Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6955905.5                      26 END     1           1        3                LOC446276 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012837434 Xl3.1-IMAGE:6640939.5.5 - 64 ESTs
                                                                       ........-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6640939.5.5                                                 AGGAAGAGTGAAGCAGACCCACAGTGAAGCGGGACATTAAATCCACAACCCGGGACAGCAGGACAGGCAGCTGCAAACAGGACAGTTGGGGGCCATCTCCTAATTTTTATCTCACCCATCCGGCTGCGGTCACGCCTCTTTCCTGGGTCCTCAGCCGACAGCTCGTGACGTCAGGCGCATAGTCTCTTCTCGCGAGACTTCGGAAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCCAGGGATGTCTGGAATCAAACAGGGCCGTGGTTCTTCAGCAGTGGAGAGGGAAGAATTGCGTCAGATATTTAATGATATTAGTAGTAGCAGTGATGGAGAAGAGGGAGAACGCCAGGAAGAAGAAGATCTTAATATCATGGAGACTGAGGAGCAGAGGGCAGGACAGGATGGTCAAAAAGGAGGCACTAACCAGATTGTTCTGGAGATGCAGAAACAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCAAATAAAATCTTTTGATTGTTA
                                                  Xl3.1-CHK-1012722207                                                       AGTGAAGCAGACCCACAGTGAAGCGGGACATTAAATCCACAACCCGGGACAGCAGGACAGGCAGCTGCAAACAGGACAGTTGGGGGCCATCTCCTAATTTTTATCTCACCCATCCGGCTGCGGTCACGCCTCTTTCCTGGGTCCTCAGCCGACAGCTCGTGACGTCAGGCGCATAGTCTCTTCTCGCGAGACTTCGGAAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCCAGGGATGTCTGGAATCAAACAGGGCCGTGGTTCTTCAGCAGTGGAGAGGGAAGAATTGCGTCAGATATTTAATGATATTAGTAGTAGCAGTGxxGxAGAxGxxGGAGAACGCCAGGAAGAAGAxxxTCTTAATATCATGGAGACTGAGGAGCAGAGGGCAGGAxxxxAxGxTxxxAAAGGAGGCACTAACCAGATTGTTCTGGAGATGCAGAAACAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCAAATAAAATCTTTTGATTGTTACCCTTC
                                                      consensus depths                                                      3     5     3     5     3     5     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     6     8     6     8     5     9     6     9     7     9     8    10     9    12    11    17    15    20    16    24    16    27    20    29    23    30    23    30    25    30    30    32    30    32    30    32    30    32    30    32    31    32    31    32    31    32    31    32    31    32    32    32    32    32    32    32    31    31    31    31    31    31    30    31    31    31    30    30    30    30    30    30    30    30    31    31    30    30    27    30    29    30    28    30    29    30    30    31    30    32    30    32    30    32    25    30    27    29    25    29    25    28    26    28    24    27    24    29    24    27    24    25    24    25    22    23    20    22    21    21    19    20    18    19    17    19    17    19    16    19    14    19    15    19    13    18    14    18    13    18    11    17     9    15     8    15     7    15     4    15     4    13     4    13     4    13     4    14     3    14     3    12     3    11     3    10     6    10     3    10     4    11     5    10     4    10     5     9     8    12     9    13     9    14     9    15    12    18    13    18    14    18    18    21    18    21    18    21    18    21    18    21    18    20    20    22    21    22    20    22    20    23    21    22    21    22    21    21    21    21    21    21    21    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    25    26    25    26    25    26    25    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    24    25    25    25    25    25    25    25    24    25    25    25    25    25    25    25    25    25    24    24    24    24    24    24    23    24    21    23    21    23    20    22    18    21    14    17     5     8     4     4
  5   1   2       e50                            Xl3.1-IMAGE:6640939.5                                                 AGGAAGAGTGAAGCAGACCCACAGTGAAGCGGGACATTAAATCCACAACCCGGGACAGCAGGACAGGCAGCTGCAAACAGGACAGTTGGGGGCCATCTCCTAATTTTTATCTCACCCATCCGGCTGCGGTCACGCCTCTTTCCTGGGTCCTCAGCCGACAGCTCGTGACGTCAGGCGCATAGTCTCTTCTCGCGAGACTTCGGAAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCCAGGGATGTCTGGAATCAAACAGGGCCGTGGTTCTTCAGCAGTGGAGAGGGAAGAATTGCGTCAGATATTTAATGATATTAGTAGTAGCAGTGATGGAGAAGAGGGAGAACGCCAGGAAGAAGAAGATCTTAATATCATGGAGACTGAGGAGGAGCAGAGGGCAGGACAGGATGGTCAAAAAGGAGGCACTAACCAGATTGTTCTGATGCAGAAACAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAG
  5   1   2       e50                            Xl3.1-IMAGE:7208526.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAAAAAGGAGGCACTAACCAGATTGTTCTGGAGATGCAGAAACAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCAAATAAAATCTTTTGATTGTTACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                     TGAATGGGGGTCACTGACCCTGTCTAAAAACAAATGCTCTATTTCATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAATTGCGTCAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGGTCAAAAAGGAGGCACTAACCAGATTGTTCTG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                         --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------G---A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------A-----
                                               BLH ATG     369    1037                                                 
                                               BLH MIN     369     182                                                 
                                               BLH OVR     369     935                                                 
                                               EST CLI     212       8                                                 
                                               ORF LNG     369      40                                                 
  5   1   2       e50                            Xl3.1-IMAGE:6640939.5                                                 AGGAAGAGTGAAGCAGACCCACAGTGAAGCGGGACATTAAATCCACAACCCGGGACAGCAGGACAGGCAGCTGCAAACAGGACAGTTGGGGGCCATCTCCTAATTTTTATCTCACCCATCCGGCTGCGGTCACGCCTCTTTCCTGGGTCCTCAGCCGACAGCTCGTGACGTCAGGCGCATAGTCTCTTCTCGCGAGACTTCGGAAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCCAGGGATGTCTGGAATCAAACAGGGCCGTGGTTCTTCAGCAGTGGAGAGGGAAGAATTGCGTCAGATATTTAATGATATTAGTAGTAGCAGTGATGGAGAAGAGGGAGAACGCCAGGAAGAAGAAGATCTTAATATCATGGAGACTGAGGAGGAGCAGAGGGCAGGACAGGATGGTCAAAAAGGAGGCACTAACCAGATTGTTCTGATGCAGAAACAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAG
                                                  Xl3.1-CHK-1012687336                                                       AGTGAAGCAGACCCACAGTGAAGCGGGACATTAAATCCACAACCCGGGACAGCAGGACAGGCAGCTGCAAACAGGACAGTTGGGGGCCATCTCCTAATTTTTATCTCACCCATCCGGCTGCGGTCACGCCTCTTTCCTGGGTCCTCAGCCGACAGCTCGTGACGTCAGGCGCATAGTCTCTTCTCGCGAGACTTCGGAAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCCAGGGATGTCTGGAATCAAACAGGGCCGTGGTTCTTCAGCAGTGGAGAGGGAAGAATTGCGTCAGATATTTAATGATATTAGTAGTAGCAGTGATGGAGAAGAGGGAGAACGCCAGGAAGAAGAxxxTCTTAATATCATGGAGACTGAGGAGGAGCAGAGGGCAGGACAGGATGGTCAAAAAGGAGGCACTAACCAGATTGTTCTGxxGxxGAAACAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAG
  5   1   2       bld Emb4 5x                         IMAGE:4202947.5p TAAACAGGAAGAGTGAAGCAGACCCACAGTGAAGCGGGACATTAAATCCACAACCCGGGACAGCAGGACAGGCAGCTGCAAACGGGACAGTTGGGGGCCATCTCCTAATTTTTATCTCACCCATCCGGCTGCGGTCACGCCTCTTTCCTGGGTCCTCAGCCGACAGCTCGTGACGTCAGGCGCATAGTCTCTTCTCGCGAGACTTCGGAAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGCTTTGAATGGGGGTCACTGACCCTGTCTAAAAACAAATGCTCTATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGG
  5   1   2       bld Spl  5x                         IMAGE:8462832.5p                                     GGGAAATAAACAGGAAGAGTGAAGCAGACCCACAGTGAAGCGGGACATTAAATCCACAACCCGGGACAGCAGGACAGGCAGCTGCAAACAGGACAGTTGGGGGCCATCTCCTAATTTTTATCTCACCCATCCGGCTGCGGTCACGCCTCTTTCCTGGGTCCTCAGCCGACAGCTCGTGACGTCAGGCGCATAGTCTCTTCTCGCGAGACTTCGGGAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGGGGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAGACTATCGACAAAAAGACTTCTACAGACTGCTGACTCTGTCGATGTGGGATGACTCTGATGAGACTCTATCACTCTGAGGAGCACTGGACTCTGACCAAAGCAGCAGAGAAGACAGACGAGAAAAATTATTTGACATGATCCGCACTCTAGATGTCAAAACCTCAGAACG
  5   1   2       bld Kid  5g                         IMAGE:7011006.5p                                            TAAACAGGAAGAGTGAAGCAGACCCACAGTGAAGCGGGACATTAAATCCACAACCCGGGACAGCAGGACAGGCAGCTGCAAACAGGACAGTTGGGGGCCATCTCCTAATTTTTATCTCACCCATCCGGCTGCGGTCACGCCTCTTTCCTGGGTCCTCAGCCGACAGCTCGTGACGTCAGGCGCATAGTCTCTTCTCGCGAGACTTCGGAAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACTCTATCCACTCTTGGAGAGCAACTGGT
  5   1   2       bld Em10 5g                         IMAGE:7982527.5p                                               ACAGGAAGAGTGAAGCAGACCCACAGTGAAGCGGGACATTAAATCCACAACCCGGGACAGCAGGACAGGCAGCTGCAAACAGGACAGTTGGGGGCCATCTCCTAATTTTTATCTCACCCATCCGGCTGCGGTCACGCCTCTTTCCTGGGTCCTCAGCCGACAGCTCGTGACGTCAGGCGCATAGTCTCTTCTCGCGAGACTTCGGAAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAAACTATCGACNAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCCCCTCTTGAGGAGCC
