Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL519f14ex.5                         88 END     1           1        1                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:5083691.5                      27 END     1           1        3                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xl341j19.5                            9 PI      80       3391     3794                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012837375 Xl3.1-IMAGE:6957465.3.5 - 67 ESTs
                                                                       .....-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6957465.3.5                                                                                                                                                                                                                                                                                                                            GACGATATGGACGGGAAAATGAAACAGCAAAAGAACCTGACTGGGACCCTGTTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTGCAGTTCGGATATGGTATTGGTGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACACGGGTTTTACTAGAAGGCAGTGCAAATGAGACCGATACAAAATCTGTACAACCGTCTGTCAAAATGTACTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGAGGGATGGTGTCTTCATTCTTTGTTGGATGGATTGCAGATAAACTGGGAAGGATAAAAGCCATGATGGCTGTAAACAGTCTGGCAGTTATTGGGGCTATTCTGATGGGGCTGGCTCCCTTAGGTCAAGCACATGCTCTTGTCATTGCTGGCAGATTAATTACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTCGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACGTTGCATCAGTTGGCTATTGTCACAGGGATTCTCATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGTAGTGAGACTCTTTGGCCTGTTCTGTTAGGCTTGTCGGGAGTCCCTGCTATTGTGCAGACCATCCTGCTGTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGATGGAAGCAGCTAAAAGAAACTTAATAAGGCTCAGAGGAGACTATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGTCGAAAGTGAAAAAAAAGTGTCTATCATACAGTTATTCAAGTCTTCTAATTACCGCCAGCCTCTAATTGTTTCTCTTGTGCTTCATATCTCTCAGCAGTTTTCCGGAATCAATGGGATCTTTTACTACTCTACAAGCATCTTTACTAGAGCGGGTATTAGCCAACCAGTATATGCAACTATTGGAGTCGGCGCTGTTAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTATAGAGAAGGCAGGTAGAAGATCCCTCTATCTGGTTGGCTTAGCCGGCATGGGCATCTGCGCTATTGTTATGACTATTGCGTTGGCACTTCTGACTCAGCATGCTTGGATGAGTTACCTAAGTATGGTCGCCATTTTCCTTTTCGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTCGCAGAATTGTTCAGTCAAGGTCCACGACCTGCAGCTATGGCAGTGTCTGGGTGCTGTAACTGGACATGCAACTTTATCATTGGGATGTGTTTTGAATACATAGCTGATGCCTGTGGGCCATATGTATTCATCATTTTTGCTGTACTCCTTTTTATATTCACCATTTTCACATACTTTAAAGTCCCGGAGACTAAGGGCAAGTCATTTGATGAGATAGCTGCCGAGTTCCGAAAGAAGAAACTTGCATCCCGCAAAGGACTTAAATCGACTGAAATGGAGTATCTGGGAACCAGTTCGGAAGCATAAATATTTCCAGCAAGTGCAAAAATTAAAACA------------------------------------------------------------TGCAATGTTTTTATAGACACTTATTTTTATTATGCTAAACTAAAGAAGAGGGTGTGCTTGAGTTTGTGGACGCTTAAAAGAGATAGAGAGGTGTCTAATCAAAGTCCTTCAGCTGCTGTACAACTCCCATGAGCCTAAGGATGTAAATAATGAGAATGGCAGTTGCACAACAGCTTTGAAGCCAAAGATGCAATCTCTGTATTCAAAATAACACAGCTTTGTTACTGTCCTTTACAAGGAATGCTTGTGTTGGCGCAGAAACCAGTGATATCTTTATAAGTCTAAAGGATCTGCAGAGTTGCAACCTGGTGATTATCCCATGTCTCATAGAAAGCCTCCATCCCTATGTTTTTGTATTTACCATGGTTTCTACAGTGGTTTTACATGGTTTGCGCAGGAATATTTACTTTAAATATATAAGTGGCTGTGAACAAGAGGGGTTATGGTAAAAACACAGCACCACGGAAGGAAGTGGCAGTCCATCTTACAAAATTAGCACCAGGGTAATTTTAAGATATTTTCTATTTATATTGAATGAGTCAATACCAGTAGGTGTTCCTGGCATATCTGTTATACAGATATCCTTAAAACAGGAATTCCTGATGATTCTAAGGACATGTCTCAGAAACAATGGATACAAAATATCTTACATAGCATTTGCAAACCTACAAAAAGAACAAAAACTGTTCAAAAATATTATCCAATGACACTAAATGCCGCCTTCAGCATGACACCTACTCATTTAAAACACTATAGCCAAAACGTATTTTAATATTCTATATTAAGTATAAATGTGTGCCAGTGTGAACAAAAGGAACAACACTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAACCTTTAGAATCCCAAAATTTTAATCTGCCCCTAATGTCTGCCTGTAAAACTATATCTGCAATACATCCTATTATAATATTATGGCGTGTTATCATAGAAACACAGCTTGTGATTTAGCTAGAGGTTCTGTGTAACTGATTAGCATGACCAGACACCAAGTTGTTGGTAGCTATATGCTCATTTATTTCACTACCTGTACCAGTCTGTTACAACTAAACATCCCAGTCAGCATCTGGCTTATATAGATTATCATACAGGTTAATTCGTTTTCATCATGAATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTAAAAAAATCTTGGGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTGCTTTAATTTCTATACTGTAGCCTAATGTAAATGGTTAGATCCTCCAATTATTGGGCCTGAACCTTATTTTGTCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAATGAATTTAAATTAAAATAAACATTTGGTTT
                                                  Xl3.1-CHK-1012722192                                                                                                                                                                                                                                                                                                                                  ATGGACGGGAAAATGAAACAGCAAAAGAACCTGACTGGGACCCTGTTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTGCAGTTCGGATATGGTATTGGTGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACACGGGTTTTACTAGAAGGCAGTGCAAATGAGACCGATACAAAATCTGTACAACCGTCTGTCAAAATGTACTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGAGGGATGGTGTCTTCATTCTTTGTTGGATGGATTGCAGATAAACTGGGAAGGATAAAAGCCATGATGGCTGTAAACAGTCTGGCAGTTATTGGGGCTATTCTGATGGGGCTGGCTCCCTTAGGTCAAGCACATGCTCTTGTCATTGCTGGCAGATTAATTACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTCGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACGTTGCATCAGTTGGCTATTGTCACAGGGATTCTCATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGTAGTGAGACTCTTTGGCCTGTTCTGTTAGGCTTGTCGGGAGTCCCTGCTATTGTGCAGACCATCCTGCTGTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGATGGAAGCAGCTAAAAGAAACTTAATAAGGCTCAGAGGAGACTATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGTCGAAAGTGAAAAAAAAGTGTCTATCATACAGTTATTCAAGTCTTCTAATTACCGCCAGCCTCTAATTGTTTCTCTTGTGCTTCATATCTCTCAGCAGTTTTCCGGAATCAATGGGATCTTTTACTACTCTACAAGCATCTTTACTAGAGCGGGTATTAGCCAACCAGTATATGCAACTATTGGAGTCGGCGCTGTTAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTATAGAGAAGGCAGGTAGAAGATCCCTCTATCTGGTTGGCTTAGCCGGCATGGGCATCTGCGCTATTGTTATGACTATTGCGTTGGCACTTCTGACTCAGCATGCTTGGATGAGTTACCTAAGTATGGTCGCCATTTTCCTTTTCGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTCGCAGAATTGTTCAGTCAAGGTCCACGACCTGCAGCTATGGCAGTGTCTGGGTGCTGTAACTGGACATGCAACTTTATCATTGGGATGTGTTTTGAATACATAGCTGATGCCTGTGGGCCATATGTATTCATCATTTTTGCTGTACTCCTTTTTATATTCACCATTTTCACATACTTTAAAGTCCCGGAGACTAAGGGCAAGTCATTTGATGAGATAGCTGCCGAGTTCCGAAAGAAGAAACTTGCATCCCGCAAAGGACTTAAATCGACTGAAATGGAGTATCTGGGAACCAGTTCGGAAGCATAAATATTTCCAGCAAGTGCAAAAATTAAAACAGTCATTTTTAAAAAAAAATATCTATACATATACACGATATACAGGGTATTACCAGACGACTGCAATGTTTTTATAGACACTTATTTTTATTATGCTAAACTAAAGAAGAGGGTGTGCTTGAGTTTGTGGACGCTTAAAAGAGATAGAGAGGTGTCTAATCAAAGTCCTTCAGCTGCTGTACAACTCCCATGAGCCTAAGGATGTAAATAATGAGAATGGCAGTTGCACAACAGCTTTGAAGCCAAAGATGCAATCTCTGTATTCAAAATAACACAGCTTTGTTACTGTCCTTTACAAGGAATGCTTGTGTTGGCGCAGAAACCAGTGATATCTTTATAAGTCTAAAGGATCTGCAGAGTTGCAACCTGGTGATTATCCCATGTCTCATAGAAAGCCTCCATCCCTATGTTTTTGTATTTACCATGGTTTCTACAGTGGTTTTACATGGTTTGCGCAGGAATATTTACTTTAAATATATAAGTGGCTGTGAACAAGAGGGGTTATGGTAAAAACACAGCACCACGGAAGGAAGTGGCAGTCCATCTTACAAAATTAGCACCAGGGTAATTTTAAGATATTTTCTATTTATATTGAATGAGTCAATACCAGTAGGTGTTCCTGGCATATCTGTTATACAGATATCCTTAAAACAGGAATTCCTGATGATTCTAAGGACATGTCTCAGAAACAATGGATACAAAATATCTTACATAGCATTTGCAAACCTACAAAAAGAACAAAAACTGTTCAAAAATATTATCCAATGACACTAAATGCCGCCTTCAGCATGACACCTACTCATTTAAAACACTATAGCCAAAACGTATTTTAATATTCTATATTAAGTATAAATGTGTGCCAGTGTGAACAAAAGGAACAACACTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAACCTTTAGAATCCCAAAATTTTAATCTGCCCCTAATGTCTGCCTGTAAAACTATATCTGCAATACATCCTATTATAATATTATGGCGTGTTATCATAGAAACACAGCTTGTGATTTAGCTAGAGGTTCTGTGTAACTGATTAGCATGACCAGACACCAAGTTGTTGGTAGCTATATGCTCATTTATTTCACTACCTGTACCAGTCTGTTACAACTAAACATCCCAGTCAGCATCTGGCTTATATAGATTATCATACAGGTTAATTCGTTTTCATCATGAATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTAAAAAAATCTTGGGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTGCTTTAATTTCTATACTGTAGCCTAATGTAAATGGTTAGATCCTCCAATTATTGGGCCTGAACCTTATTTTGTCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAATGAATTTAAATTAAAATAAACATTTGGTTTTTAATT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                 