Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8821438.5                      40 PI      88        153      906                (no blast hit)

 This cluster: approximate FL confidence score = 86%

 1012837412 Xl3.1-IMAGE:8529704.5.5 - 38 ESTs
                                                                       -50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8529704.5.5                                                   TGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGACTCCAGCACTGAAATACCCTCCGTGTGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTTATATGCCGGCAGACCCGTGCCTCTTGGAAACTACCCTTGTTGATGAACCATACGACCACGTAACCTCGACCTTCCCACGTGGAAAATACAACTTATAGAGTTGCTGCAGCCAATCAAGTCTTTGTCTCACGTCAAGTGCATAACCGATTCCAGCACCACTGCTCTCATTGGCCAATCTCTACACGTCTGTGACTTCTCTGCGTGTAGACTATTAATTGCTTGTGATCCGGCTGAACGGCTTCTTTGGAACTTCCATGTTCAATTCCCTTCATCTCCAAATCAGATTTCCTGCAAAGTTCTCTGGAAATTGCCCTGGACTTTGTTTCTATTATTATTAGAATATTCATTAGGAGGTATAATGAGTCTATGTTTAGTCGTGCAGTAAAGCGATTTACAACTAAAACACTCTGTTTTATATACTCGGGATTAACTTACCCTTCATATACACACACACGATTCCAACACTTATAGTTTTCCCCTCCCTTTATGCTGAATGGTCTCCAGGCAGAAGTGTTGATCCCTCCCCGAGTTTTAAGCGACCAATTGAAATCTAATAGAGATTTGTATAATTACAATGTGACGTGGATAGGCGAAGTCACAATGATCACATGTTTGTCAATCGAATAACTATTCCCAGTATTTTTTTTTTTTATTTAAGATCTTGCTTTGATGGATTTAG
                                                  Xl3.1-CHK-1012721745                                                         AGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGACTCCAGCACTGAAATACCCxxCxxxTGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTTATATGCCGGCAGACCCGTGCCTCTTGGAAACTACCCTTGTTGATGAACCATACGACCACGTAACCTCGACCTTCCCACGTGGAAAATACAACTTATAGAGTTGCTGCAGCCAATCAAGTCTTTGTCTCACGTCAAGTGCATAACCGATTCCAGCACCACTGCTCTCATTGGCCAATCTCTACACGTCTGTGACTTCTCTGCGTGTAGACTATTAATTGCTTGTGATCCGGCTGAACGGCTTCTTTGGAACTTCCATGTTCAATTCCCTTCATCTCCAAATCAGATTTCCTGCAAAGTTCTCTGGAAATTGCCCTGGACTTTGTTTCTATTATTATTAGAATATTCATTAGGAGGTATAATGAGTCTATGTTTAGTCGTGCAGTAAAGCGATTTACAACTAAAACACTCTGTTTTATATACTCGGGATTAACTTACCCTTCATATACACACACACGATTCCAACACTTATAGTTTTCCCCTCCCTTTATGCTGAATGGTCTCCAGGCAGAAGTGTTGATCCCTCCCCGAGTTTTAAGCGACCAATTGAAATCTAATAGAGATTTGTATAATTACAATGTGACGTGGATAGGCGAAGTCACAATGATCACATGTTTGTCAATCGAATAACTATTCCCAGTATTTTTTTTTTTTATTTAAGATCTTGCTTTGATGGATTTAGCTGAAT
                                                      consensus depths                                                        2     2     2     2     2     2     2     5     2     8     2     9     4    12    14    21    14    25    15    26    15    26    15    26    26    26    26    26    27    27    28    29    28    29    28    29    28    29    29    29    29    29    29    29    29    29    30    30    30    30    30    31    30    31    30    31    32    32    32    32    32    32    32    32    32    32    31    32    32    32    32    32    32    32    32    32    32    32    31    32    32    32    31    32    31    32    32    32    31    32    32    33    30    32    31    31    29    31    29    31    29    31    29    31    29    31    27    32    28    32    28    32    23    31    25    31    25    32    25    32    23    32    20    32    18    32    18    32    16    31    15    30    15    29    17    27    14    24    11    24    10    24     8    23     7    22     7    20     6    19     5    18     5    18     6    17     6    15     5    15     5    11     5    11     5    10     6     9     5     7     5     7     6     7     6     8     6     8     6     8     8     9     5     7     6     7     6     7     6     7     6     7     6     7     5     7     6     7     5     7     5     7     5     7     5     7     5     6     4     6     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4
  5   1   2      3-95                            Xl3.1-IMAGE:8529704.5                                                 GATGTGACAGTGCGTGGAGTGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGACTCCAGCACTGAAATACCCTCCGGATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTTATATGCCGGCAGACCCGTGCCTCTTGGAAACTACCCTTGTTGATGAACCATACGACCACGTAACCTCGACCTTCCCACGTGGAAAATACAACTTATAGAGTTGCTGCAGCCAATCAAGTCTTTGTCTCACGTCAAGTGCATAACCGATTCCAGCACCACTGCTCTCATTGGCCAATCTCTACACGTCTGTGACTTCTCTGCGTGTAGACTATTAATTGCTTGTGATCCGGCTGTACGGCTTCTTTGGAACTTCCATGTTCAATTCCCTTCATCTCCAAATCCGATTTCCTGCAAAGTTCTCTGGAAATTGCCCTGGACTTTGTTTTTATTATTATTAGAATATTCATTAGGAGGTATAATGAGTCTATGTTTAGTCGTGCAGTAAAGCG