  5   1   2       bld Te2  5g3  in                    IMAGE:7208526.5p                                                 AGGAAGAGTGAAGCAGACCCACAGTGTAGCGGGACATTAAATCCACAACCCGGGACAGCAGGACAGGCAGCTGCAAACGGGACAGTTGGGGGCCATCTCCTAATTTTTATCTCACCCATCCGGCTGCGGTCACGCCTCTTTCCTGGGTCCTCAGCCGACAGCTCGTGACGTCAGGCGCATAGTCTCTTCTCGCGAGACTTCGGAAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCGACTGGGACTACTGACTCAAAGCTAGCAG
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073425.5p                                                                             CCACGCGTCCGAATCCACAACCCGGGACAGCAGGACAGGCAGCTGCAAACAGGACAGTTGGGGGCCATCTCCTAATTTTTATCTCACCCATCCGGCTGCGGTCACGCCTCTTTCCTGGGTCCTCAGCCGACAGCTCGTGACGTCAGGCGCATAGTCTCTTCTCGCGAGACTTCGGAAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACA
  5   1   2       bld Egg3 5g                         IMAGE:3379125.5p                                                                                                                                                                                            CCGGGGGGTCCTCAGCCGACAGCTCGTGATGTTTGGCGCATAGGCTCTTCTCGCGAGACTTCGGGAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGTCTCTTGGGGGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAGAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTGAAAGACTATCGACAAAAAGACTATCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAATCTGGACTACTGACCCCAAAGCCAGCTAGAAGAAAGACAGGGACAGA
  5   1   2       bld Egg3 5g                         IMAGE:3379149.5p                                                                                                                                                                                            CCGGGGGGTCCTCATCCGACAGCTCGTGACGTTAGGCGCATAGTGTCTTCTCGCGAGACTTCGGGAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGTCTCTTGGGGGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTGGACCGTGTCCCACTAGCTGCAGAACTAGTTGATGTTCCCTGCACAGTGGAGTGTGTAGAGACTATCGACAAAAAGACTGTCTACAAGACTGCTGACATCTGTCAGATGTAGGTATGTACTCTTGATGGAGACCTCTATCCACCTGTAGAGGAGCCAACTGGGACTACTGACCCAGAAGCCAGCGAGACGAATGACATGGACGAGAGAGAAAAAATATATATGGAACCATGCAATCACGCCATCTCT
  5   1   2       bld Egg3 5g                         IMAGE:3377432.5p                                                                                                                                                                                                                       CCGGGCAGGCGCATAGTCTCTTCTCGCGAGACTTCGGAAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCANAAGCCAGCAAGAAGAAAGACAGGGACAGAGAGAAAAATNTATNTGGACCATGGATCACGCCACCTCTGAGATGTGCGANAAGACGCTTCAGAAAC
  5   1   2       bld Bla1 5g3  in                    IMAGE:3380097.5p                                                                                                                                                                                                                                                     CCGGGGGGAAACACAGTGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGANGAGCCAACTGGGACTACTGACCCANAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGGCAAGAAGAAA
  5   1   2       bld Egg1 5g                         IMAGE:4678781.5p                                                                                                                                                                                                                                                                AGTGAGGCAAAAACCAGGAAGAGTGAATCTGACCCACAGAGAAGCGGGACATTAAGTCCACAACCCTGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGGGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGTTCTTTCTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCCCCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTTGGAACCATGGAATCACGCCACCTCT
  5   1   2       bld Emb4 5g                         IMAGE:5515404.5p                                                                                                                                                                                                                                                                     TGAGGCAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATNCCCCAGGATGTCTGGGAATCAACAGGGCG
