTTTCAAATGTTTAGAACTATATTTTAGCCTCTAGCCGGCTCTATAAAGAACAATGTCATGAATTCCACCCCCTCCCCTCCCCCGAAATTTCTCTTCCGTCTTTAAGAAACTACGGTTGCGCTTCAACCTGGAGCCTCAGAGACTCAATGTCAGTCAGCATCTCGCTTCTGCATCACTTCCTTTCTTTATATGGCGTTTTGTCTGTGTTGCTGTTTAGATTAAATAAACTGTTTATAGA
                                                  Xl3.1-CHK-1012722640                                                                                    TTCGATTGATATCGAGAGTTAAATATCCACTTATCGGGTATATTTTATAGACGGGAAGGTATTCGCGTCATCGCGTGAGATACTTCACGCTGTTCGCTCCCTGGGGCCTACTTATCCGTCCCGGCTGTCACTTTGTAGACGATCxxTxAxGTTCAGTGCTGTTTCAGGAGGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTAAAAAAACAAAAAAATATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACACAAAACAAAAATTTTTTTTTTTxxxTxTGAATGATGCTCAATAGAATCGAAAxxxxxxTTAGGGGxxGGGGGTCGTATGTGTGCCATTTTCCATTTCCGCxxxTTxxATxxxGTTCTAAATTTGCTGAATATCCCCCCCCCACCCCCAGTTTTTTCATACAGGGTCTCTTCCTTCAGTCTTTTTGTATTTTGATTGTTATGATGTAAAACTTGCTTTTATTTTAATATTGATGTCAGTATTTCAACTGCTGTAAAATGATAAAACTTTTATACTTCTATATAAATTCACTAGTAACCTCTTAGTTTTTTTTTTTTTGTTTTTTTTTCCTTTTGCTCTCTGATGCAGGCATGCTTTTTCAAATGTTTAGAACTATATTTTAGCCTCTAGCCGGCTCTATAAAGAACAATGTCATGAATTCCACCCCCTCCCCTCCCCxxAAxTTTCTCTTCCGTCTTTAAGAAACTACGGTTGCGCTTCAACCTGGAGCCTCAGAGACTCAATGTCAGTCAGCATCTCGCTTCTGCATCACTTCCTTTCTTTATATGGCGTTTTGTCTGTGTTGCTGTTTAGATTAAATAAACTGTTTATAGAAAGTTT
                                                      consensus depths                                                                                   2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     2     3     1     3     2     4     2     5     6    12     6    15    11    20    18    28    21    33    25    37    27    42    27    42    27    42    35    43    36    44    39    44    39    44    40    45    40    45    40    45    40    45    40    45    40    45    40    45    41    46    41    46    40    46    42    46    45    46    46    46    45    46    43    46    44    46    46    46    45    46    46    46    46    46    45    46    46    46    44    47    46    47    45    47    44    48    44    49    42    49    44    49    43    48    46    48    44    47    42    45    41    45    39    44    36    41    35    39    35    39    24    29    15    24    11    19    11    19     9    17     9    18     5    17     3    11     3    11     2    11     2    11     2    12     2    12     2    13     2    12     3    12     4    13     5    12     6    11     6    11     6    11     6    11     6    11     6    11     5    11     5    10     5     9     5     9     4     8     3     7     4     8     2     8     3     7     3     6     3     6     3     5     3     4     3     5     3     5     3     4     5     6     3     5     3     5     3     4     4     4     3     4     5     5     3     4     3     5     5     5     3     4     3     4     3     4     2     4
  5   1   2      ests                               Xl3.1-XL516d06ex.5                                                                              GTTTAGTTCGATTGATATCGAGAGTTAAATATCCACTTATCGGGTATATTTTATAGACGGGAAGGTATTCGCGTCATCGCGTGAGATACTTCACGCTGTTCGCTCCCTGGGGCCTACTTA------------GTCACTTTGTAGACGATCCCTTACGTTCAGTGCTGTTTCAGGAGGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTAAAAAAACAAAAAAATATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACACAAAACAAAAATTTTTTTTTTTTTTTTTGAATGATGCTCAATAGAATCGAAATGTCACTTAGGGGGAGGGGGTCGTATGTGTGCCATTTTCCATTTCCGCATTTTCCATTTCGTTCTAAATTTGCTGAATATCCCCCCCCCACCCCCAGTTTTTTCATACAGGGTCTCTTCCTTCAGTCTTTTTGTATTTTGATTGTTATGATGTAAAACTTGCTTTTATTTTAATATTGATGTCAGTATTTCAACTGCTGTAAAATGATAAAACTTTTATACTTCTATATAAATTCACTAGTAACCTCTTAGTTTTTTTTTTTTTGTTTTTTTTTCCTTTTGCTCTCTGATGCAGGCATGCTTTTTCAAATGTTTAGAACTATATTTTAGCCTCTAGCCGGCTCTATAAAGAACAATGTCA
  5   1   2      ests                               Xl3.1-XL469d15ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCTCCCCTCCCCCGAAATTTCTCTTCCGTCTTTAAGAAACTACGGTTGCGCTTCAACCTGGAGCCTCAGAGACTCAATGTCAGTCAGCATCTCGCTTCTGCATCACTTCCTTTCTTTATATGGCGTTTTGTCTGTGTTGCTGTTTAGATTAAATAAACTGTTTATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                  CTTGGACACCGTGAAACTGTCTTCGAGTAGAGCGGA
                                                                   SNP                                                                                                                                                                                                                                                                                          ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                      ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T-----T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------T-----
                                               BLH ATG     272     768                                                                              
                                               BLH MIN     260     113                                                                              