4     5     6     6     6     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     6     7     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     4     5     4     5     3     4     2     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     5     2     5     2     5     2     4     2     4     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     0     0     0     0     0     0     0     0     0     0     2     2     2     2     1     1     3     3     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     6     6     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     6     5     6     7     7     7     7     8     8     8     8     8     8     9     9     9    10     9    10     9    10     8     9     9    10    11    11    11    11    11    11    11    11    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     9     8     9     9     9    11    11    10    10    10    10    11    11     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    10    11    10    11    10    12    11    12    11    12    11    12    11    12    10    11    12    13    12    13    15    15    15    16    14    15    14    15    18    19    19    20    19    20    21    22    24    25    25    26    25    26    25    27    27    28    28    28    29    29    30    30    31    32    32    33    32    35    31    33    30    34    33    35    33    35    33    35    34    36    32    37    34    37    33    36    33    37    33    36    33    36    33    36    33    36    33    36    33    36    32    35    32    35    32    35    31    35    32    35    31    35    32    35    30    33    30    33    30    32    29    31    29    31    26    31    27    31    29    31    27    30    27    29    25    28    25    27    25    27    23    26    22    25    20    24    14    19    11    15     4     9     4     4
  5   1   2      ests                            Xl3.1-IMAGE:6952949.5                                                                                                                                                                                                                                                                                                                            GACGATATGGACGGGAAAATGAAACAGCAAAAGAACCTGACTGGGACCCTGTTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTGCAGTTCGGATATGGTATTGGTGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACACGGGTTTTACTAGAAGGCAGTGCAAATGAGACCGATACAAAATCTGTACAACCGTCTGTCAAAATGTACTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGAGGGATGGTGTCTTCATTCTTTGTTGGATGGATTGCAGATAAACTGGGAAGGATAAAAGCCATGATGGCTGTAAACAGTCTGGCAGTTATTGGGGCTATTCTGATGGGGCTGGCTCCCTTAGGTCAAGCACATGCTCTTGTCATTGCTGGCAGATTAATTACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTCGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACGTTGCATCAGTTGGCTATTGTCACAGGGATTCTCATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGTAGTGAGACTCTTTGGCCTGTTCTGTTAGGCTTGTCGGGAGTCCCTGCTATTGTGCAGACCATCCTGCTGTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGATGGAAGCAGCTAAAAGAAACTTAATAAGGCTCAGAGGAGACTATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGTCGAAAGTGAAAAAAAAGTGTCTATCATACAGTTATTCAAGTCTTCTAATTACCGCCAGCCTCTAATTGTTTCTCTTGTGCTTCATATCTCTCAGCAGTTTTCCGGAATCAATGGGATCTTTTACTACTCTACAAGCATCTTTACTAGAGCGGGTATTAGCCAACCAGTA
  5   1   2      ests                            Xl3.1-IMAGE:6957465.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAAACTAAAGAAGAGGGTGTGCTTGAGTTTGTGGACGCTTAAAAGAGATAGAGAGGTGTCTAATCAAAGTCCTTCAGCTGCTGTACAACTCCCATGAGCCTAAGGATGTAAATAATGAGAATGGCAGTTGCACAACAGCTTTGAAGCCAAAGATGCAATCTCTGTATTCAAAATAACACAGCTTTGTTACTGTCCTTTACAAGGAATGCTTGTGTTGGCGCAGAAACCAGTGATATCTTTATAAGTCTAAAGGATCTGCAGAGTTGCAACCTGGTGATTATCCCATGTCTCATAGAAAGCCTCCATCCCTATGTTTTTGTATTTACCATGGTTTCTACAGTGGTTTTACATGGTTTGCGCAGGAATATTTACTTTAAATATATAAGTGGCTGTGAACAAGAGGGGTTATGGTAAAAACACAGCACCACGGAAGGAAGTGGCAGTCCATCTTACAAAATTAGCACCAGGGTAATTTTAAGATATTTTCTATTTATATTGAATGAGTCAATACCAGTAGGTGTTCCTGGCATATCTGTTATACAGATATCCTTAAAACAGGAATTCCTGATGATTCTAAGGACATGTCTCAGAAACAATGGATACAAAATATCTTACATAGCATTTGCAAACCTACAAAAAGAACAAAAACTGTTCAAAAATATTATCCAATGACACTAAATGCCGCCTTCAGCATGACACCTACTCATTTAAAACACTATAGCCAAAACGTATTTTAATATTCTATATTAAGTATAAATGTGTGCCAGTGTGAACAAAAGGAACAACACTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAACCTTTAGAATCCCAAAATTTTAATCTGCCCCTAATGTCTGCCTGTAAAACTATATCTGCAATACATCCTATTATAATATTATGGCGTGTTATCATAGAAACACAGCTTGTGATTTAGCTAGAGGTTCTGTGTAACTGATTAGCATGACCAGACACCAAGTTGTTGGTAGCTATATGCTCATTTATTTCACTACCTGTACCAGTCTGTTACAACTAAACATCCCAGTCAGCATCTGGCTTATATAGATTATCATACAGGTTAATTCGTTTTCATCATGAATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTAAAAAAATCTTGGGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTGCTTTAATTTCTATACTGTAGCCTAATGTAAATGGTTAGATCCTCCAATTATTGGGCCTGAACCTTATTTTGTCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAATGAATTTAAATTAAAATAAACATTTGGTTTTTAATTTCAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -T--T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------A----
                                               BLH ATG       6     812                                                                                                                                                                                                                                                                                                                            
                                               BLH OVR       6      87                                                                                                                                                                                                                                                                                                                            
                                               EST CLI      -8      87                                                                                                                                                                                                                                                                                                                            
                                               ORF LNG       6      18                                                                                                                                                                                                                                                                                                                            