  5   1   2       chi Thy       in                    IMAGE:8550376.5p                                                                                                                                                                                                                                                                          CAAAAACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCANGAAAAACTGCAAGAAGAAGTATATTGATCCCCAGACGTGGAGAANGAGTGAACGGCTTTGAGCACAAGCTAAGCAGTAGTGTCGATGAAGTGATGCTGAGAGATCAAAGAGTCAGATCTGCTGGTTGATGACCNAGGATGCTGATCACAGGCGTGTCTCACATGAAGGAGATGCTCGATTATGATATATACTGTGAAAAGAACCCGAAAAATT
  5   1   2       bld Oo1  5g                         IMAGE:6640939.5p                                                                                                                                                                                                                                                                              AACCAGGAAGAGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCANAAGAAGTCGAGAATCTGTCTGGGGTGGATGGATCCCCAGGGATGTCTGGGATCAAACAGGGCCGTGGNTCTTCAGTGGAGAGGGGAGAATTGCGTCAGATATTTTATGATAATAGNAGTAGCAGTGATGAAAAAAAGGGAGACGCCAGGAAGAAAGAGATCTTAATATCATGGAGACTGGAGGAGGAACCAAGGCCT
  5   1   2       bld DMZ  5g3  in                         xl323c01.5p                                                                                                                                                                                                                                                                                 CCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGCTTTGAATGGGGGTCACTGACCCTGTCTAAAAACAAATGCTCTATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGA
  5   1   2       bld Egg1 5g                            PBX0068D06.5p                                                                                                                                                                                                                                                                                   CACGAGGTGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCTGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGGGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGACGGTGGTCCAGTCTGGGAGTATAAATACACAAGACAGACTTTCTATTGAGGTACA
  5   1   2       bld Oo1  5g                         IMAGE:6643795.5p                                                                                                                                                                                                                                                                                     GAAGAGGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGGAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGGTGGATGGATCCCCAGGGATGTCTGGAATCAAACCAGGGCCGTGGTTCTTCAGCAGTGGAAAAGGAAAGATTGCGGCAGATATTTAATAATATTAGTAGTACCAGTGGTTGAAAAAGAGGGAGAACGCCAGGAAT
  5   1   2       chi Egg3                            IMAGE:6868380.5p                                                                                                                                                                                                                                                                                        GATTCCCGGGCGGGAACCAGTGTCGAAAAACCAGGAAGAGGAAACTGAGCCCAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGTCTCTTGGGGGATTTCATTGCTACTTCTGCCAGCTTCACCTGACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGANGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCCAGGGATGTCTGGGATCAAACAGGGCCGGGGTTCCTCANCAATGGAGAGGGAAAAAATTGCGTCCGATATTTAATGATATTAGTAGTACCAGGGAAGGGAGAAAAAGGAGAAACGCCAGGAAAAAAGAAGAATCTTAATATCATTGGAGACTGAGGGAGGACCCAAGGGCAGGACAGGAAGGGTCAAA
  5   1   2       bld Ooc1 5g3  in                      xlnoc002f03.5p                                                                                                                                                                                                                                                                                          TGAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGGGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCANAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGANAAAATTATTTGGACCATGG
  5   1   2       bld Emb1 5g                         IMAGE:6863653.5p                                                                                                                                                                                                                                                                                           GAAACTGAGCCACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGAATGGGAAGTGATTGCTGAAGATGAATCCAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCCCAGGATGTCTGGGAATCCAACAGGGCCGTGGGTTCTTCAGTGGGAAAGGGGAAAAATTGCGGTCAGATATTTTAATGATATTAGTAATAACCATTGATGGGAGAAGAA