                                               BLH OVR     272      42                                                                              
                                               EST CLI     175      20                                                                              
                                               ORF LNG     272       1                                                                              
  5   1   2      ests                               Xl3.1-XL516d06ex.5                                                                              GTTTAGTTCGATTGATATCGAGAGTTAAATATCCACTTATCGGGTATATTTTATAGACGGGAAGGTATTCGCGTCATCGCGTGAGATACTTCACGCTGTTCGCTCCCTGGGGCCTACTTA------------GTCACTTTGTAGACGATCCCTTACGTTCAGTGCTGTTTCAGGAGGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTAAAAAAACAAAAAAATATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACACAAAACAAAAATTTTTTTTTTTTTTTTTGAATGATGCTCAATAGAATCGAAATGTCACTTAGGGGGAGGGGGTCGTATGTGTGCCATTTTCCATTTCCGCATTTTCCATTTCGTTCTAAATTTGCTGAATATCCCCCCCCCACCCCCAGTTTTTTCATACAGGGTCTCTTCCTTCAGTCTTTTTGTATTTTGATTGTTATGATGTAAAACTTGCTTTTATTTTAATATTGATGTCAGTATTTCAACTGCTGTAAAATGATAAAACTTTTATACTTCTATATAAATTCACTAGTAACCTCTTAGTTTTTTTTTTTTTGTTTTTTTTTCCTTTTGCTCTCTGATGCAGGCATGCTTTTTCAAATGTTTAGAACTATATTTTAGCCTCTAGCCGGCTCTATAAAGAACAATGTCA
                                                  Xl3.1-CHK-1012686446                                                                                    TTCGATTGATATCGAGAGTTAAATATCCACTTATCGGGTATATTTTATAGACGGGAAGGTATTCGCGTCATCGCGTGAGATACTTCACGCTGTTCGCTCCCTGGGGCCTACTTATCCGTCCCGGCTGTCACTTTGTAGACGATCxxTxAxGTTCAGTGCTGTTTCAGGAGGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTAAAAAAACAAAAAAATATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACACAAAACAAAAATTTTTTTTTTTxxxTxTGAATGATGCTCAATAGAATCGAAAxxxxxxTTAGGGGxxGGGGGTCGTATGTGTGCCATTTTCCATTTCCGCxxxTTxxATxxxGTTCTAAATTTGCTGAATATCCCCCCCCCACCCCCAGTTTTTTCATACAGGGTCTCTTCCTTCAGTCTTTTTGTATTTTGATTGTTATGATGTAAAACTTGCTTTTATTTTAATATTGATGTCAGTATTTCAACTGCTGTAAAATGATAAAACTTTTATACTTCTATATAAATTCACTAGTAACCTCTTAGTTTTTTTTTTTTTGTTTTTTTTTCCTTTTGCTCTCTGATGCAGGCATGCTTTTTCAAATGTTTAGAACTATATTTTAGCCTCTAGCCGGCTCTATAAAGAACAATGTCATGAATT
  5   1   2       bld Ooc1 5g3  in                      xlnoc002b06.5p TCGGGAACCGAGGAGTGAATACTCGGAGCAACTTAGGCCCTGCCATGTTTCCTGAGGGCAATACCCATGGAAATACGGTTTAGTTCGATTGATATCGAGAGTTAAATATCCACTTATCGGGTATATTTTATAGACGGGAAGGTATTCGCGTCATCGCGTGAGATACTTCACGCTGTTCGCTCCCTGGGGCCTACTTATCCGTCCCGGCTGTCACTTTGTAGACGATCCCTTACATTTAGAGCGCGGCTCCTTTAAATGTATAGCTGGTCGCGGGGCTGCCTGAGTGTAACACTAGGTATTACCCGCCCTGGCACGGTGAAACTTCCTCCGAGAAGAGCGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGTGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGCGAAGGTGGCTTATTCAAATTACNGATGCTTTTTAAGGATGATCATNCCTCGTCACCTCCTAAATGTAAATGTGAGCCACCCCTATTTCATTCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGACGCCAGCTATCACAATTAAACAGATCTTGTATGAATACAAGAACTCCTATATGACCCAATATACTAGATCCAGCTCATGCAGAGCATACACACTTACTGCCTATCAGATTGATATGAAA
  5   1   2       chi Emb9                            IMAGE:7976669.5p                  GGGAAACTTCAGGGGGCTTTGTCCCGAGATAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGCCTTATGTATCCAAGGTGGATGCAAGCAGCCAATTGCTGGCCTTCTCCTGGCACAATTTCTCCTTTGCAAATTTGGCAGCTCAAATGGACGTGGCTGCATATTCTACATACGCATAATGAATGGGCATTTGGCTTTGCAATGAAAGGGATTTCCGACTAATTAAACTGTTCATGGAGGACTTTCGAGTTATACACCTTACATTGCAGTGGACAAAATATGTTAAGAGAAATAAAAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAAGCACAGTGTGTCTGTCTATCTTAAAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTAAGGAATAAAAAACTTTTAAATGAAACAAATATTCAAGATCCAGCTCAA
  5   1   2       bld FaBN 5g                         IMAGE:8076268.5p                          GACTCATTTAGGCCCTGCCATGTTTCCTGAGGGCAATATCCACCTCAAGGCGATTTATTTCGATTGATATCGCGAGTTAAATATCCGCTTATCGGGTATATATGATAAACGGGAAGATATTTGCGTCATCGCGTCTGATACGTTACGCTAAACGCTCCCCGGGGCCTACTTATCCACCCTGACTGACACTTTGTAGACGATCCCTTAAATTTAGAGCGCGGCTCCTTTAAATGTATAGCTGTCCGTGGCGCTGCCTGTGTACAACGCTAGGTATTACCGACTTGGACACCGTGAAACTGTCTTCGAGTAGAGCGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGGATCTTGTTAGGAATACAAGAAACTTCTAAATGAACCAAATTATTCAGGATCCAGCTCAAGCAGAGGCATACAGAATTTACTGGCCAAAACAGGAGTTT
  3  -1   2       bld Tbd4                            IMAGE:4060306.3p                                                                                                                                                                                                              ATTCCCCGGCTTATTTAGTCTGGGTCAGGTTCAGTGCTGTTTCAGGAGGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGACGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTANAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACACGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAA
  5   1   2       bld FaBN 5x3                        IMAGE:8074930.5p                                                                                                                                                                                                                     ttctttttAAGTCNGGGTCAGGTTCAGTGCTGTTTCAGGAGGGAATTTTAAGGGGGCTTTGTCCCGAGACAAAGAGCAGAAATCACCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCTCCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCTTGCAGCATCTAGaaaaaaaaaaaaCAATTAATAATAAAAGGAAGGGATGGTTTGGCAAGACTTGTTACAAATTTTTGCAAATCTGATGATGCCATAGATCGAACTGTCCTAG