  5   1   2      3-95                            Xl3.1-IMAGE:6877868.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGTGGAACATACCGAAACAATGTCATTAATGAGCAGTTTCGCTGGGAAAGGGACTCTGCTGCTTCATCAGTGACTTCAATCTAGACATGGCTAGATCTGGTACTTGAGAGTGAATAGGGTAACGTATGTATATTAGTGCCTTTATATGCCGGCAGACCCGTGCTCTTGGAAACTACCCTTTGTTGATGAACCATACGACCACGTAACCTCGACGTTCCCACGTGGAAAATACAACTTATAGAGTTGCTGCAGCCAATCAAGTCTTTGTCTCACGTCAAGTGCATAACCGATTCCAGCACCACTGCTCTCATTGGCCAATCTCTACACGTCTGTGACTTCTCTGCGTGTAGACTATTAATTGCTTGTGATCCGGCTGAACGGCTTCTTTGGAACTTCCATGTTCAATTCCCTTCATCTCCAAATCAGATTTCCTGCAAAGTTCTCTGGAAATTGCCCTGGACTTTGTTTCTATTATTATTAGAATATTCATTAGGAGGTATAATGAGTCTATGTTTAGTCGTGCAGTAAAGCGATTTACAACTAAAACACTCTGTTTTATATACTCGGGATTAACTTACCCTTCATATACACACACACGATTCCAACACTTATAGTTTTCCCCTCCCTTTATGCTGAATGGTCTCCAGGCAGAAGTGTTGATCCCTCCCCGAGTTTTAAGCGACCAATTGAAATCTAATAGAGATTTGTATAATTACAATGTGACGTGGATAGGCGAAGTCACAATGATCACATGTTTGTCAATCGAATAACTATTCCCAGTATTTTTTTTTTTTATTTAAGATCTTGCTTTGATGGATTTAGCTGAATAATGTAATGTTTTTATAAATTGTCTACCTTCCCAATAGCAAATCCATTCACAGCCAGCC
                                                                   VAR                                                                                                                                       CCTCCGTGTGTGTCTGCTGGAAACTAAGGGCACCCCGTGTGTGCTAGGCTTCTATCAGCT
                                                                   SNP                                                                                                                                                                                                                                                                           ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                               C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                       -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------C-
                                               BLH ATG     157     227                                                   
                                               BLH MIN     115      84                                                   
                                               BLH MPR      -8      84                                                   
                                               BLH OVR     157      85                                                   
                                               EST CLI      34      42                                                   
                                               ORF LNG     157       3                                                   
  5   1   2      3-95                            Xl3.1-IMAGE:8529704.5                                                 GATGTGACAGTGCGTGGAGTGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGACTCCAGCACTGAAATACCCTCCGGATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTTATATGCCGGCAGACCCGTGCCTCTTGGAAACTACCCTTGTTGATGAACCATACGACCACGTAACCTCGACCTTCCCACGTGGAAAATACAACTTATAGAGTTGCTGCAGCCAATCAAGTCTTTGTCTCACGTCAAGTGCATAACCGATTCCAGCACCACTGCTCTCATTGGCCAATCTCTACACGTCTGTGACTTCTCTGCGTGTAGACTATTAATTGCTTGTGATCCGGCTGTACGGCTTCTTTGGAACTTCCATGTTCAATTCCCTTCATCTCCAAATCCGATTTCCTGCAAAGTTCTCTGGAAATTGCCCTGGACTTTGTTTTTATTATTATTAGAATATTCATTAGGAGGTATAATGAGTCTATGTTTAGTCGTGCAGTAAAGCG
                                                  Xl3.1-CHK-1012687570                                                       ACAGTGCGTGGAGTGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGACTCCAGCACTGAAATACxxxxCxGATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTTATATGCCGGCAGACCCGTGCCTCTTGGAAACTACCCTTGTTGATGAACCATACGACCACGTAACCTCGACCTTCCCACGTGGAAAATACAACTTATAGAGTTGCTGCAGCCAATCAAGTCTTTGTCTCACGTCAAGTGCATAACCGATTCCAGCACCACTGCTCTCATTGGCCAATCTCTACACGTCTGTGACTTCTCTGCGTGTAGACTATTAATTGCTTGTGATCCGGCTGAACGGCTTCTTTGGAACTTCCATGTTCTATTCCCTTCATCTCCAAATCCGATTTCCTGCAAAGTTCTCTGGAAATTGCCCTGGACTTTGTTTCTATTATTATTAGAATATTCATTAGGAGGTATAATGAGTCTATGTTTAGTCGTGCAGTAAAGCGATTTAC