                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 4e-099     NP_493982.1 solute carrier family 2 member 3 (2B799) [Caenorhabditis elegans] --------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                         PROTEIN --- Ag ---- 4e-122     XP_308485.4 AGAP007340-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PREDICTED - Sp ---- 4e-122     XP_001185716.1 PREDICTED: similar to glucose transporter [Strongylocentrotus purpuratus] ------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN --- Dm ---- 2e-122     NP_001097469.1 Glucose transporter 1 CG1086-PF, isoform F [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Bt ==== 3e-168     NP_001096692.1 solute carrier family 2 (facilitated glucose transporter), member 2 [Bos taurus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 0          NP_001036186.1 solute carrier family 2 (facilitated glucose transporter), member 2 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 0          NP_112474.2 solute carrier family 2 (facilitated glucose transporter), member 2 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 0          XP_545289.2 PREDICTED: similar to Solute carrier family 2, facilitated glucose transporter, member 2 (Glucose transporter type 2, liver) [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 0          NP_000331.1 solute carrier family 2 (facilitated glucose transporter), member 2 [Homosapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Gg ==== 0          NP_997061.1 solute carrier family 2 (facilitated glucose transporter), member 2 [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Xt ==== 0          NP_001011453.1 hypothetical LOC496943 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 0          NP_001084982.1 solute carrier family 2 (facilitated glucose transporter), member 2 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                               Xl3.1-IMAGE:6957465.3.5                                                                                                                                                                                                                                                                                                                                  ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------ATGATG------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---TAA---------TAATGA---------------------------------------------------------------------------------------ATG---------------------------------TAA---TAA------------------------TGA---------------TAG---------------ATG------------------------------------ATG------------------------------TAA------------------------------------------------------------------------------------TAA---TAA------------------TGAATG------------TAG---------------------------------TAA------------TGATGA---TAA------------------ATG------------------TAG---------------------------------------------------------------------------------------------------TAG------------------------------------------------TGA------------------TGA---TAG---------------------ATG------------TAA---------------------------------------------------------------------TAA---------------------TAA---------------------------------ATG------------------------------------------------TAA---------ATG---------------------------ATG------------------------------------------------------------------TAG------------------------------TGA---ATG------------------------------ATG------------------------TAA------------------------------------------------------------TAA---------------------------------------------------TAA------------------------------TGA---------------------------------------------------------TAA---------------------------------------TGA------------ATG---TAG------------------TAATAA------TAAATG---ATGATG------------------------------------------------------------------------ATG---TGA---TAA---------------ATGATG---------------------TAG---ATG------------------------------------------TAA------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------TAATGA---ATGATG---------------ATG------------------------------------------------------------------------ATGTAA------TGA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2      ests                            Xl3.1-IMAGE:6952949.5                                                                                                                                                                                                                                                                                                                            GACGATATGGACGGGAAAATGAAACAGCAAAAGAACCTGACTGGGACCCTGTTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTGCAGTTCGGATATGGTATTGGTGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACACGGGTTTTACTAGAAGGCAGTGCAAATGAGACCGATACAAAATCTGTACAACCGTCTGTCAAAATGTACTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGAGGGATGGTGTCTTCATTCTTTGTTGGATGGATTGCAGATAAACTGGGAAGGATAAAAGCCATGATGGCTGTAAACAGTCTGGCAGTTATTGGGGCTATTCTGATGGGGCTGGCTCCCTTAGGTCAAGCACATGCTCTTGTCATTGCTGGCAGATTAATTACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTCGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACGTTGCATCAGTTGGCTATTGTCACAGGGATTCTCATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGTAGTGAGACTCTTTGGCCTGTTCTGTTAGGCTTGTCGGGAGTCCCTGCTATTGTGCAGACCATCCTGCTGTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGATGGAAGCAGCTAAAAGAAACTTAATAAGGCTCAGAGGAGACTATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGTCGAAAGTGAAAAAAAAGTGTCTATCATACAGTTATTCAAGTCTTCTAATTACCGCCAGCCTCTAATTGTTTCTCTTGTGCTTCATATCTCTCAGCAGTTTTCCGGAATCAATGGGATCTTTTACTACTCTACAAGCATCTTTACTAGAGCGGGTATTAGCCAACCAGTA
                                                  Xl3.1-CHK-1012693490                                                                                                                                                                                                                                                                                                                                  ATGGACGGGAAAATGAAACAGCAAAAGAACCTGACTGGGACCCTGTTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTGCAGTTCGGATATGGTATTGGTGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACACGGGTTTTACTAGAAGGCAGTGCAAATGAGACCGATACAAAATCTGTACAACCGTCTGTCAAAATGTACTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGAGGGATGGTGTCTTCATTCTTTGTTGGATGGATTGCAGATAAACTGGGAAGGATAAAAGCCATGATGGCTGTAAACAGTCTGGCAGTTATTGGGGCTATTCTGATGGGGCTGGCTCCCTTAGGTCAAGCACATGCTCTTGTCATTGCTGGCAGATTAATTACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTCGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACGTTGCATCAGTTGGCTATTGTCACAGGGATTCTCATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGTAGTGAGACTCTTTGGCCTGTTCTGTTAGGCTTGTCGGGAGTCCCTGCTATTGTGCAGACCATCCTGCTGTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGATGGAAGCAGCTAAAAGAAACTTAATAAGGCTCAGAGGAGACTATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGTCGAAAGTGAAAAAAAAGTGTCTATCATACAGTTATTCAAGTCTTCTAATTACCGCCAGCCTCTAATTGTTTCTCTTGTGCTTCATATCTCTCAGCAGTTTTCCGGAATCAATGGGATCTTTTACTACTCTACAAGCATCTTTACTAGAGCGGGTATTAGCCAA
  5   1   2       bld Emb1 5g                         IMAGE:6637471.5p                                                                                                                                                                                                                                                                                                               GACTGTCTGGACCGACGATATGGACGGGAAAATGAAACAGCAAAAGAACCTGACTGGGACCCTGTTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTGCAGTTCGGATATGGTATTGGTGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACACGGGTTTTACTAGAAGGCAGTGCAAATGAGACCGATACAAAATCTGTACAACCGTCTGTCAAAATGTACTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGAGGGATGGTGTCTTCATTCTTTGTTGGATGGATTGCAGATAAACTGGGAAGGATAAAAGCCATGATGGCTGTAAACAGTCTGGCAGTTATTGGGGCTATTCTGATGGGGCTGGCTCCCTTAGGTCAAGCACATGCTCTTGTCATTGCTGGCAGATTAATTACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTCGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACGTTGCATCAGTTGGCTATTGTCACAGGGATTCTCATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGTAGTGAGACTCTTTGGCCTGTTCTGTTAGGCTTGTCGGGAGTCCCTGCTATTGTGCAGACCCATCCTGCTGTTCTTTTGCCCTGAAAGCCCCCAATTTCTGTTAATCAAACTTGGGGAAGATGGAAGCAGCTAAAAGAAACTTAATAAGGCTTCGAGGAGACTATGGATCCAacaaaaagacatggaaaagatggaaaaagggaaaaggaaataagttcaaaagtggaaaaaaaaaGTGGCCTATCAATACCGTTTATTCTCAGGCCTT