  5   1   2       bld Spl  5x3                        IMAGE:8460706.5p                                                                                                                                                                                                                               GTCTGGGTCAGGTTCAGTGCTGTTTCAGGAGGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGAAATCACCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCTTGCAGCATCTaaaaaaaaaaaaCAATAAATAAATAAAAGGAAGGGATTGGTTTGGCAGAACTTGTTTACAAATTTTTGCAAATCTGATGATGCTCATAGATCGAACTGTCCTAGGGNAGGGTCGATGTTGCATTTCATTCGCACTGATAAGTCTATTGCTATTCCCCCCACCAGNTTCACAGTCCTCTCAGCTTGATGATGAGAGACTGCTATAATAGCGT
  5   1   2       bld DMZ  5x3  out                        xl243k11.5p                                                                                                                                                                                                                               GTCTGGGTCAGGTTCAGTGCTGTTTCAGGAGGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaTATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTT
  3   1   2       bld Ga18 5g3  in                      xlk109a04ex.3p                                                                                                                                                                                                                                   CTGGGTCAGGTTCAGTGCTGTTTCAGGAGGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGAAATCACCGNNNNGAGCCCGCATTCTCTGGGGGTGAANNCACCGCAGGAACCCTGAAATGTNNNNATAGNCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCANNNNNAANCCAAGAAG
  5   1   2       bld Egg3 5x3                        IMAGE:6327156.5p                                                                                                                                                                                                                                     CGATTCCCCGGGAGCGCGGCTCCTTTACATGATAGCTGTCCGTGGCGCTGCCTGTGTACAACGCTAGGTATTACCGACTTGGACACCGTGAAACTGTCTTCGAGTAGAGCGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaTATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACACAAAACAAAAttttttttttttttttttttttGCAAAAATTGATTGATGCTCCATAGAATTGAAACTGTCACTTAAGGGAGGGGGGTCGTATGTGGTGCCATTTTCCATTTCCGCCCCTTGTATAGAGGTCTAAATTTGCTGAATATAccccccccccccAGTTTTTTTCTACAAGGGGCCTCTTCCCTTCAGNcttttttggaatttttgaattggttatggagggaaaaactttggctttttattttttAAAAATTGGATGGC
  5   1   2       bld Ga12 5x3                             XL183h16.5p                                                                                                                                                                                                                                     GTCAGGTTCAGTGCTGTTTCAGGAGGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaTATAAAG
  5   1   2       bld Ga18 5g3  in                      xlk109a04ex.5p                                                                                                                                                                                                                                        GGNCAGGTTCAGTGCTGTTTCAGGAGGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGAAATCACCGCCGCNNNNNGCATTCTCTGGGGGTGAAGCCACCGCANAACCCTGAAATGTCTGGCATAGCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTNAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTNGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGNATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGNCAAGAAGTTTGCNNCATCATAAACTTCNACCTTGCAGCATCTaaaaaaaaaa
  5   1   2      seed DMZ  5x3                             xl296b04.5p                                                                                                                                                                                                                                          GTTCAGTGCTGTTTCAGGAGGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaTATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACACAAAACAAAAAtttttttttttttttG
  5   1   2       bld Te2  5x3  out                   IMAGE:7390967.5p                                                                                                                                                                                                                                               TCGGTCCGGATTCCCGGGATCTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGAAATCACCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCTTGCAGCATCTaaaaaaaaaaaaaaaCAAATAAATTAATAAAAAGGAAGGGATTGGTTTGGCAAGAACTGTTTACAAAATTTTTTGCAAAATCTGAATGATGCTNCATAGATCGAAACTGTCACTTAGGGGAGGGGTCGTATGTGTGCATTTTCCCATTTCGCACTGTATAGAGTTCAAATTGCTGATATCCCC