  5   1   2       bld Int2 5x3                        IMAGE:8821486.5p CCCCCCTTGAATAAATGCGGACCCATCAAATTCAAATTCGTCCCCTCTGATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGACTCCAGCACTGAAATACCCTCCGTGCCTCCGTGTGTGTCTGCTGGAAACTAAGGGCACCCCGTGTGTGCTAGGCTTCTATCAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACATCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCCGGACCGGGTACTTCTTGTTCAGCTGGAAGAACGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCTCATCAGTGACCTCATTCTAGACATGGCTAGATCTGGTACTATGAAAGTGAATAGGTACGTATGTATATATGCTTTATATGCGCGACCGTGCCTCTTGGAAACTACCCTTGTTTGAAGAACCATACGACA
  5   1   2       bld Int2 5x3                        IMAGE:8531272.5p                                       GAAGATCTCTGATGTGACAGTGCGTGGAGTGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGACTCCAGCACTGAAATACCCTCCGTGCCTCCGTGTGTGTCTGCTGGAAACTAAGGGCACCCCGTGTGTGCTAGGCTTCTATCAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTCTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTACTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGCNGTGGTGGGTGACATACGGAACATGTCATTATGAGCATCGCTGGGGAAGAGACTCTCTGCTGCTCATCATGACTTCATCTAGACTGCTAGTCTGTACTATGAGATGATAGGTACGTAGTTATATGCTATTGCCGCA
  5   1   2       bld Int2 5x3                        IMAGE:8823461.5p                                                                                      GTTATAAAATAAATGATTATATAGGTTTTAAATAATTCGTCCCCTCTGATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTTATATGCCCGGCAGACCCGTGCTCTTGGAAACTACCCTGTTGATGACATACGACACGTACTCGACTTTCCCACCGTGAAATACACCTATAGAGTGCTGCAGCCATTCAGTCTTGTCTCACGTTCAAGTGCAAACCGAATCAGCCCACAGTGTATCTCTATATGGGGA
  5   1   2       bld Int2 5x3                        IMAGE:8822426.5p                                                                                      TCATCCTTTTTGCATGAGCTATATTATAACTGAATTCGTCCCCTCCGTGCCTCCGTGTGTGTCTGCTGGAAACTAAGGGCACCCCGTGTGTGCTAGGCTTCTATCAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTTATGTTGATCTTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCAGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAATGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTTGGTACTATGAGAGTGAATAGGGTAACGGTATGTATATAGTGCCTTTATAATGCCGGCAGAACCGTTGCTTCTTGAAACTACCCTTGTGATGAACCATACGACCACGTAACCTCGGACCTTCCCACGTGGAAATACAACTTATAAGTTGCTGCCAGCCAATCAAGGTTCTTGTCTACGTT
  5   1   2       bld Int2      in                    IMAGE:8820827.5p                                                                                      TTGTTTAAATTATGTAGTTAAATTAATTTAAATTCGTCCCGATCTCTGATGTGACAGTGCGTGGAGTGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTCTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTACTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAAGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTACCGTATGTATATAGTGCCTTTATATGCCGGCAGACCCGTGCTCTGAACTACCCTTGTTGATGACATACGACCACGTACTCGACTCCACGTGGAAATACACTATAGAGTGCTGCAGCAATCCAGTCTTTGTCCAGGTCAAGTGCTAACCGATCCAGCACACTGTCTTCTAATGGCCAATCCTTACG
  5   1   2       bld Emb1 5x3                        IMAGE:6631850.5p                                                                                         ATGGGAGGTGGGAGGAATTCGGTCACTCAGTTGTGAAGATCTCTGATGTGACAGTGCGTGGAGTGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTCTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCTGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAAAANGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAAACCGTATGTATATAGTGGCCTTTATATGCCCGGCAGAACCCCTGCCCTCTTGGGAAAACTACCCCTTGNTTGGATGAAACCATTACGAACCCACGNTAACCCTCCGACCCTTTCCCCACGTTGGGAAAAAAT
  5   1   2       bld Em10 5x3                        IMAGE:8321557.5p                                                                                             TCTTTTGAACAGTTTCGGTCCGGAATTCCCGGGATCTCTGAATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTTCTTGTTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTTCATTCCTAGACATGGCTAGATCTTGGTACT