  5   1   2       bld Spl  5g                         IMAGE:8462493.5p                                                                                                                                                                                                                                                                                                     CACAGTGAAGCGGGACATTAAGTCCACAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGGGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGAAGTGATGCTGAGATGATCANNAGAGTCGAGATCTGTCTGGGTGGATGGATCCANGATGTCTGGATCACAGGNCGTGGTCTCAGTGAAGGGAGATGCTCGAATTATGATTATATACATGATGAAGAGGAACCNGAA
  5   1   2       bld Egg3 5g                         IMAGE:6323809.5p                                                                                                                                                                                                                                                                                                      TTCCCGAGGCCCGGGGCATTTTCTCAAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGGCGATGGGAAGTGATTGCGTGAAGATGAATCCAAAAGAAAGTCGAAGAAATCTGGCCTGGGGGTTGGAATGGGATCCCCCCCAGGGGAAGGTCCTGGGGAAATTCCAAAAAGAgggggcccggggggggttccttttccaccccaaatttggggaaaaaaggggggaaaaaaaaaTTTTGT
  5   1   2       bld Ga12 5g3  in                         XL146h03.5p                                                                                                                                                                                                                                                                                                       ACAGTGAAGCGGGACATTAAGTCCCAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAA
  5   1   2       bld Oo1  5g                         IMAGE:6861227.5p                                                                                                                                                                                                                                                                                                        TGAAGCGGGACATTAAGTCCTTACCCGGGACAGCAAGACAAGCAGCTGAAACGGGTCTCTTggggggggATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCCAGGGATGTCTGGGATCAAACAGGCCCGTGGTTCTTCACCAGTGGAGAGGGAAGAATTGCGTCAGATATTTAATGATATTAGTAGTAGCAGTGATGGGAGAAGAGGGGAGAAACGCCCGGAAGAAGAAGATCCTA
  5   1   2       bld Tbd7 5g3  in                         XL106h05.5p                                                                                                                                                                                                                                                                                                              GGGGACATTAAGTCCACAACCCGGGACAGCAAGNACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCACACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGA
  5   1   2       bld Egg1 5g                            PBX0156C04.5p                                                                                                                                                                                                                                                                                                                    ggggctgttgggggctttgaatgggggTCACTGACCCTGTCTAAAAACAAATGCTCTATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGA
  5   1   2       bld Spl  5g                         IMAGE:8462193.5p                                                                                                                                                                                                                                                                                                                      ATTAAGTCCCAACCCGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGGGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTGGNATGGGATCCANNGATGTCTGGAATCAACAGGNNCGTGGGTTCTCACAGTGGAGAGGGAGAA