  5   1   2       bld Ooc1 5g3  in                     Ooc1-db28f10.y1                                                                                                                                                                                                                                                GGGTCGACCCACGCGTCCGCTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGAAATCACCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAGAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCAGTAACTGCATCCTTGCAGCATCTGAGAAAAAAAGAAA
  5   1   2       bld Emb1 5g3  in                    IMAGE:3401394.5p                                                                                                                                                                                                                                                   CACGCGTCCGGGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGAAATCACCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTNTGCGCCATCATAAACTTTCACCTTGCAGCATCTaaaaaaaaaaaaCAAAGAAT
  5   1   2       bld Emb1 5x3               IMAGE:3401394-IMAGp.IMAGp                                                                                                                                                                                                                                                             GGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGAAATCACCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCTTGCAGCATCTaaaaaaaaaa
  5   1   2       bld DMZ  5x3                             xl268h21.5p                                                                                                                                                                                                                                                             GGGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaTATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACACAAAACAAAAAttttttttttttttNGCAAAA
  5   1   2       bld Ga15 5x3                           XL510o02ex.5p                                                                                                                                                                                                                                                              GGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaTATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACACAAAACAAAAAtttttttttttttttGCAAAAATTG
  5   1   2       bld Ga15 5x3                           XL429d20ex.5p                                                                                                                                                                                                                                                               GAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                      xlk162a21ex.3p                                                                                                                                                                                                                                                                GGAAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGNNNNGNGCCCGCATTCTCTGGGGGTGAANNCACCGCAGGAACCCTGAAATGTNNNNANAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGNNNNAANCCAAGAAG
  5   1   2       bld Emb1 5x3                        IMAGE:6636641.5p                                                                                                                                                                                                                                                                   CTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGAAATCACCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGACCCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCTTGCACCATCCTAAAAAAACCAACCAATAACTAAATAAACAGGAAGGGATTGGTTTGGAAAGAACTTGTTTACAAAATTTTTTTGCCAAAAATCTGAAATGATGCCTCAATAAAAATCGAAAACTGCTCACTTTAGGGGAAGGGGGCTCGTAATGTGTGCCCATTTTCCCCTTTCCCGCCCCCTTGCTATAAAAGTTCTAAATTTTGGCTGGAATAAcccccccccccACCCCTCCACGGTTTCTTTCCATAACGGGGGGCCCCCCTCCCTTTCAAGCCCTCTTTTTGCCACTTTTGGATTTCGCCCCCGCACTGTAAAAACCTTGGCCTTTCACTATTTAACAAATTTGCCGTGGCCCATACCTCTCTACAACTGGTTTGCCCACAATTGATTACCCN
  5   1   2       bld Emb1 5x3               IMAGE:6636641-IMAGp.IMAGp                                                                                                                                                                                                                                                                   CTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGAAATCACCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCTTGCAGCATCTaaaaaaaaaaaacaaataaataaataaaaaGGAAGGGATTGGTTTGGCAAGAACTTGTTTACAAAATTTTTTGCAAAAAATCTGAATGATGCTCAATAGAATCGAAACTGTCACTTA
  5   1   2       bld Ga15 5x3                           XL516d06ex.5p                                                                                                                                                                                                                                                                   CTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaTATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACACAAAACAAAAAtttttttttttttttGCAAAAATTGAT