  5   1   2       bld Neu7 5g                              XL040k13.5p                                                                                                                                                                                                                                                                                                                GNCTGCAGGNAATTCGGTCACGAGGGGAAAATGAAACAGCAAAAGAACCTGACTGGGACCCTGTTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTGCAGTTCGGATATGGTATTGGTGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACACGGGTTTTACTAGAAGGCAGTGCAAATGAGACCGATACAAAATCTGTACAACCGTCTGTCAAAATGTACTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGAGGGATGGTGTCTTCATTCTTTGNTGGATGGATTGCAGATAAACTGGGAAGGATAAAAGCCATGATGGCTGNAA
  5   1   2       bld Ga15 5g3  in                       XL436c18ex.5p                                                                                                                                                                                                                                                                                                                    TCTGGACCGACGATATGGACGGGAAAATGAAACAGCAAAAGAACCTGACTGGGACCCTGTTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTGCAGTTCGGATATGGTATTGGTGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACACGGGTTTTACTAGAAGGCAGTGCAAATGAGACCGATACAAAATCTGTACAACCGTCTGTCAAAATGTACTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGAGGGATGGTGTCTTCATTCTTTGTTGGATGGATTGCAGATAAACTGGGAAGGATAAAAGCCATGATGGCTGTAAACAGTCTGGCAGTTATTGGGGCTATTCTGATGGGGCTGGNCTCCCTT
  5   1   2       bld Em10 5g                         IMAGE:8320600.5p                                                                                                                                                                                                                                                                                                                    TCTGGACCGACGATATGGACGGGAAAATGAAACAGCAAAAGAACCTGACTGGGACCCTGTTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTGCAGTTCGGATATGGTATTGGTGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACACGGGTTTTACTAGAAGGCAGTGCAAATGAGACCGATACAAAATCTGTACAACCGTCTGTCAAAATGTACTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGAGGGATGGTGTCTTCATTCTTTGTTGGATGGATTGCAGATAAACTGGGAAGGATAAAAGCCATGATGGCTGTAAACAGTCTGGCAGTTATTGGGGCTATTCTGATGGGGCTGGCTCCCTTAGGTCAAGCACATGCTCTTGTCATTGCTGGCAGATTAATTACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTCGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACGTTGCATCAGTTGGCTATTGTCACAGGGATTCTCATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGTAGTGAGACTCTTTGGCCTGTTCTGTTAGGCTTGTCGGGAGTCCCTGCTATTGTGCAGACCATCCTGCTGTTCTTTTGCCCTGAAGCCCCAGATTTCTGTTATCAACTTGGGAGATGGAGCAGCTAAAGAACTTATANGCTCAAAGAACTTGATCCACAAAACTTGAGAGTGAANAGAAAGAGAGTCGAGTGAAAAATGCTTCTACGTATCAGTCTCATACGCGCTCATGTCCTGGCTCACCCAC
  5   1   2       bld Brn1 5g                         IMAGE:6952949.5p                                                                                                                                                                                                                                                                                                                         ACCGACGATATGGACGGGAAAATGAAACAGCAAAAGAACCTGACTGGGACCCTGTTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTGCAGTTCGGATATGGTATTGGTGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACACGGGTTTTACTAGAAGGCAGTGCAAATGAGACCGATACAAAATCTGTACAACCGTCTGTCAAAATGTACTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGAGGGATGGTGTCTTCATTCTTTGTTGGATGGATTGCAGATAAACTGGGAAGGATAAAAGCCATGATGGCTGTAAACAGTCTGGCAGTTATTGGGGCTATTCTGATGGGGCTGGCTCCCTTAGGTCAAGCACATGCTCTTGTCATTGCTGGCAGATTAATTACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTCGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACGTTGCATCAGTTGGCTATTGTCACAGGGATTCTCATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGTAGTGAGACTCTTTGGCCTGTTCTGTTAGGCTTGTCGGGAGTCCCTGCTATTGTGCAGACCATCCTGCTGTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGATGGAAGCAGCTAAAAGAAACTTAATAAGGCTCAGAGGAGACTATGATCCCACCAAAGACATTGAAGAGAtgaaaaaagaaaaggaaagaagtcgaaaagtgaaaaaaaaagTGTCTATCATACAGTTTATTTCAAGTCTTCTAAATTACCGCCCACCCTCCAAATTGTTTTCCCCTTGGGCCTTC
  5   1   2      seed Ga12 5g3  in                         XL173h08.5p                                                                                                                                                                                                                                                                                                                                       GGGGAAAATGAAACAGCAAAAGAACCTGACTGGGACCCTGTTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCAATGCAGTTCGGATATGGTATTGGTGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACACGGGTTTTACTAGAAGGCAGTGCAAATGAGACCGATACAAAATCTGTACAACCGTCTGTCAAAATGTACTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGAGGGATGGTGTCTTCATTCTTTGTTGGATGGATTGCAGATAAACTGGGAAGGATAAAAGCCATGATGGCTGTAAACAGTCTGGCAGTTATTGGGGCTATTCTGATGGGGCTGGCTCCCTTAGGTCAAGCACATGCTCTTGTCATTGCTGGCAGATTAATTACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTCGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACGTTACATCAGTTGGCTATTGTCACAGGGATTCTCATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGTAGTGAGACTCTTTGGCCTGTTCTGTTAGGCTTGTCGGGAGTCCCTGCTATTGTGCAGACCATCCTGCTGTTCTTTTGCCCTGAAAG
  5   1   2       bld Neu7 5g3  in                         XL023a10.5p                                                                                                                                                                                                                                                                                                                                                                ACTGGGCACCCTGTTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTGCAGTTCGGCATATGGTATTGGTGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACACGGGTTTTACTAGNAAGGCAGTGCAAATGAGACCGATACAAAATCTGTACAACCGTCTGTCAAAATGTACTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGAGGGATGGTGTCTTCATTCTTTGTTGGATGGATTGCAGATAAACTGGGAAGGATAAAAGCCATGATGGCTGTAAACAGTCTGGCAGTTATTGGGGCTATTCTGATGGGGCTGGCTCCCTTAGGTCAAGCACATGCTCTTGTCATTGCTGGCAGATTAATTACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTCGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACGTTGCATCAGTTGGCTATTGTCACAGGGATTCTCATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGTAGTGAGACTCTTTGGCCTGTTCTGTTAGGCTTGTCGGGA
  5   1   2       bld Ga15                               XL447d10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAATGTACTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGAGGGATGGTGTCTTCATTCTTTGTTGGATGGATTGCAGATAAACTGGGAAGGATAAAAGCCATGATGGCTGTAAACAGTCTGGCAGTTATTGGGGCTATTCTGATGGGGCTGGCTCCCTTAGGTCAAGCACATGCTCTTGTCATTGCTGGCAGATTAATTACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTCGGAGAGATCTCCC
  3  -1   2       bld Emb1      in                    IMAGE:3401921.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCGATCTAGCATCAGGACTGGTTCCCATGTATGTCGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACGTTGCATCAGTTGGCTATTGTCACAGGGATTCTCATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGTAGTGAGACTCTTTGGCCTGTTCTGTTAGGCTTGTCGGGAGTCCCTGCTATTGTGCAGACCATCCTGCTGTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGATGGAAGCAGCTAAAAGAAACTTAATAAGGCTCAGAGGAGACTATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGTCGAAAGTGAAAAAAAAGTGTCTATCATACAGTTATTCAAGTCTTCTAATTACCGCCAGCCTCTAATTGTTTCTCTTGTGCTTCATATCTCTCAGCAGTTNTCCGGAATCAATGGGATCTTTTACTACTCTACAAGCATCTNTACTAGAGCGGGTATTAGCCAACCAGTATATG
  5  -1   2      skin Emb1                   IMAGE:3401921-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTCTGGTAATCAAACTTGGGAAGATGGAAGCAGCTAAAAGAAACTTAATAAGGCTCAGAGGAGACTATGATCCAACAAAAGACATTGAAGAGATgaaaaaggaaaaggaagaagtcgaaagtgaaaaaaaaGTGTCTATCATACAGTTATTCAAGTCTTCTAATTACCGCCAGCCTCTAATTGTTTCTCTTGTGCTTCATATCTCTCAGCAGTTTTCCGGAATCAATGGGATCTTTTACTACTCTACAAGCATCTTTACTAGAGCGGGTATTAGCCAACCAGTATATGCAACTATTGGAGTCGGCGCTGTTAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTATAGAGAAGGCAGGTAGAAGATCCCTCTATCTGGTTGGCTTAGCCGGCATGGGCATCTGCGCTATTGTTATGACTATTGCGTTGGCACTTCTGACTCAGCATGCTTGGATGAGTTACCTAAGTATGGTCGCCATTTTCCTTTTCGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTCGCAGAATTGTTCAGTCAAGGTCCACGACCTGCAGCTATGGCAGTGTCTGGGTGCTGTAACTGGACATGCAACTTTATCATTGGGATGTGTTTTGAATACATAGCTGATGCCTGTGGGCCATATGTATTCATCATTTTTGCTGTACTCCTTTTTATATTCACCATTTTCACATACTTTAAAGTCCCGGAGACTAAGGGCAAGTCATTTGATGAGATAGCTGCCGAGTTCCGAAAGAAGAAACTTGCATCCCGCAAAGGACTTAAATCGACTGAAATGGAGTATCTGGGAACCAGTTCGGAAGCATAAATATTTCCAGCAAGTGCAAAAATTAAAACAGTCATTTTTT
  5  -1   0       add Emb1      in                    IMAGE:3401921.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACTCTACAAGCATCTTACTAAGAGCGGGTATTAGCCAACCAGTATATGCAACTATTGGAGTCGGCGCTGTAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTATAGAGAAGGCAGGTAGAAGATCCCTCTATCTGGTTGGCTTAGCCGGCATGGGCATCTGCGCTATTGTTATGACTATTGCGTTGGCACTTCTGACTCAGCATGCTTGGATGAGTTACCTAAGTATGGTCGCCATTTTCCTTTTCGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTCGCAGAATTGTTCAGTCAAGGTCCACGACCTGCAGCTATGGCAGTGTCTGGGTGCTGTAACTGGACATGCAACTTTATCATTGGGATGTGTTTTGAATACATAGCTGATGCCTGTGGGCCATATGTATTCATCATTTTTGCTGTACTCCTTTTTATATTCACCATTTTCACATACTTTAAAGTCCCGGAGACTAAGGGCAAGTCATTTGATGAGATAGCTGCCGAGTTCCGAAAGAAGAAACTTGCATCCCGCAAAGGACTTAAATCGACTGAAATGGAGTATCTGGGAACCAGTTCGGAAGCATAAATATTTCCAGCAAGTGCAAAAATTAAAACAGTCATTTTTTaaaaaaaaa
  5   1   0       add Neu7 5g3  in                         XL043g21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCCGGCATGGGCATCTGCGCTATTGTTATGACTATTGCGTTGGCACTTCTGACTCAGCATGCTTGGATGAGTTACCTAAGTATGGTCGCCATTTTCCTTTTCGTGGTTTTCTTTGAAGTTGGCCCAGGTCCTATTCCTTGGTTCATTGTCGCAGAATTGTTCAGTCAAGGTCCACGACCTGCAGCTATGGCAGTGTCTGGGTGCTGTAACTGGACATGCAACTTTATCATTGGGATGTGTTTTGAATACATAGCTGATGCCTGTGGGCCATATGTATTCATCATTTTTGCTGTACTCCTTTTTATATTCACCATTTTCACATACTTTAAAGTCCCGGAGACTAAGGGCAAGTCATTTGATGAGATAGCTGCCGAGTTCCGAAAGAAGAAACTTGCATCCCGCAAAGGACTTAAATCGACTGAAATGGAGTATCTGGGAACCAGTTCGGAAGCATAAATATTTCCAGCAAGTGCAAAAATTAAAACAGTCATTTTTaaaaaaaaaTATCTATACATATACACGATATACAGGGTATTACCAGACGACTGCAATGTTTTTATAGACACTTATTTTTATAATGCTAAACTAAAGAAG
  5   1   2      ests                            Xl3.1-IMAGE:6957465.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAAACTAAAGAAGAGGGTGTGCTTGAGTTTGTGGACGCTTAAAAGAGATAGAGAGGTGTCTAATCAAAGTCCTTCAGCTGCTGTACAACTCCCATGAGCCTAAGGATGTAAATAATGAGAATGGCAGTTGCACAACAGCTTTGAAGCCAAAGATGCAATCTCTGTATTCAAAATAACACAGCTTTGTTACTGTCCTTTACAAGGAATGCTTGTGTTGGCGCAGAAACCAGTGATATCTTTATAAGTCTAAAGGATCTGCAGAGTTGCAACCTGGTGATTATCCCATGTCTCATAGAAAGCCTCCATCCCTATGTTTTTGTATTTACCATGGTTTCTACAGTGGTTTTACATGGTTTGCGCAGGAATATTTACTTTAAATATATAAGTGGCTGTGAACAAGAGGGGTTATGGTAAAAACACAGCACCACGGAAGGAAGTGGCAGTCCATCTTACAAAATTAGCACCAGGGTAATTTTAAGATATTTTCTATTTATATTGAATGAGTCAATACCAGTAGGTGTTCCTGGCATATCTGTTATACAGATATCCTTAAAACAGGAATTCCTGATGATTCTAAGGACATGTCTCAGAAACAATGGATACAAAATATCTTACATAGCATTTGCAAACCTACAAAAAGAACAAAAACTGTTCAAAAATATTATCCAATGACACTAAATGCCGCCTTCAGCATGACACCTACTCATTTAAAACACTATAGCCAAAACGTATTTTAATATTCTATATTAAGTATAAATGTGTGCCAGTGTGAACAAAAGGAACAACACTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAACCTTTAGAATCCCAAAATTTTAATCTGCCCCTAATGTCTGCCTGTAAAACTATATCTGCAATACATCCTATTATAATATTATGGCGTGTTATCATAGAAACACAGCTTGTGATTTAGCTAGAGGTTCTGTGTAACTGATTAGCATGACCAGACACCAAGTTGTTGGTAGCTATATGCTCATTTATTTCACTACCTGTACCAGTCTGTTACAACTAAACATCCCAGTCAGCATCTGGCTTATATAGATTATCATACAGGTTAATTCGTTTTCATCATGAATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTAAAAAAATCTTGGGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTGCTTTAATTTCTATACTGTAGCCTAATGTAAATGGTTAGATCCTCCAATTATTGGGCCTGAACCTTATTTTGTCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAATGAATTTAAATTAAAATAAACATTTGGTTTTTAATTTCAA
                                                  Xl3.1-CHK-1012686492                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAAGAAGAGGGTGTGCTTGAGTTTGTGGACGCTTAAAAGAGATAGAGAGGTGTCTAATCAAAGTCCTTCAGCTGCTGTACAACTCCCATGAGCCTAAGGATGTAAATAATGAGAATGGCAGTTGCACAACAGCTTTGAAGCCAAAGATGCAATCTCTGTATTCAAAATAACACAGCTTTGTTACTGTCCTTTACAAGGAATGCTTGTGTTGGCGCAGAAACCAGTGATATCTTTATAAGTCTAAAGGATCTGCAGAGTTGCAACCTGGTGATTATCCCATGTCTCATAGAAAGCCTCCATCCCTATGTTTTTGTATTTACCATGGTTTCTACAGTGGTTTTACATGGTTTGCGCAGGAATATTTACTTTAAATATATAAGTGGCTGTGAACAAGAGGGGTTATGGTAAAAACACAGCACCACGGAAGGAAGTGGCAGTCCATCTTACAAAATTAGCACCAGGGTAATTTTAAGATATTTTCTATTTATATTGAATGAGTCAATACCAGTAGGTGTTCCTGGCATATCTGTTATACAGATATCCTTAAAACAGGAATTCCTGATGATTCTAAGGACATGTCTCAGAAACAATGGATACAAAATATCTTACATAGCATTTGCAAACCTACAAAAAGAACAAAAACTGTTCAAAAATATTATCCAATGACACTAAATGCCGCCTTCAGCATGACACCTACTCATTTAAAACACTATAGCCAAAACGTATTTTAATATTCTATATTAAGTATAAATGTGTGCCAGTGTGAACAAAAGGAACAACACTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAACCTTTAGAATCCCAAAATTTTAATCTGCCCCTAATGTCTGCCTGTAAAACTATATCTGCAATACATCCTATTATAATATTATGGCGTGTTATCATAGAAACACAGCTTGTGATTTAGCTAGAGGTTCTGTGTAACTGATTAGCATGACCAGACACCAAGTTGTTGGTAGCTATATGCTCATTTATTTCACTACCTGTACCAGTCTGTTACAACTAAACATCCCAGTCAGCATCTGGCTTATATAGATTATCATACAGGTTAATTCGTTTTCATCATGAATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTAAAAAAATCTTGGGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTGCTTTAATTTCTATACTGTAGCCTAATGTAAATGGTTAGATCCTCCAATTATTGGGCCTGAACCTTATTTTGTCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAATGAATTTAAATTAAAATAAACATTTGGTTTTTAA
  5   1   2       bld Tbd2                            IMAGE:3200122.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACTGCAATGTTTTTATAGACACTTATTTTTATTATGCTAAACTAAAGAAGAGGGTGTGCTTGAGTTTGTGGACGCTTAAAAGAGATAGAGAGGTGTCTAATCAAAGTCCTTCAGCTGCTGTACAACTCCCATGAGCCTAAGGATGTAAATAATGAGAATGGCAGTTGCACAACAGCTTTGAAGCCAAAGATGCAATCTCTGTATTCAAAATAACACAGCTTTGTTACTGTCCTTTACAAGGAATGCTTGTGTTGGCGCAGAAACCAGTGATATCTTTATAAGTCTAAAGGATCTGCAGAGTTGCAACCTGGTGATTATCCCATGTCTCATAGAAAGCCTCCATCCCTATGTTTTTGTATTTACCATGGTTTCTACAGTGGTTTTACATGGTTTGCGCAGGAATATTTACTTTAAATATATAAGTGGCTGTGAACAAGAGGGGTTATGGTAAAAACACAGCACCACGGAAGGAAGTGGCAGTCCATCTTACAAAATTAGCACCA
  5   1   2       bld Tbd3                            IMAGE:3548912.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAAACTAAAGAAGAGGGTGTGCTTGAGTTTGTGGACGCTTAAAAGAGATAGAGAGGTGTCTAATCAAAGTCCTTCAGCTGCTGTACAACTCCCATGAGCCTAAGGATGTAAATAATGAGAATGGCAGTTGCACAACAGCTTTGAAGCCAAAGATGCAATCTCTGTATTCAAAATAACACAGCTTTGTTACTGTCCTTTACAAGGAATGCTTGTGTTGGCGCAGAAACCAGTGATATCTTTATAAGTCTAAAGGATCTGCAGAGTTGCAACCTGGTGATTATCCCATGTCTCATAGAAAGCCTCCATCCCTATGTTTTTGTATTTACCATGGTTTCTACAGTGGTTTTACATGGTTTGCGCAGGAATATTTACTTTAAATATATAAGTGGCTGTGAACAAGAGGGGTTATGGTAAAAACACAGCACCACGGAAGGAAGTGGCAGTCCATCTTACAAAATTAGCACCAGGGTAATTTTAAGATATTTTCTATTTATATTGAATGAGTCAATACCAGTAGGTGTTCCTGGCATATCTGTTATACAGATATCCTT