  5   1   2       bld Int2 5x3                        IMAGE:8823253.5p                                                                                              GAAGAGGGAAAATCGAAGGAGGATGCTCGCCATTTAATTCGTCCCCGTGTGTGTCTGCTGGAAACTAAGGGCACCCCGTGTGTGCTAGGCTTCTATCAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACATCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAAGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTTGCCTTTATATGCCCGGCAGACCCGTGCCTCTGGAACTACCCTTGTTGATGACCATACGACACGTTACTTCGGACCTTTCCCACCGTGGAAAATACACTTATGAAGTTGCTGCAGCCAATCAGGTCTTTTGTCTCACGTCAAGTGCATAACCGATTCCAGCCACACGTGCCTTCTCATTGGCCAGTCTCTTA
  5   1   2       bld Thy  5x3                        IMAGE:8549972.5p                                                                                                          GGGAGACATGATTCAATTCGTCCCTCTGATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTCTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACTCTCTGCTGCCTCATCAGTGACTTCATTCTAGACATGCTAGATCTGTACTATGAATGATAGGTAACGTAGTAATATGCTTATTGCCGCGACCGTGCTCTGAACTACCTGTGAGACATACACACTACTCACTTCACTGAATCACTAAAGTCTGACATCATCTGCCGTAGGTACATCGCCCGCCATGCATCTACTGATCTGCGATTATGTGACGGAGTTGATCGATCTTCA
  5   1   2       bld Int2 5x3                        IMAGE:8821396.5p                                                                                                                ACATGGTGAGTATAGAGGATCCATCGAAACGAATTCGTCCCGGAAACTAAGGGCACCCCGTGTGTGCTAGGCTTCTATCAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAAGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTTATATGCCGCAGACCCGTGCCTCTTGGAAACTACCCTGTGATGATCATACGACACGTACTCGACTCACGTGAAATACCACCTATAGAGTGCTGCAGCATCAGTCTTGTCTCCGTCAGGTGCAAACCGATCAGACAACC
  5   1   2       bld Tad1      in                    IMAGE:6877868.5p                                                                                                                  GGGACTGAAATACCCTCCGTGCCTCCGTGTGTGTCTGCTGGAAACTAAGGGCACCCCGTGTGTGCTAGGCTTCTATCAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTCTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCCGGAGCCGGGACCGCGTTACTTCTTTGTTCAGCTGGAAACAAGGCGGTGGGTGGTGGGACATAAACCGGAACATTGGTCATTAAATGAGCCAGTCCGCTGGGGAAAGGAAGACCTCCTCTGCTGGCCTCCCATCAGTGGACCTTTCATTCCTAAGACATGGCCTAGAATCTTGGA
  5   1   2      seed FaBN 5x3                        IMAGE:8076400.5p                                                                                                                           GAAGATCTCTGATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATA
  5   1   2       bld Int2 5x3                        IMAGE:8526782.5p                                                                                                                              GATCTCTGATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACATCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAACCTCTCTGCTGCCTCATCAGTGACCTTCATTCTAGACATGCTAGATCTGTACTATGAAGTGATAGGGTAACGTATGTATATAGTGCTTTAATGCCGCAGACGTGCTCTGGAACTCCCTGTGATAACAACACACGTACTCACTTCACGTGAATCACTAAAGTCTGACATCATCTTTCTCATAGGTACGATCACCCTGCTCTGCATCCCGT
  5   1   2       bld DMZ  5g                              xl308b17.5p                                                                                                                              GATCTCTGATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGANAATGTGNAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAANATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCANCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCNGANCCGGGACCGGNTACTTCTTGTTCAGCTGGAA
  5   1   2       bld Tail 5x3                        IMAGE:8545736.5p                                                                                                                               ATCTCTGATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACATCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGAACTCTCTGCTGCCTCATCAGTGACCTTATTCCTAGACATGCTAGATCTGTACTATGAGAGTGATANGGTAACGTATGTATATAGTGCTTTTATGCGGCAGACCGTGCTCTGAAACTACCCTGTGATGACATACACACTACTCGACTCCACGTGAATCACTATAATGCGCACATA