  5   1   2       bld Ga18 5g3  in                      xlk162a21ex.5p                                                                                                                                                                                                                                                                   GGAANCTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCNNNNNGCATTCTCTGGGGGTGAAGCCACCNCNNNACCCTGAAATGTCTGGCATAGCNTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGNAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGNNATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaaaa
  5   1   2       chi Emb4                            IMAGE:5572226.5p                                                                                                                                                                                                                                                                    TTCACGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGGGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCCTAATGACCCAAATAATCCAGATCCAGCTCAAGCAAAGGCCTACCCAATTTACTGCCCAAACAGGACCGGAATATGGAAAAAGGAGTCACCACCAAAGGCCAAGAAATTTTGGCGGCATCCTAAGACTTTCCACCGGTGCACGATTTTTTTACAATCACCCACCAGCTATTAAAGGGAACCGTGTTTGGGTTTGGGCAAAGACACCTGCTTCTACCACAAACCAGCAGAAACCGTTCTTTCTATCTTCTGGCAAAAGACTTGGCTCGGACGGGTCCTATAGGGAAGGGGAAACATGGTGCCCCTCTAGCGCGGAAGGGGCGCCCCCCCTATGGAGTAAGCCCGATACTCTGCCACCCTTAACAGCGACATGCTCGATCCCGCCAGCGCTCGCAAACGGCGGGCAGTAGGGAATAAGACACCCCGCTccccccccGCCGATGGTCGTCTCTCACCCCCGCGTATGCGCACCACGTCGCCTccccccccACAAGCGCTTCGCATCAGCTGACCCGCAACGGCCGCGATCGAGTATCCAGCGACAAGCCGACACATGAACACCCCGTCTCTCCATAG
  5   1   2       bld Ga18 5x3                          xlk165n21ex.5p                                                                                                                                                                                                                                                                    AAACTTCAGGGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCNNNNNGCATTCTCTGGGGGTGAAGCCACCNNNNNACCCTGAAATGTCTGGCATAGCNNTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGNAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGNCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCNAGATCCAGCTCAAGCAGAGGNATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGNCAAGAAGTTTGNGNCATCATAAACTTCAACCGTGCAGCATCTTaaaaaacaaaaaaTATAAAGGNNG
  5   1   2       bld DMZ  5x3                             xl340i05.5p                                                                                                                                                                                                                                                                         GGGGCTTTGTCCCGAGACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaTATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACACAAAACAAAAAttttttttttttttttG
  5   1   2       bld Tbd7 5x3                             XL078p01.5p                                                                                                                                                                                                                                                                           CTTTGTCCCGAGNACAAAGNAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaTATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTA
  5   1   2       bld Ga12 5x3                             XL213c06.5p                                                                                                                                                                                                                                                                                CGAGGCCGAGACAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaTATAAAGGGAA
  5  -1   2       chi Emb1                            IMAGE:6633748.5p                                                                                                                                                                                                                                                                                        TAGAGTGttttttttGACACCGATAGCCCCCCCTGAAAGCGGGGGATCTTGTTCCCTCCGGGGAGAGAGAAAAAAATCTCTTGGGGGGGAAAAAGGGACCCCACCCCCTTTTTGGGTTTGTGGGGGCCCAGTTCCCCACGGGAAAAAAATCCCAGGAGGGCCCCCAAGGAATTTTGATGAAACTGGGGAATTGTGTTATTCCAGGCCAAGGAAAGGGGAACCCCAGGGGAAAGTTGGATTTTTTAAATTACGGATGCTTTTTAAGGAGGATTATCCCTCCTCCCCTCCTAAAGGTAAATTGGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAACATCTTaaaaaaacaaaaaaaTATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACACAAAACAAAAttttttttttttttttttGCTAAAATTGATTGATGCTCCATAGAATTGAAACTGTCACTTAGGGGAGGGGGTCGTATGTGTGCCATTTTCCATTTCCGCCACTTGTATAGAGTTCTAAATTTGCTGAATATAccccccccccAGTTTTTTCATACAGGGTCTCTTCCTTCAGTCTTTTTGTATTTTGATTGTTATGATGTAAAACTTGCTTTTATTTTAATATTGATGTCAGTATTTCAACTGCTGTAAAATGATAAAACTTTTATACTTCTAT