  5   1   2       bld Neu7 5g3  in                         XL040i17.5p                                                                                                                                                                                                                                                                                                                               ACGAGGGGACAGCAAGNACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCC
  5   1   2      seed Ga12 5g3  in                         XL217b12.5p                                                                                                                                                                                                                                                                                                                               CACGAGGGGACAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAA
  3   1   2       bld Ga15                               XL508i14ex.3p                                                                                                                                                                                                                                                                                                                                         CAGCAAGACAAGCAGCTGAAACGGGGCTGTTGGGTGATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGATTTACATCCTGCCGGANGTCATG
  5   1   2       bld Ooc1 5g3  in                      xlnoc002f23.5p                                                                                                                                                                                                                                                                                                                                                                          TCTATTTCATTGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTTTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGANAAAGACGCTTCANGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGANACGGCTNTTGAGCACAGNATGCTGAGCAGNNTAGTGTGCGATGGAAGTGATTGCTGAAGATGAATCANAAGAAGTCGAGAATCTGTCTGGGTTGGATGATCCNCCAGGA
  5   1   2       bld Ga12 5x3  out                        XL206g10.5p                                                                                                                                                                                                                                                                                                                                                                            GGCACGAGGGCCACTTCTGCCAGCTTCACCTGACAGATTGTCTGAGAATCCATCATGACTTCCACAAAACAGAAGACATCAAGAAGCAAAGATGATGCCCCACATGAACTAGAGAGCCAGTTCATCTTGCGACTCCCACAGGAATATGCCTCAACAGTTAGGAGGGTGGTCCAGTCTGGGAGTATAAATACAAAAGACAGACTTTCTATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCC
  5   1   2       bld Ga15                               XL417c14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATTGAGTTACATCCTGACGGACGTCATGGAATTGTACGTGTTGACCGTGTCCCACTAGCTGCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCCAGGGATGTCTGGAATCAAACAGGGCCGTGGTTCTTCAGCAGTGGAGAGGGAAGAATTGCGTCAGATATTTAATGATATTAGTAGTAGCAGTGATGGAGAAGAGGGAGAACGCCAGGAAGAANAAGATCTTAATATCATGGAGACTGAGGAGGAGCAGAGGGCAGGACAGGATGGTCAAAAAGGAGGCACTAACCAGATTGTTCTGGAGATGCA
  5   1   2       bld Lmb1      in                    IMAGE:8532251.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAAAACTAGTTGATGTTCCCTGCACAGTGGAGTGTTTAAAGACTATCGACAAAAAGACTTTCTACAAGACTGCTGACATCTGTCAGATGTTGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCCAGGGATGTCTGGAATCAAACAGGGCCGTGGTTCTTCAGCAGTGGAGAGGGAAGAATTGCGTCAGATATTTAATGATATTAGTAGTAGCAGTGATGGAGAAGAGGGAGAACGCCAGGAAGAAGAAGATCTTAATATCATGGAGACTGAGGAGGAGCAGAGGGCAGGACAGGATGGTCAAAAAGGAGGCACTAACCAGATTGTTCTGGAGATGCAGAAACAGTTGGAAAATTTACAGAAGAACTGAGGGAGACACAGAACGAAGAAGCGACAGAAGAGCTTATATGAAGGTGAAATCTAGCATGAAACTCGCTGCAGCTGTACTGATGATTAGCAGCAGAGAGAAGAAGCACACTACTCCTCAGACACTCAGCTCTAGAGATGAAGTTCTGTGTCATGATGTATGCACGCCAAGACGCAAGATCGCTAATGTAATCATTGCGATATACGATTAG
  5  -1   2       bld Bla2                            IMAGE:7299834.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGACATCTGTCAGATGTTGGTATGTACTCTGATGGGAGACCTCTATCCACCTCTGNAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCCAGGGATGTCTGGAATCAAACAGGGCCGTGGTTCTTCAGTGGAGAGGGAAGAATTGCGTCAGATATTTAATGATATTAGTAGTAGCAGTGATGGAGAAGAGGGAGAACGCCAGGAAGAAGAAGATCTTAATATCATGGAGACTGAGGAGGAGCAGAGGGCAGGACAGGATGGTCAAAAAGGAGGCACTAACCAGATTGTTCTGGAGATGCAGAAACAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGGGGGCCCGTACCCAATCGCCTAAGACGCN