  5   1   2       bld Em10 5x3                        IMAGE:7979162.5p                                                                                                                                 CTCTGATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAATGACCTTCTTCCTAGACTGGCTAGATCTGGACTATGAAGTGGATAGGGTAACGTATGTATTAGTGCCTTTATAGCCGGCGACCGTGCTCTTGAACCTACCTGTTATGACCAACGACAC
  5   1   2       bld Int2 5x3                        IMAGE:8530450.5p                                                                                                                                 CTCTGATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAACTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCATATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGT
  5   1   2       bld Int2 5x3                        IMAGE:8529704.5p                                                                                                                                 CTCTGATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACATCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTATATGCCGGCAGACCGTGCCTCTGG
  5   1   2       bld Eye1 5x3                        IMAGE:6959652.5p                                                                                                                                  TCTGATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTATGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGGAAGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTTATATGCCGGCAGACCCGTGCCTCTTGGAAACTACCCTTGTTGATGAACCATACGACCACGTAAACCTCGACCTTCCCACGTGGGAAAAACAAACT
  5   1   2       bld Int2 5x3                        IMAGE:8530345.5p                                                                                                                                     GATGTGACAGTGCGTGGAGCGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACATCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGAACTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATG
  5   1   2       bld Int2 5x3                        IMAGE:8529448.5p                                                                                                                                      GCCTCCGTGTGTGTCTGCTGGAAACTAAGGGCACCCCGTGTGTGCTAGGCTTCTATCAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAACTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCATATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAG
  5   1   2       bld Int2 5x3                        IMAGE:8529835.5p                                                                                                                                            GTGTGTGTCTGCTGGAAACTAAGGGCACCCCGTGTGTGCTAGGCTTCTATCAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCCTTATATGCCGGCAGACCCGTGCCTCTTGGAAACTACCCTTGTGAT
  5   1   2       add Tbd5 5g                         IMAGE:3580819.5p                                                                                                                                             TGTGNNTCTGCTGGAAACTAAGGGCACCCCGTGTGTGCTAGGCTTCTATCAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAACTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAAGGGCTGAAGATTTCGCGGGAAGCCTTGCTGGGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCCGGGCCCCATGGGACCACACTGATGGAGACTTACAAAACAGTGGGGGCACGTATGGTCAAGTTACCCCACATGATGGAGACCCTGCTGGATATCATTCCAGTGGTG
  5   1   2       bld Int2 5x3                        IMAGE:8527334.5p                                                                                                                                                   GTCTGCTGGAAACAAGGGCACCCCGTGTGTGCTAGGCTTCTATCAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAACTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCATATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAAGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTATACATGGCTAGATCTGGTACTATAAAAATAAAACGGTAACCG
  5   1   2       bld Int2 5x3                        IMAGE:8530875.5p                                                                                                                                                   TCTGCTGGAAACTAAGGGCACCCCGTGTGTGCTAGGCTTCTATCAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGAT
  5   1   2       add Emb3 5g                         IMAGE:3400179.5p                                                                                                                                                        CGACCTCCTGCTACCGGGACTGAGAGCGGCCACTGCTAGAGCTGATCTCTGGACATGAATCACTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTCTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGGTGGGTTTGCTGTACGAGGGGCTGAAAATATCACGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATGTAACTCCATGCCGGTGCCGGTGCCAAATGAGACCCCACTGATGGAGACTCACACAACAGCAGGGCAGCGTATGTTCAGTTGTCTCTACATGAATGCTACCCTGATGCACATC
  5   1   2       bld FaBN                            IMAGE:8078775.5p                                                                                                                                                                                                                      CTCTCACCATATGGCAACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTTATATGCCGGCAGACCCGTGCCTCTTGGAAACTACCCTTGTTGATGAACCATACGAC
  5   1   2       bld Int2                            IMAGE:8530113.5p                                                                                                                                                                                                                                  TGGCACTACCAGCGACCCACACGCCGGCCACCAGCACCCCACCACGTCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTTATATGCCGGCAGACCCGTGCCTCTTNGGAACTACCTTTGTGATGAACATACGCCACGTAACTCGACTTCCACGTGGAAATACACTTATGAGTGCTGCGCCATCAGTCTTGTTCACTCAGTGCTACGATCAGCCACTGTCTCTGGCATCCTACCTCGTATCCTCTGAACATATGCTGG
  5   1   2       chi Int2                            IMAGE:8821358.5p                                                                                                                                                                                                                                    CCCCCCCTGAAAAAGGGCATGAGCCCCACGATACGAATTCGTCCCCTGGAAGTCACGGCGACCATGGGGGAGGGTGTGGGATGCACATGATGGCAATGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAACTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCATATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTTATATGCCTCTTGGCTGTGTGAAACTGTCCCTTGTGGATGAACCATACGACCACGGAACCTCGACCTTCCCACGTGGCTCCTGGAAAATACAACTTATAGTGTTGCTGCAGCCAATCAAGTCTTTGTCTCACGTCAAGTGCATAGCCGATTCCAGCACACTGCTCTCATTGGGCCAATCTCTACACGTCTGTGACTCTCTGCGTGTAGACTATTAATTGCTTGGTGATCGGCCGTACGGCTTCTTTGGAACTTCCATGTTTCATTTCC
  5   1   2       bld Tad1                            IMAGE:6937698.5p                                                                                                                                                                                                                                                                                                                                   GGGACCTTTTACTTTGGATATGAGAATGTGGAGGTGCTATTCACAGGCCTGGTCATTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGGCCTTTATATGCCGGCAGACCCGTGCCCTCTTGGAAACTACCCTTGTTGATGAACCATACGACCACGTTAACCTCGACCTTCCCACGTGGAAAATACCACTTTATAGAGTTGCCTTCCGCCCAACCAAGTCTTTGGTC
  5   1   2       chi Int2                            IMAGE:8821788.5p                                                                                                                                                                                                                                                                                                                                                        TTGCCTTTGATGTGACCTTCTGGTAGAGCTCCCTTTATTCGTCCCGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACTTGCTGCAGACCCTGCTGCACATCGTCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAACGAGCAGTCGTTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGCTACTATGAGAGTGAGTAGGTTAACCGTATGTATATAGTGCCTTTATATGCCTCTTGGCTGTATGAAACTGTCCCTTGTGGATGAACCATACGACCACGGAACCTCGACCTTCCCACGTGGCTCCTGGAAAATACAACTTATAGTGTTGCTGCAGCCAATCAAAGTCTTTGTCTCACGTCAAGTGCATAGCCGATTCCAGCACCACTGCTCTCATTGGCCAATCACTACACGTCTGTGACTTCTCTGCGTGTAGACTATTAATTGCTTGTGATCCGGCCGTACGCTTCTTTGCAACTTCCATGTTCAATTCCCTTCATCTCCAAATCCGATTTCCTGCAAGTTCCTCTGGAAATGCCTGGACTTTGTTTCTTATTATTATTAGATTATTCATTAAGAAGATATGAAGTCTATGTTTAGTCCTGCAGTAGCGATGTACAACCTACCAGACTCTGTCCTGTTATAATACCTCGGA