  5   1   2       bld Gas6 5x3                        IMAGE:3474689.5p                                                                                                                                                                                                                                                                                         ACAAAGAGCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCA
  5   1   2       bld Ga15 5g3  in                       XL486l24ex.5p                                                                                                                                                                                                                                                                                         ACAAAGAGCAGAAATCACCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCTTGCAGCATCTaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL486l24ex.3p                                                                                                                                                                                                                                                                                         ACAAAGAGCAGAAATCACCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTT
  5   1   2       bld Neu7 5x3                             XL022b02.5p                                                                                                                                                                                                                                                                                                GCAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaTATAAAGGA
  5   1   2       bld Ga12 5x3                             XL194d06.5p                                                                                                                                                                                                                                                                                                 CAGTAATCGCCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaTATAAAGG
  5   1   2       bld Ga15 5g3  in                       XL469d15ex.5p                                                                                                                                                                                                                                                                                                 CAGAAATCACCGCCGCGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCTTGCAGCATCTaaaaaaaaaa
  5   1   2       bld Ga18 5x3                          xlk142i03ex.5p                                                                                                                                                                                                                                                                                                  AGAGCAGAAATCACCGCCNCNNNNNNCATTCTCTGGGGGTGAAGNCACCNNNNNACCCTGAAATGTCTGGCATAGCNTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGNATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGNCAAGAAGTTTGCGCCATCATAAACTTCAACCTTGCAGCATCTaaaaaaaaaa
  5   1   2       bld Oo1  5x3                        IMAGE:6638638.5p                                                                                                                                                                                                                                                                                                       TCCTCCCACGCCCTGGACACGGTGAAACTTTCTCCGAGAAGAGCGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCTTGCAGCATCTaaaaaaaaaaaaaaaaCAAATAAATAAATAAAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACAAAATTTTTTGCANTTCTTGAAATGGATGGCTCCANNNGNNCNccccnnccccccccttccnctcttccgtcttccccccccccttcccccctccttccttccccttcccccccttctcttgccctttccccctnctttctctccctccctctcttcctcctgccctTTGCCGTCCTGGTGTGGGCTCCGCCGCTTCCTCCGCCCCCCTTCGGTTTTGTGTTCTGTTTCCGCCTCCGCTCCCCCCGGCAGCCTTCTTGCGTGCCNCACTGCTCTcccccccccccTCTCCCCGTTTATTCCTCCATCTCCACAACCAATACAACGCTGTCTATCCACTCTATTTGCCACATCTCCACCCCACACCCGTGACTCTCCAATTTGCGCGACGTCACCTCCACTATCACAAA
  5   1   2       bld Egg1 5x3                           PBX0145G01.5p                                                                                                                                                                                                                                                                                                          TTACCCGCCCTGGACACGGTGAAACTTCCTCCGAGAAGAGCGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCTTGCAGCATCTaaaaaaaaaaaaaaaaaaGATTC