  5   1   2       bld Tbd7 5g3  in                         XL061e20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGCTGTACAACTCCCATGAGCCTAAGGATGTAAATAATGAGAATGGCAGTTGCACAACAGCTTTGAAGCCAAAGATGCAATCTCTGTATTCAAAATAACACAGCTATGTTACTGTCCTTTACAAGGAATGCTTGTGTTGGCGCAGAAACCAGTGATATCTTTATAAGTCTAAAGGATCTGCAGAGTTGCANCCTGGTGATTATCCCATGTCTCATAGAAAGCCTCCATCCCTATGTTTTTGTATTTACCATGGTTTCTACAGTGGTTTTACATGGTTTGCGCAGGAATATTTACTTTAAATATATAAGTGGCTGTGAACAAGAGGGGTTATGGTAAAAACACAGCACCACGGAAGGAAGTGGCAGTCCATCTTACAAAATTAGCACCAGGGTAATTTTAAGATATTTTCTATTTATATTGAATGAGTCAATACCAGTAGGTGTTCCTGGCATATCTGNTATACAGATATCCTTAAAACAGGAATTCCTGATGATNCTAAGGACATGTCTC
  5   1   2       bld DMZ  5g3  in                         xl303p18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAGCTTTGAAGCCAAAGATGCAATCTCTGTATTCAAAATAACACAGCTTTGTTACTGTCCTTTACAAGGAATGCTTGTGTTGGCGCAGAAACCAGTGATATCTTTATAAGTCTAAAGGATCTGCAGAGTTGCAACCTGGTGATTATCCCATGTCTCATAGAAAGCCTCCATCCCTATGTTTTTGTATTTACCATGGTTTCTACAGTGGTTTTACATGGTTTGCGCAGGAATATTTACTTTAAATATATAAGTGGCTGTGAACAAGAGGGGTTATGGTAAAAACACAGCACCACGGAAGGAAGTGGCAGTCCATCTTACAAAATTAGCACCAGGGTAATTTTAAGATATTTTCTATTTATATTGAATGAGTCAATACCAGTAGGTGTTCCTGGCATATCTGTTATACAGATATCCTTAAAACAGGAATTCCTGATGATTCTAAGGACATGTCTCAGAAACAATGGATACAAAATATCTTACATAGCANTTGCAAACCTACAAAAAGAACAAAAACTGTTCAAAAATATTATCCAATGACACTAAATGCCGCCTTCAGCATGACACCTACTCATTTAAAACACTATAGCCCAAACGTATTTTAATATTCTATATNAAGTATAAATGTGTGCCAGTGTGAACAAAAGGAACAACACTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGT
  5   1   2       bld DMZ  5g3  in                         xl265n08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAATCTCTGTATTCAAAATAACACAGCTTTGTTACTGTCCTTTACAAGGAATGCTTGTGTTGGCGCAGAAACCAGTGATATCTTTATAAGTCTAAAGGATCTGCAGAGTTGCAACCTGGTGATTATCCCATGTCTCATAGAAAGCCTCCATCCCTATGTTTTTGTATTTACCATGGTTTCTACAGTGGTTTTACATGGCTTGCGCAGGAATATTTACTTTAAATATATAAGTGGCTGTGAACAAGAGGGGTTATGGTAAAAACACAGCACCACGGAAGGAAGTGGCAGTCCATCTTACAAAATTAGCACCAGGGTAATTTTAAGATATTTTCTATTTATATTGAATGAGTCAATACCAGTAGGTGTTCCTGGCATATCTGTTATACAGATATCCTTAAAACAGGAATTCCTGATGATTCTAAGGACATGTCTCAGAAACAATGGATACAAAATATCTTACATAGCATTTGCAAACCTACAAAAAGAACAAAAACTGTTCAAAAATATTATCCAATGACACTAAATGCCGCCTTCAGCATGACACCTACTCATTTAAAACACTATAGCCAAAACGTATTTNAATATTCTATATTAAGTATAAATGTGTGCCAGTGT
  5   1   2       bld Tbd7 5g3  in                         XL063g05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCAGGNAATTCGGCACGAGGGGTGATTATCCCATGTCTCATAGAAAGCCTCCATCCCTATGTTTTTGTATTTACCATGGTTTCTACAGTGGTTTTACATGGTTTGCGCAGGAATATTTACTTTAAATATATAAGTGGCTGTGAACAAGAGGGGTTATGGTAAAAACACAGCACCACGGAAGGAAGTGGCAGTCCATCTTACAAAATTAGCACCAGGGTAATTTTAAGATATTTTCTATTTATATTGAATGAGTCAATACCAGTAGGTGTTCCTGGCATATCTGTTATACAGATATCCTTAAAACAGGAATTCCTGATGATTCTAAGGACATGTCTCAGAAACAATGGATACAAAATATCTTACATAGCATTTGCAAACCTACAAAAAGAACAAAAACTGTTCAAAAATATTATCCAATGACACTAAATGCCGCCTTCAGCATGACACCTACTCATTTAAAACACTATAGCCAAAACGTATTTTAATATTCTATATTAAGTATAAATGTGTGCCAGTGTGAACAAAAGGAACAACACTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAA
  5   1   2       bld Ga12 5g3  in                         XL190p15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTAATTTTAAGATATTTTCTATTTATATTGAATGAGTCAATACCAGTAGGTGTTCCTGGCATATCTGTTATACAGATATCCTTAAAACAGGAATTCCTGATGATTCTAAGGACATGTCTCAGAAACAATGGATACAAAATATCTTACATAGCATTTGCAAACCTACAAAAAGAACAAAAACTGTTCAAAAATATTATCCAATGACACTAAATGCCGCCTTCAGCATGACACCTACTCATTTAAAACACTATAGCCAAAACGTATTTTAATATTCTATATTAAGTATAAATGTGTGCCAGTGTGAACAAAAGGAACAACACTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAACCTTTAGAATCCCAAAATTTTAATCTGCCCCTAATGTCTGCCTGTAAAACTATATCTGCAATACATCCTATTATAATATTATGGCGTGTTATCATAGAAACACAGCTTGTGATT
  5   1   2       bld Neu7 5g3  in                         XL035a12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTTTAAGATATTTTCTATTTATATTGAATGAGTCAATACCAGTAGGTGTTCCTGGCATATCTGTTATACAGATATCCTTAAAACAGGAATTCCTGATGATTCTAAGGACATGTCTCAGAAACAATGGATACAAAATATCTTACATAGCATTTGCAAACCTACAAAAAGAACAAAAACTGTTCAAAAATATTATCCAATGACACTAAATGCCGCCTTCAGCATGACACCTACTCATTTAAAACACTATAGCCAAAACGTATTTTAATATTCTATATTAAGTATAAATGTGTGCCAGTGTGAACAAAAGGAACAACACTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAACCTTTAGAATCCCAAAATTTTAATCTGCCCCTAATGTCTGCCTGTAAAACTATATCTGCAATACATCCTATTATAAT
  5   1   2       bld Tbd7 5g3  in                         XL075g03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACAAAAAGAACAAAAACTGTTNAAAATATTATCCAATGACACTAAATGCCGCCTTCAGCATGACACCTACTCATTTAAAACACTATAGCCAAAACGTATTTTAATATTCTATATTAAGTATAAATGTGTGCCAGTGTGAACAAAAGGAACAACACTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAACCTTTAGAATCCCAAAATTTTAATCTGCCCCTAATGTCTGCCTGTAAAACTATATCTGCAATACATCCTATTATAATATTATGGCGTGTTATCATAGAAACACAGCTTGTGATTTAGCTAGAGGTTCTGTGTAACTGATTAGCATGACCAGACACCAAGTTGTTGGTAGCTATATGCTCATTTATTTCACTACCTGTACCAGTCTGTTACAACTAAACATCCCAGTCAGCATCTGGCTTATATAGATTATCATACAGGTTAATTCGTTTTCATCATGAATAATGAAATTCTGTGT
  5   1   2       bld Ga15      out                      XL460m10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAATATTATCCAATGACACTAAATGCCGCCTTCAGCATGACACCTACTCATTTAAAACACTATAGCCAAAACGTATTTTAATATTCTATATTAAGTATAAATGTGTGCCAGTGTGAACAAAAGGAACAACACTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTANAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAACCTTTAGAATCCCAAAATTTTAATCTGCCCCTAATGTCTGCCTGTAAAACTATATCTGCAATACATCCTATTATAATATTATGGCGTGTTATCATAGAAACACAGCTTGTGATTTAGCTAGAGGTTCTGTGTAACTGATTAGCATGACCAGACACCAAGTTGTTGGTAGCTATATGCTCATTTATTTCACTACCTGTACCAGTCTGTTACAACTAAACATCCCAGTCAGCATCTGGCTTATATAGATTATCATACAGGTTAATTCGTTTTCATCATGAATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTAAAAAAATCTTGGGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTGCTTTAATTTCTATACTGTAGCCTAATGTAAATGGTTAGATCCTCCAATTATTGGGCCTGAACCTTATTTTGTCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGA
  5   1   2       bld Tbd7 5g3  in                         XL105k18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCTTAGCATGACACCTACTCATTTAAAACACTATAGCCAAAACGTATTTTAATATTCTATATTAAGTATAAATGTGTGCCAGTGTGAACAAAAGGAACAACACTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAACCTTTAGAATCCCAAAATTTTAATCTGCCCCTAATGTCTGCCTGTAAAACTATATCTGCAATACATCCTATTATAATATTATGGCGTGTTATCATAGAAACACAGCTTGTGATTTAGCTAGAGGTTCTGTGTAACTGATTAGCATGACCAGACACCAAGTTGTTGGTAGCTATATGCTCATTTATTTCACTACCTGTACCAGTCTGTTACAACTAAACATCCCAGTCAGCATCTGGCTTATATAGATTATCATACAGGTTAATTCGTTTTCATCATGAATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTaaaaaaaaTCTTGGGAACA
  5   1   2       bld Ga15 5g3  in                       XL499o17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCAAAACGTATTTTAATATTCTATATTAAGTATAAATGTGTGCCAGTGTGAACAAAAGGAACAACACTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAACCTTTAGAATCCCAAAATTTTAATCTGCCCCTAATGTCTGCCTGTAAAACTATATCTGCAATACATCCTATTATAATATTATGGCGTGTTATCATAGAAACACAGCTTGTGATTTAGCTAGAGGTTCTGTGTAACTGATTAGCATGACCAGACACCAAGTTGTTGGTAGCTATATGCTCATTTATTTCACTACCTGTACCAGTCTGTTACAACTAAACATCCCAGTCAGCATCTGGCTTATATAGATTATCATACAGGTTAATTCGTTTTCATCATGAATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTAAAAAAATCTTGGGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTGCTTTAATTTCTATACTGTAGCCTAATGTAAATGGTTAGATCCTCCAATTATTGGGCCTGAACCTTATTTTGTCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGT
  5   1   2       bld Tbd7 5g3  in                         XL072c01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTATTTTAATATTNCTATATTAAGTATAAATGTGTGCCAGTGTGAACAAAGGAACAACACTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAACCTTTAGAATCCCAAAATTTTAATCTGCCCCTAATGTCTGCCTGTAAAACTATATCTGCAATACATCCTATTATAATATTATGGCGTGTTATCATAGAAACACAGCTTGTGATTTAGCTAGAGGTTCTGTGTAACTGATTAGCATGACCAGACACCAAGTTGTTGGTAGCTATATGCTCATTTATTTCACTACCTGTACCAGTCTGTTACAACTAAACATCCCAGTCAGCATCTGGCTTATATAGATTATCATACAGGTTAATTCGTTTTCATCATGAATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTAAAAAAATCTTGGGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTTCTTTAATTTCTATACTGTAGCCTAATGTAAATGGTTAG
  5   1   2       bld Tbd7                                 XL076d22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGCACGNGGCTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAACCTTTAGAATCCCAAAATTTTAATCTGCCCCTAATGTCTGCCTGTAAAACTATATCTGCAATACATCCTATTATAATATTATGGCGTGTTATCATAGAAACACAGCTTGTGATTTAGCTAGAGGTTCTGTGTAACTGATTAGCATGACCAGACACCAAGTTGTTGGTAGCTATATGCTCATTTATTTCACTACCTGTACCAGTCTGTTACAACTAAACATCCCAGTCAGCATCTGGCTTATATAGATTATCATACAGGTTAATTCGTTTTCATCATGAATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTAAAAAAATCTTGGGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTGCTTTAATTTCTATACTGTAGCCTAATGTAAATGGTTAGATCCTCCAATTATTGGGCCTG
  5   1   2       bld Tbd7 5g3  in                         XL062m18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTGTGATATTAGGCTCAAAAACATTCTCCTGAAATGACATATTTACCTTAAAGGAAAGTTCTTTTTCCCTTAACTTTGCTACAATTTGAACGGCTGGGAACCTTTAGAATCCCAAAATTTTAATCTGCCCCTAATGTCTGCCTGTAAAACTATATCTGCAATACATCCTATTATAATATTATGGCGTGTTATCATAGAAACACAGCTTGTGATTTAGCTAGAGGTTCTGTGTAACTGATTAGCATGACCAGACACCAAGTTGTTGGTAGCTATATGCTCATTTATTTCACTACCTGTACCAGTCTGTTACAACTAAACATCCCAGTCAGCATCTGGCTTATATAGATTATCATACAGGTTAATTCGTTTTCATCATGAATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTAAAAAAATCTTGGGAACA
  5   1   2       bld Ga12 5g3  in                         XL206p16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGCTGGCTTATATAGATTATCATACAGGTTAATTCGTTTTCATCATGAATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTAAAAAAATCTTGGGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTGCTTTAATTTCTATACTGTAGCCTAATGTAAATGGTTAGATCCTCCAATTATTGGGCCTGAACCTTATTTTGTCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATANAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCANACAGAAAATAACTTACCCNATGTCACTGTACACGC
  5   1   2       bld Ga12 5g                              XL154d06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGGCTTATATAGATTATNTACAGGTTAATTCGTTTTNTCATGAATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTAAAAAAATCTTGGGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTGCTTTAATTTCTATACTGTAGCCTAATGTAAATGGTTAGATCCTCCAATTATTGGGCCTGAACCTTATTTTGTCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACA
  5   1   2       bld Ga12 5g3  in                         XL156e08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTAAAAAAATCTTGGGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTGCTTTAATTTCTATACTGTAGCCTAATGTAAATGGTTAGATCCTCCAATTATTGGGCCTGAACCTTATTTTGTCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCA
  5   1   2       bld Ga12                                 XL161a18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATAATGAAATTCTGTGTTTGGTTAATATATAAATGTATGGTAAAAAAATCTTGGGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTGCTTTAATTTCTATACTGTAGCCTAATGTAAATGGNTAGATCCTCCAATTATTGGGCCTGAACCTTATTTTGNCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATANGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATG
  5   1   2       bld Ga15 5g3  in                       XL505o16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATGTATGGTAAAAAAATCTTGGGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTGCTTTAATTTCTATACTGTAGCCTAATGTAAATGGTTAGATCCTCCAATTATTGGGCCTGAACCTTATTTTGTCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCA
  5   1   2       bld Neu7 5g3  in                         XL022l14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAACAAGTGTAAACTTTGACAACAAAACAAGTTCTGTATATATGTATTTGCTTTAATTTCTATACTGTAGCCTAATGTAAATGGTTAGATCCTCCAATTATTGGGCCTGAACCTTATTTTGTCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAG
  5   1   2       chi Emb1      in                    IMAGE:3401772.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGGAGAAGGCCGGGCGGAGACGGCTCATTGAAGGTTAAAAAAATGGAACCAAAGCCATCAAGACTGCCTCGTAGGATAACTGTACAACCCTCCTCCTTGTCCCCCATAACTACTCGGACCCAGAGAGTTTACTTATCCTTTAATTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCATCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTTATTGAAGTCATTTATTTCATAGAAAATGGTTGAAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCACTGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAA
  3   1   2       bld Ga15 5g3  in                       XL505o16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAATGGTTAGATCCTCCAATTATTGGGCCTGAACCTTATTTTGTCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCCAGTATTA
  5   1   2       bld Neu7 5g3  in                         XL013f13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACGAGGATTGGGCCTGAACCTTATTTTGTCCAATAATCCTCTGAACCAATAAATTGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGAGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAG
  3   1   2       bld Eye1                            IMAGE:6957465.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAACTTTATTTTGTCCCAATAATCTTCTGAACCAATAAATGGCAGACACCTCTGATTTAGTTTTTGTTGTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAATGAATTTAAATTAAAATAAACATCTGCATTTC
  3   1   2       bld Tbd7                                 XL072g18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCCTTGGGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCTATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGATCAACATTACTGTACATT
  3   1   2       bld Neu7 5g3  in                         XL022l14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACAGCAGCTCAAGATTTCACCCCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAANAATTTAAATTAAAATAAACATT
  3   1   2       bld DMZ  5g3  in                         xl303p18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTGGTTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTTTTATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTAT
  3   1   2      seed Ga12 5g3  in                         XL206p16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCCTTAAGTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAA
  3   1   2       bld Ga15 5g3  in                       XL436c18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTAATGTCAGAGGGTTTATGTCACCTTACTTATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGGAAATCCNGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATNGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTnGGATTTTACATTTTTnGGATTnGGATTTTTTTTAANGAAAAATGATGACGATNGTTTGTCTTANGTATNGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATAAAATGAATTAAATAA
  3   1   2       bld Ga12                                 XL207p17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTT
  3   1   2       bld Ga12 5g3  in                         XL190p15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCAATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAATGAATTTAAA
  3   1   2       bld Tbd7 5g3  in                         XL072c01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATAGCAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCTATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTACTGTACATTTT
  3   1   2       bld Tbd7 5g3  in                         XL063g05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCTGATGCAAGACTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTTATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCACTGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAAACAGTATCAGTATTAACATTTACTTGTACATTTTTATGGAATTAAAANAATTTAAATTAAAATAAACATT