  5   1   2       bld Int2                            IMAGE:8529604.5p                                                                                                                                                                                                                                                                                                                                                                                          TTAATTCTGCAGGAGAAATGGCGGGCGCCTTTGTGGCCGTGTTCCTGTTGGGTTTGCTGTACGAGGGGCTGAAGATTTCGCGGGAAGCCTTGCTGAGGAAGTCACAAGTCAGCATCCGATATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCACACTGATGGAGACTCACAAAACAGTGGGGCAGCGTATGTTCAGTTTACCCCACATGATGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTTATATGCCGGCAGACCCGTGCCTCTTGGAAACTACCCTTGTTGATGAACCATACGACCACGTAACCTCGACCTTCCCACGTGGAAAATACAACTTATAGAGTTGCTGCAGCCAATCAAGTCTTTGTCTCACGTCAAGTGCATAACCGATTCCAGCACCACTGCTCTCATTGGCCAATCTCTACACGTCTGTGACTTCTCTGCGTGTAGACTATTAATTGCTTGTGATCCGGCTGAACGGCTTTCTTTGAACTCCCATGTCAATTTCC
  5   1   2       bld Ga15      in                       XL403l07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCAGACCCTGCTGCACATCATCCAAGTGGTGGTGAGTTATTTCCTTATGTTGATCTTCATGACGTACAACGCTTACCTGTGCATCGCTGTGGCTGCCGGAGCCGGGACCGGGTACTTCTTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATAACGGAACATTGTCATTAATGAGCAGTCGCTGGGGAAGGAGACCTCTCTGCTGCCTCCATCAGTGACCTTCATTCCTAGACATGGCTAGATCTGGTACTATGAGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTTATATGCCGGCAGACCCGTGCCTCTTGGAAACTACCCTTGTTGATGAACCATACGACCACGTAACCTCGACCTTCCCACGTGGAAAATACAACTTATAGAGTTGCTGCAGCCAATCAAGTCTTTGTCTCACGTCAAGTGCATAACCGATTCCAGCACCACTGCTCTCATTGGCCAATCTCTACACGTCTGTGACTTCTCTGCGTGTAGACTATTAATTGCTTGTGATCCGGCCGTACGGCTTCTTTGGAACTTCCATGTTCTATTCCCTTCATCTCCAAATCCGATTTCCTGCAAAGTTCTCTGGAAATTGCCCTGGACTTTGTTTTTATTACTAATAGAATATTCATTAGGAGGTATAATGAGTCTATGTTTAGTCGTGCAGTAAAGCGATTTACAACTACAACACTCTGTCTGTTTTATATACTCGGGATTAATTTACC
  5   1   2       bld Egg1                               PBX0096A10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAGTGAATAGGGTAACCGTATGTATATAGTGCCTTTATATGCCGGCAGACCCGTGCCTCTTGGAAACTACCCTTGTTGATGAACCATACGACCACGTAACCTCGACCTTCCCACGTGGAAAATACAACTTATAGAGTTGCTGCAGCCAATCAAGTCTTTGTCTCACGTCAAGTGCATAACCGATTCCAGCACCACTGCTCTCATTGGCCAATCTCTACACGTCTGTGACTTCTCTGCGTGTAGACTATTAATTGCTTGTGATCCGGCTGAACGGCTTCTTTGGAACTTCCATGTTCAATTCCCTTCATCTCCAAATCAGATTTCCTGCAAAGTTCTCTGGAAATTGCCCTGGACTTTGTTTCTATTATTATTAGAATATTCATTAGGAGGTATAATGAGTCTATGTTTAGTCGTGCAGTAAAGCGATTTACAACTAAAACACTCTGTTTTATATACTCGGGATTAACTTACCCTTCATATACACACACACGATTCCAACACTTATAGTTTTCCCCTCCCTTTATGCTGAATGGTCTCCAGGCAGAAGTGTTGATCCCTCCCCGAGTTTTAAGCGACCAATTGAAATCTAATAGAGATTTGTATAATTACAATGTGACGTGGATAGGCGAAGTCACAATGATCACATGTTTGTCAATCGAATAACTATTCCCAGTAttttttttttttATTTAAGATCTTGCTTTGATGGATTTAGCT
  3   1   1       add Ga15      in                       XL403l07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGTAGANTATTAATNGCTTGTGATCCGGCCGTACGGNTTCTTTGGAACTTCCATGTTCTATTCCCNTCATCTCCAAATCCGATTTCCTGCAAAGTTCTCNGGAAATTGCCCTGGACTTTGTTTTTATTATNTANTAGAATATTCATTAGGAGGTATAATGAGTNTATGTNTAGTCGTGCAGTAAANCGATTTACAAGCTACAAC
  5   1   2      3-95                            Xl3.1-IMAGE:6877868.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGTGGAACATACCGAAACAATGTCATTAATGAGCAGTTTCGCTGGGAAAGGGACTCTGCTGCTTCATCAGTGACTTCAATCTAGACATGGCTAGATCTGGTACTTGAGAGTGAATAGGGTAACGTATGTATATTAGTGCCTTTATATGCCGGCAGACCCGTGCTCTTGGAAACTACCCTTTGTTGATGAACCATACGACCACGTAACCTCGACGTTCCCACGTGGAAAATACAACTTATAGAGTTGCTGCAGCCAATCAAGTCTTTGTCTCACGTCAAGTGCATAACCGATTCCAGCACCACTGCTCTCATTGGCCAATCTCTACACGTCTGTGACTTCTCTGCGTGTAGACTATTAATTGCTTGTGATCCGGCTGAACGGCTTCTTTGGAACTTCCATGTTCAATTCCCTTCATCTCCAAATCAGATTTCCTGCAAAGTTCTCTGGAAATTGCCCTGGACTTTGTTTCTATTATTATTAGAATATTCATTAGGAGGTATAATGAGTCTATGTTTAGTCGTGCAGTAAAGCGATTTACAACTAAAACACTCTGTTTTATATACTCGGGATTAACTTACCCTTCATATACACACACACGATTCCAACACTTATAGTTTTCCCCTCCCTTTATGCTGAATGGTCTCCAGGCAGAAGTGTTGATCCCTCCCCGAGTTTTAAGCGACCAATTGAAATCTAATAGAGATTTGTATAATTACAATGTGACGTGGATAGGCGAAGTCACAATGATCACATGTTTGTCAATCGAATAACTATTCCCAGTATTTTTTTTTTTTATTTAAGATCTTGCTTTGATGGATTTAGCTGAATAATGTAATGTTTTTATAAATTGTCTACCTTCCCAATAGCAAATCCATTCACAGCCAGCC