  5   1   2       bld Ga18 5x3                           xlk69a15ex.5p                                                                                                                                                                                                                                                                                                           TATTACCCGCCCTGGACACGGTGNNNNNCCTCCGAGAAGAGCGGAACCCTGAAATGTCTGGCATAGCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGNNGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTNAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATANGGATTGGAGGNCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGNATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGNCAAGAAGNTTGCGCCATCATAAACTTCAACCTTGCAGCATCTaaaaaaaaaa
  5   1   2       bld Ga15 5x3                           XL401h12ex.5p                                                                                                                                                                                                                                                                                                             TCCGGGAGCCCGCATTCTCTGGGGGTGAAGCCACCGCAGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCTTGCAGCATCTaaaaaaaaaa
  5   1   2       bld Egg1 5g                            PBX0085E06.5p                                                                                                                                                                                                                                                                                                                  CTTGGACACCGTGAAACTGTCTTCGAGTAGAGCGGAACCCTGAAATGTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACA
  3   1   2       bld Ooc1 5g3  in                      xlnoc002b06.3p                                                                                                                                                                                                                                                                                                                                                   GGAACCCTGAAATGTCTGGCATAGCCTTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCCTGGGAAGGTGGCTTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCGTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCATCCGAATGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCTTGCAGCATCTAA
  5   1   2       bld Egg3                            IMAGE:3379069.5p                                                                                                                                                                                                                                                                                                                                                                GTCTGGCATAGCCCTGAGCAGACTTGCACAGGAGAGAAAAGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATCTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGACCCCCT
  5   1   2       bld Ga15                               XL423o24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                    CTCCGCTTGGAGAAAAGACCATCCTTTTGGTTTTGTGGCAGTACCAACGAAAAATCCAGATGGCACAATGAATTTGATGAACTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAACATCTTaaaaaaacaaaaaaaTATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACACAAAACAAAAtttttttttttttttttttGCAAAANTNG
  5   1   2       bld Ga15                               XL444m18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGGAATGTGCTATTCCAGGCAAGAAAGGGACCCCATGGGAAGGTGGATTATTTAAATTACGGATGCTTTTTAAGGATGATTATCCCTCCTCACCTCCTAAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaaaa
  5   1   2       bld Ga15                               XL430d20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGACCCCATGGGAAGGTGGATTATTTANATTACNGATGCTTTTTNAGGATGATTATCCCTCCTCNCCTCCTNAATGTAAATTTGAGCCACCCCTATTTCACCCGAACGTCTATCCTTCAGGCACAGTGTGTCTGTCTATCTTAGAAGAAGATAAGGATTGGAGGCCAGCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaaaa
  5   1   2       bld Ga15                               XL511o02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTGGAGGCCNNCAATCACAATTAAACAGATCTTGTTAGGAATACAAGAACTTCTANGTGAACCAAATATTCAAGATCCAGCTCAAGCANGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCGTGCAGCATCTTaaaaaaacaaaaaaaTATAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACACAAAACAAAAAtttttttttttttttNCNA
  3   1   2       bld Ov1                             IMAGE:4055802.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGATCTTGTTAGGAATACAAGAACTTCTAAATGAACCAAATATACAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATATGAAAAAAGAGTCAGAGCACAAGCCAAGAAGTTTGCGCCATCATAAACTTCAACCTTGCAGCATCTAAAAAAAAAAAACAAATAAATAAATAAAAAGGAAGGGATTGGTTTGGCAAGAACTTGTTTACAAAATTTTTTGCAAAAATCTGAATGATGCTCAATAGAATCGAAACTGTCACTTAGGGGAGGGGGTCGTATGTGTGCCATTTTCCATTTCCGCCACTTGTATAGAGTTCTAAATTTGCTGAATATCCCCCnCCCCACCCCCAGTTTTTTCATACAGGGTCTCTTCCTTCAGTCTTTTTGTATTTTGATTGTTATGATGTAAAACTTGCTTTTATTTTAATATTGATGTCAGTATTTCAACTGCTGTAAAATGATAAAACTTTTATACTTCTATATAAATTCACTAGTAACCT
  5   1   2       bld Egg6                            IMAGE:4435385.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAAGAACTTCTAAGTGAACCGAGTATTCAAGATCCAGCTCAAGCAGAGGCATACACAATTTACTGCCAAAACAGAGTTGAATAGGAAAGAAGAGTCAGAGCACAAGCCGAGAAGTTTGCGCCATCA