  3   1   2       bld Ga12 5g3  in                         XL156e08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATGCAAGANTGGGATGAAATAGGTAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGNTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGNACNAGCATTTTATACATGTGTCACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCAnTTGGATTTTACAnnTTTTGGATTTGGATTTTTTTTAATGAAAA
  3   1   2       bld Neu7                                 XL001j20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTNCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTNCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTATGTAATTAAAAGNAATTAAATTAA
  3   1   2       bld Neu7 5g3  in                         XL043g21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGCAGGAAATCCTGCTAATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAA
  3   1   2       bld Ga12 5g3  in                         XL173h08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAATAAAACACATAAATGAATATGATGATTCNTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCTATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTTACATTTTTTGGnTTTnTnTTTTTTTTAATGAAAAATGATG
  3   1   2       bld Neu7 5g3  in                         XL013f13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATAAAACACATAAATGAATATGATGATTCCTGAGCTATGTGGCTGAGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCTATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTA
  3   1   2       bld Neu7 5g3  in                         XL023a10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAAACACATAAATGAATATGATGATTCNTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTTTTATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGnnGTTTTTTTTTTTTTTTG
  3   1   2       bld Tbd7 5g3  in                         XL061e20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACACATAAATGAATATGATGATTCNTGAGCTATGTGGCTGGGTGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCTATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAANAATTTAAATTAAAATAAACATTNGTTTT
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3201520.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTATGTGGCTGGGTGCGACATTTTTTATCTGATATTCATCCTACTTCTTGGGAAACCAATTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTTTTATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACT
  3   1   2       bld Tbd7 5g3  in                         XL105k18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCGACATTGTTTTGCTGATATTCATCCTACTTCTTGGGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTTATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCACTGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAAACAGTATCAGTATTAACATTTACTTGTACATTTTTANNAATTAAAANAATTTA
  3   1   2       bld Tbd7 5g3  in                         XL075g03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCATCCTNCTTCTTGGGAAACCAAGTTAATGGNCTGATCATAAAATTACNCAGCNCAGATNATGTTATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCACTGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAANTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATNNAAACAGTATCAGTANTAACATTTACTTGTACATTTTTATGTNATTAAAA
  3   1   2       bld Tbd7 5g3  in                         XL062m18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAAACCAAGTTAATGGACTGATCATAAAATTACACAGCACAGATGATGTTATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCACTGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAAACAGTATCAGTATTAACATTTACTTGNACATTTTTATGNAATTAAA
  3   1   2       bld DMZ  5g3  in                         xl265n08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CANGTTAATGGNGNGNTCNTAAAATTACACAGCACNGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTGGTAGTGAACCAATGGCCATTATCTTGTGCNGACAGAAAATAACTNNNCCAANGTCACTGTACACGCCTGTGTCCCCNGNGTGAGCAAGCAATGCGTCACTGCAAAAGTAAGCCTTTTTATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTNTANGTACAAGCATTTTATACANGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGNGTAAAGTTTTTAGTCATTTGGATTnTACATTTTTTGGATTTGGnnTTTTTnTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGNANT
  3   1   2       bld Tbd7                                 XL068n05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAATGGACTGATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCATTTATATCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACT
  3   1   2       bld Ga15 5g3  in                       XL499o17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATCATAAAATTACACAGCACAGATGATGTCATTGAAGTCANNTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATNACTTACCCAATGTCNCTGTACACGCCTGTGTCCCCTGNGTGAGCAAGCAATGCGTCACNGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGNTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCTATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACC
  3   1   2       bld Neu7 5g3  in                         XL035a12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACACAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGAATTAAAATAATTTAAATTAAAATAAACATT
  3   1   2       bld Tbd2 5g3  in                    IMAGE:3201520.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCACAGATGATGTCATTGAAGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTTTTATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAATGAATTTAAATTAAAATAAACATTTGGTTTTTAATTTCAAAA
  3   1   2       bld Tbd7 5g3  in                         XL104a23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGTCATTTATTTCATAGAAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCACTGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAAACAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAANAATTTAAATTAAAATAAACATT
  3   1   2       bld Gas5 5x3  out                   IMAGE:3750500.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAATGGTTGTAGTGAACCAATGGCCATTATCTTGTGCAGACAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCTATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAATGAATTTAAATTAAAATAAACATTTGGTTTTTAATTTCAA
  5   1   2       bld Tbd7 5g3  in                         XL104a23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTATCTTGTGCAGACAGAAAATAACTTACCCACTGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGtttttagtcatttggattttacattttttggatttggattttttttAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAAACAGTATCAGTATTAACATTTACTTGTAcatttttatgtaattaaaatgaatttaaattaaaataaacatttggtttttaatttcaaaaaaaaaa
  3   1   2       bld Bla1                            IMAGE:3381016.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGAAAATAACTTACCCAATGTCACTGTACACGCCTGTGTCCCCTGTGTGAGCAAGCAATGCGTCACTGCAAAACTAAGCCTTTTTATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGTTTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCCATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAACCAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAATGAATTTAAATT
  3   1   2       bld Emb1      in                    IMAGE:3401772.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTGTCCCATGTGTGAGCAAGCAATGTGTCACTGCAAAACTAAGCCTTATATTAAATCTATTACATATCTTCCACGCTGGTACAATATCTTTAAAAACAAACAGGGTGAGATTTTTCTATCTTATGTTTATGTACAAGCATTTTATACATGTGTAACTGAACCACGTTGTACCAAAGGAATGGTTTTCCAATTGAGTGAGCTATCACTTTTCAGAAGTGTAAAGTTTTTAGTCATTTGGATTTTACATTTTTTGGATTTGGATTTTTTTTAATGAAAAATGATGACGATTGTTTGTCTTATGTATTGTACTAAAGCAAAAGGGTGTGCTCTGTATAAAAACAGTATCAGTATTAACATTTACTTGTACATTTTTATGTAATTAAAATGAATTTAAATTAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)