                                                  Xl3.1-CHK-1012712174                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACATACCGAAACAATGTCATTAATGAGCAGTTTCGCTGGGAAAGGGACTCTGCTGCTTCATCAGTGACTTCAATCTAGACATGGCTAGATCTGGTACTTGAGAGTGAATAGGGTAACGTATGTATATTAGTGCCTTTATATGCCGGCAGACCCGTGCTCTTGGAAACTACCCTTTGTTGATGAACCATACGACCACGTAACCTCGACGTTCCCACGTGGAAAATACAACTTATAGAGTTGCTGCAGCCAATCAAGTCTTTGTCTCACGTCAAGTGCATAACCGATTCCAGCACCACTGCTCTCATTGGCCAATCTCTACACGTCTGTGACTTCTCTGCGTGTAGACTATTAATTGCTTGTGATCCGGCTGAACGGCTTCTTTGGAACTTCCATGTTCAATTCCCTTCATCTCCAAATCAGATTTCCTGCAAAGTTCTCTGGAAATTGCCCTGGACTTTGTTTCTATTATTATTAGAATATTCATTAGGAGGTATAATGAGTCTATGTTTAGTCGTGCAGTAAAGCGATTTACAACTAAAACACTCTGTTTTATATACTCGGGATTAACTTACCCTTCATATACACACACACGATTCCAACACTTATAGTTTTCCCCTCCCTTTATGCTGAATGGTCTCCAGGCAGAAGTGTTGATCCCTCCCCGAGTTTTAAGCGACCAATTGAAATCTAATAGAGATTTGTATAATTACAATGTGACGTGGATAGGCGAAGTCACAATGATCACATGTTTGTCAATCGAATAACTATTCCCAGTATTTTTTTTTTTTATTTAAGATCTTGCTTTGATGGATTTAGCTGAATAATGTAATGTTTTTATAAATTGTCTACCTTCCCAATAGCAAATCCATTCACAGCCAGCCCAACCA
  3   1   2       chi Int2      in                    IMAGE:8820827.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCAGTGCATCGATGTGATGCGAACCGGACAGGTAACTATGTCCAGTGAGGAAGGCAGTGGTGTGGAACATACCGAAACAATGTCATTAATGAGCAGTTTCGCTGGGAAAGGGACTCTGCTGCTTCATCAGTGACTTCAATCTAGACATGGCTAGATCTGGTACTTGAGAGTGAATAGGGTAACGTATGTATATTAGTGCCTTTATATGCCGGCAGACCCGTGCTCTTGGAAACTACCCTTTGTTGATGAACCATACGACCACGTAACCTCGACGTTCCCACGTGGAAAATACAACTTATAGAGTTGCTGCAGCCAATCAAGTCTTTGTCTCACGTCAAGTGCATAACCGATTCCAGCACCACTGCTCTCATTGGCCAATCTCTACACGTCTGTGACTTCTCTGCGTGTAGACTATTAATTGCTTGTGATCCGGCTGAACGGCTTCTTTGGAACTTCCATGTTCAATTCCCTTCATCTCCAAATCAGATTTCCTGCAAAGTTCTCTGGAAATTGCCCTGGACTTTGTTTCTATTATTATTAGAATATTCATTAGGAGGTATAATGAGTCTATGTTTAGTCGTGCAGTAAAGCGATTTACAACTAAAACACTCTGTTTTATATACTCGGGATTAATTTACCCTTCATATACACACACACGATTCCAACACTTATAGTTTTACCCTCCCTCTATGCTGAATGGTCTCCAGGCAGAAGTGTTGATCCCTCCCCGAGTTTTAAGCGACCAATTGAAATCTAATAGAGATTTGTATAATTACAATGTGACGTGGATAGGCGAAGTCACAATGATCACATGTTTGTCAATCGAATAACTATTCCCAGTATTTTTTTTTTTTATTTAAGATCTTGCTTTGATGGATTTAGCTGAATAATGTAATGTTTTTATAAATTGTCTACCTTCCCAATAGCAAATCCATTCACAGCCAGCCCAACCAACCCG
  3   1   2      seed Tad1      in                    IMAGE:6877868.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGAAACTTTGTTCATAAATGAGCAGTTCGCCTGGGGAAGGAGAACCTTTTTTGTGCCCTCCCTCAGGGACCTTCATTCCTAGACCATGGCTAGATCGGGTACTAAGAGAGTGATTAGGGTAACCGTATGTATATAGTGCCTTTTTATGCCGGCAGACCCGTGCCTCTTGGAAACTACCTTTGTTGATGAACCATACGACCACGTAACCTCGACCTTCCCACGTGGAAAATACAACTTATAGAGTTGCTGCAGCCAATCAAGTCTTTGTCTCACGTCAAGTGCATAACCGATTCCAGCACCACTGCTCTCATTGGCCAATCTCTACACGTCTGTGACTTCTCTGCGTGTAGACTATTAATTGCTTGTGATCCGGCTGAACGGCTTCTTTGGAACTTCCATGTTCAATTCCCTTCATCTCCAAATCCGATTTCCTGCAAAGTTCTCTGGAAATTGCCCTGGACTTTGTTTCTATTATTATTAGAATATTCATTAGGAGGTATAATGAGTCTATGTTTAGTCGTGCAGTAAAGCGATTTACAACTAAAACACTCTGTTTTATATACTCGGGATTAACTTACCCTTCATATACACACACACGATTCCAACACTTATAGTTTTCCCCTCCCTTTATGCTGAATGGTCTCCAGGCAGAAGTGTTGATCCCTCCCCGAGTTTTAAGCGACCAATTGAAATCTAATAGAGATTTGTATAATTACAATGTGACGTGGATAGGCGAAGTCACAATGATCACATGTTTGTCAATCGAATAACTATTCCCAGTATTTTTTTTTTTATTTAAGATCTTGCTTTGATGGATTTAGCTGAATAATGTAATGTTTTTATAAATGTCGTTTGTTC
  5   1   2       bld Egg2                            IMAGE:5278883.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTCTTTGGAACTTCCATGTTCAATTCCCTTCATCTCCAAATCAGATTTCCTGCAAAGTTCTCTGGAAATTGCCCTGGACTTTGTTTCTATTATTATTAGAATATTCATTAGGAGGTATAATGAGTCTATGTTTAGTCGTGCAGTAAAGCGATTTACAACTAAAACACTCTGTTTTATATACTCGGGATTAACTTACCCTTCATATACACACACACGATTCCAACACTTATAGTTTTCCCCTCCCTTTATGCTGAATGGCCTCCAGGCAGAAGTGTTGATCCCTCCCCGAGTTTTAAGCGACCAATTGAAATCTAATAGAGATTTGTATAATTACAATGTGACCTGGATAGGCGAAGTCACAATGATCACATGTTTGTCAATCGAATAACTATTCCCAGTAttttttttttttATTTAAGATCTTGCTTTGATGGATTTAGCTGAATAATGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)