  5   1   2       bld Egg1                               PBX0155G05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTTACAAAATTTTTTGCAAAAATCTGAATGATGCTCAATAGAATCGAAACTGTCACTTAGGGGAGGGGGTCGTATGTGTGCCATTTTCCATTTCCGCCACTTGTATAGAGTTCTAAATTTGCTGAATATcccccccccacccccAGTTTTTTCATACAGGGTCTCTTCCTTCAGTCTTTTTGTATTTTGATTGTTATGATGTAAAACTTGCTTTTATTTTAATATTGATGTCAGTATTTCAACTGCTGTAAAATGATAAAACTTTTATACTTCTATATAAATTCACTAGTAACCTCTTAGtttttttttttttgtttttttttCCTTTTGCTCTCTGATGCAGGCATGCTTTTTCAAATGTTTAGAACTATATTTTAGCCTCTAGCCGGCTCTATAAAGAACAATGTCATGAATTCCAccccctcccctccccGAAATTTCTCTTCCGTCTTTAAAAAACTAC
  5   1   2       bld Egg1                               PBX0149F07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCAATAGAATCGAAACTGTCACTTATGGGAGGGGGTCGTATGTGTGCCATTTTCCATTTCCGCCACTTGTATAGAGTTCTAAATTTGCTGAATATcccccccccacccccAGTTTTTTCATACAGGGTCTCTTCCTTCAGTCTTTTTGTATTTTGATTGTTATGATGTAAAACTTGCTTTTATTTTAATATTGATGTCAGTATTTCAACTGCTGTAAAATGATAAAACTTTTATACTTCTATATAAATTCACTAGTAACCTCTTAGtttttttttttttggttttttttccttttGCTCTCTGATGCAGGCATGCTTTTTCAAATGTTTAGAACTATATTTTAGCCTCTAGCCGGCTCTATAAAGAACAATGTCATGAATTCCACCC
  5   1   0       add Ga18                              xlk161o08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATTGATTGATGCTCCATAGAATTGAAACTGTCACTTAGGGGAGGGGGTCGTATGTGTGCCATTTTCCATTTCCGCCACTTGTATAGAGTTCTAAATTTGCTGAATATAccccccccccccccccNGNTTTTTCCT
  3   1   2       add Ga15                               XL432b03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAGAATTGAAACTGTCACTTAGGGGAGGGGGTNGTANGTGTGCCATTTTCCATTTCCGCCNCTTGTATAGAGTTTTAAATTTGCTGAANATACCCCCCCCCCCAGTTTTTTCATACAGGGTCTCTTCCTTCAGTCTTTTTGTATTTTGATTGTTATGATGTAAAACTTGCTTTTATTTTAATATTGATGTCAGTATTNCAACTG
  5   1   2       add Ga18      out                     xlk156d22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTCGTATGTGTNCCATTTTCCATTTCCGCCACTTGTATAGAGTTCTAAATTTGCTGAATATAccccccccccAGNTTTTTCNTACAGGGNCTCTTCCTTCAGGCTTTTTGTATTTTGATTGTTATGATGTAAAACTTGCTTTTATTTTAATATTGATGTCAGGATTTCAACTGCTGTNAAANGATAAAACTTTTATACTTCTATAAACCCACTAGNAACCTCTAGGTTTTCCTTTTGCTCTCCGATGCAGGCNTNNNTTTCAAATGTTT
  5   1   2       bld Egg1                               PBX0149F03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTGAATATcccccccccacccccAGTTTTTTCATACAGGGTCTCTTCCTTCAGTCTTTTTGTATTTTGATTGTTATGATGTAAAACTTGCTTTTATTTTAATATTGATGTCAGTATTTCAACTGCTGTAAAATGATAAAACTTTTATACTTCTATATAAATTCACTAGTAACCTCTTAGGttttttttttttttgttttttttCCTTTTGCTCTCTGATGCAGGCATGCTTTTTCAAATGTTTAGAACTA
  5   1   2      ests                               Xl3.1-XL469d15ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCTCCCCTCCCCCGAAATTTCTCTTCCGTCTTTAAGAAACTACGGTTGCGCTTCAACCTGGAGCCTCAGAGACTCAATGTCAGTCAGCATCTCGCTTCTGCATCACTTCCTTTCTTTATATGGCGTTTTGTCTGTGTTGCTGTTTAGATTAAATAAACTGTTTATA
                                                  Xl3.1-CHK-1012703364                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTCCCCCGAAATTTCTCTTCCGTCTTTAAGAAACTACGGTTGCGCTTCAACCTGGAGCCTCAGAGACTCAATGTCAGTCAGCATCTCGCTTCTGCATCACTTCCTTTCTTTATATGGCGTTTTGTCTGTGTTGCTGTTTAGATTAAATAAACTGTTTATAGAAAGT
  3   1   2      seed Ga15 5g3  in                       XL469d15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TNTTNTTTTTTTTTTTTTTTTTTTNTTCCTTTTGCTCTCTGATGCAGGCATGCTTTTTCAAATGTTTAGAACTATATCTTAGCCTCTAGCCGGCTCTATAAAGAACAATGTCATGAATTCCACCCCCTCCCCTCCCCCGAAATTTCTCTTCCGTCTTTAAGAAACTACGGTTGCGCTTCAACCTGGAGCCTCAGAGACTCAATGTCAGTCAGCATCTCGCTTCTGCATCACTTCCTTTCTTTATATGGCGTTTTGTCTGTGTTGCTGTTTAGATTAAATAAACCTGTTTATAGAAAGTTTTTTTT
  3   1   2       bld Ooc1 5g3  in                     Ooc1-db28f10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGCCGGCTATATAAAGAACAATGTNATGAATTCCACCCCCTCCCCTCCCCGAAATTTCTCTTCCGTCTTTAAGAAACTACGGTTGCGCTTCAACCTGGAGCCTCAGAGACTCAATGTCAGTCAGCATCTTGCTTCTGCATCACTTCCTTTCTTTATATGGCGTTTTGTCTGTGTTGCTGTTTAGATTAAATAAACTGTTTATAGAAAGTTAAAAAAAAAA
  3  -1   0       add DMZ                                 rxl278k10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAATTCCACCCCCTCCCCTCCCCGAAATTTTCTTTTTACGNCTTTAAGAAACTAGGTTGCGCTTCANCCNANAGCCNCANANATTCAATGTCAGTCCGCANCTCGCTNCNGCATCACTTCCTTTTTGTTTATATGGCGTTCT
  3  -1   1       add DMZ                                 rxl278m10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATTCCACCCCCTCCCCTCCCCGAAATTTTCNTTTTACGTCTTTAANAAACTAGGTTGCGCTTCANCCTANAGCCTCANANATTCAATGTCAGTCCGCATCTCGCTNCNGCATCACTTCCTTTTTGTTTATATGGCGTTCTGNCNCTGTTGCTGTTTAGATTAAATAAACNGNTTATATAAAGTTTTTTTTTTTTTTTTTTTTNCNTNNAAGGGNCCCCAAAAAAACC
  3   1   2       bld Emb1 5g3  in                    IMAGE:3401394.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCTCCCCTCCCCCGAAATTTCTCTTCCGTCTTTAAGAAACTACGGTTGCGCTTCAACCTGGAGCCTCAGAGACTCAATGTCAGTCAGCATCTCGCTTCTGCATCACTTCCTTTCTTTATATGGCGTTTTGTCTGTGTTGCTGTTTAGATTAAATAAACTGTTTATAGAAAGTTTTTTTTGTTTCTTTATCTTTTTCATTAAAAGGACCACAGAGCGGAAGTGTTCAGCCTTGTGAACTGACATTGTGACTTTTTTTTTTTCTTCTTCTTTCGTGTGTGAAATCTGTATATTATATATATATAAAAACAACAAAAAACTTTTTATAACTGTTCTATTCTTGCTGCGCCGTGAAAAAAAAAAAGGATGAGCGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)