  5   1   2       bld Bla1      in                    IMAGE:3381401.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGGGGTATGTACTCTTGATGGAGACCTCTATCCACCTCTTGAGGAGCCAACTGGGACTACTGACCCAAAAGCCAGCAAGAAGAAGGACAGGGACAGAGAGAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCCAGGGATGTCTGGAATCAAACAGGGCCGTGGTTCTTCAGCAGTGGAGAGGGAAGAATTGCGTCAGATATTTAATGATATTAGTAGTAGCAGTGATGGAGAAGAGGGAGAACGCCAGGAAGAAGAAGATCTTAATATCATGGAGACTGAGGAGGAGCAGAAGGCAGGACAGGATGGTCAAAAAGGAGGCACTAACCAGATTGTTCTGGAGATGCAGAAACAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAANGCGACAGAAGAGCTTATNATGAAAGGTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAAGAGCAGGAAGAGAGAGAAA
  5   1   2       bld Te2N      in                    IMAGE:7202983.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAAAAAATTTATTTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCAGGAAAACTGCAAAGAAGAAGTATATTGAATCCCCAGACGTGGAGAAGGAGGTGAAACGGCTTTTGAGCACAGATGCTGAGGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCAAAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCCAGGGATGTCTGGAATCAAACAGGGCCGTGGTTCTTCAGTGGAGAGGGAAGAATTGCGTCAGATATTTAATGATATTAGTAGTAGCAGTGATGGAGAAGAGGGAGAACGCCAGGAAGAAGAAGATCTTAATATCATGGAGACTGAGGAGGAGCAGAGGGCAGGACAGGATGGTCAAAAAGGAGGCACTAACCAGATTGTTCTGGAGATGCAGAAACAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTNGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAAGGACGATTGTTTGACTTCGGGGCCATTCGAAAGGTAACTGCATGAAGGATGTTACCCCTGCCATTTGTGTGGTGGCGGTGACTAAATGGG
  5   1   2       bld Egg1                               PBX0052G09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACGAGGTGGAACCATGGAATCACGCCACCTCTGAAGAATGTGCGAAAAAGACGCTTCACGAAAACTGCAGAGAAGAAGTATATTGAATCCCCATACGTGGAGAATGAGGTGAAACGGCTTTTGAGCACAGATGCTGATGCAGTTAGTGTGCGATGGGAAGTGATTGCTGAAGATGAATCATAAGAAGTCGAGAATCTGTCTGGGTTGGATGGATCCCCAGGGAT
  5   1   2       e50                            Xl3.1-IMAGE:7208526.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAAAAAGGAGGCACTAACCAGATTGTTCTGGAGATGCAGAAACAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCAAATAAAATCTTTTGATTGTTACC
                                                  Xl3.1-CHK-1012688584                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGAGGCACTAACCAGATTGTTCTGGAGATGCAGAAACAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCAAATAAAATCTTTTGATTGTTACCCTTCAA
  3   1   2       bld Lmb1      in                    IMAGE:8532251.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAACGGAAGTGTCCGGAATTCAATCAGCTGGATCTCCAGCATGGAGAGGGAAGATTGCGTTCAGATATTAATGATATAGTAGTAGCAGTGATGAGAAGAGGAGACGCAGAGAGAGATCTATATCATGAGACTGAGAGAGCAGAGGCAGACAGATGGTCAAAAGGAGGCACTAACCCAGATTGTCTGGAGATGCAGAAACAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCCAAATAT
  3   1   2       bld Te2  5g3  in                    IMAGE:7208526.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTATTGATTTTGGTAGCAGCAGGGATGGAGAAGAGGGAGAACGTCCAGGAGGAAGAAGATCTTATATTCATGGAGACGAGGAGGAGCAGAGGTCAGGACACGATGGTCAAAAAGGAGGCACTAACCAGATTGTTCTGGAGATGCAGAAACAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAAAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCTAAATAAAATCATTAGCAGTT
  3   1   2       bld Thy       in                    IMAGE:8550376.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGTCCGATCGTACAGCGGTTCGCGGAAGAGATGTCGTTTAGATTGTGTGCTGTGGAGGGGACGCAGAGAGAGTCTATTCTGGATGAGAGACAGAGCAGACAGAGTCAAAAGAGCACACCAGATGTCTGAGAGCAGAACAGTGGAAAATTACAGAAGAACTGAGGAGACACAGAACGAAGAAGCGACAGAAGAGCTTATATGAAGGTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATCCATCCAAAAAATCTTATATT
  3   1   2       bld Te2N      in                    IMAGE:7202983.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAGGCAGACAGATGTCAAAAAGGAGGCACTACCAGATTTGTCTGGAGATGCAGAACAGTTGGAAAATTTACAGAGAAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGGTCACCCCACCTACTATTCCATCCAAATAAATCTTGTTCTGTT
  5   1   2       bld Egg1                               PBX0107E08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGAGGGGATGGTCAAAAAGGAGGCACTAACCAGATTGTTCTGGAGATGCAGAAACAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACA
  3   1   2       chi Ga12                                 XL205o03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTATGGTTTTGCAGTATGGCTCTGTGCAGTAATAAAGCACATGCAAAATCACACCACCGATAAAAGATTATGAATTTTGGGACTACTGCAAAGGGATTTGAGGCTGTTTTTATTTCTGTCACTTTTCTGTACACCCAGGATAATCTATTTCTTTCCTTACCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCAAATAAA
  3   1   2       bld Ga12      in                         XL219c10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAACCAGTTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAAAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCAAATAAA
  3   1   2       bld DMZ  5g3  in                         xl323c01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GNTGGAAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCAC
  5   1   2       bld Ga12      in                         XL219c10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAATTTACAGAAGAAACTGAGGGAGACACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAAAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTT
  5   1   2       bld Ga12      in                         XL155o08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGTACACAAGNAACGAAGNAAAGCGACAAGNAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAAAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCANATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCT
  3   1   2       bld Tbd7 5g3  in                         XL106h05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACAAGAACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATNATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCAAATAAAA
  3   1   2       bld Ga12 5g3  in                         XL217b12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTNGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAAAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCAAATAAA
  3   1   2       bld Ga18      in                      xlk102p09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACNCTTTTAAAT
  5   1   2      seed Ga18      in                      xlk102p09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACGAAGAAAGCGACAAGAAGAGCTTATAATGAAGGTTGAAAATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCAAATAAAATCTTTTGATTGTTACCCTTCaaaaaaaaaa
  3   1   2       bld Neu7 5g3  in                         XL040i17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGNAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAAAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATNATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCA
  3   1   2       bld Ga12      in                         XL155o08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAAAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATNACAGCTACAGATAACTCTAAATATTTTTNACACTTTTAAGNNGCACCCCACCACNATTCCATCCAAANAAATCTTTNA
  3   1   2       bld Ga12 5g3  in                         XL146h03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTAGCATTGAAGACTCGCTTGCAAGCTGTACTGGATGAGTTTAGGCAGCAGGAGGAGAGAGAAAAGCAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAGAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTCANCAGCATTAGTGTTAAGAAGAATATTGNCAGCTACAGA
  5   1   2       bld Ga12      in                         XL174o12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGCAGCTGACATCACTACAGGNAGCAGCTCGAGGCTCTGATAGAGAAGTGAAAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTC
  3   1   2       bld Ga12      in                         XL174o12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCAGCTGACATCACTACAGGAGCAGCTCGAGGCTCTGATAGAGAAGTGAAAAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTNNACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATAACTCTAAATATTTTTAACACTTTAAAGGTGCACCCCACCGACATTCCATCCAA
  3   1   2       bld Egg2                            IMAGE:5162750.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCACGAGGAGTTTTCATGTGGTTTCCATGGAATTTGTAACTTGCCCACCATGCTCTAGATGTACAGCATAGAGGGGGATTCTGCCTTTTAATAAGTCTGTCTAAAATATCAGTTTTTGTGCTGAAAAGTATATATACACAGGACGATTGTTGACTTCGGGCCATTCGAAGGTAACTGCATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCCCC
  3   1   2       bld Ooc1 5g3  in                      xlnoc002f03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCAAATAAAATCTTTTGATTGTTAAAAA
  3   1   2       bld Ooc1 5g3  in                      xlnoc002f23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCAAATAAAATCTTTTGATTGTTACCCTTCAAA
  3   1   2       bld Bla1 5g3  in                    IMAGE:3380097.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCAT
  3   1   2       bld Emb1                            IMAGE:3401691.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCATCCAAATAAAATCTTTTGATTGTT
  3   1   2       bld Bla1      in                    IMAGE:3381401.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATGAGGATGTTACGCTGCAATTGTGTGTGCTGTGACTAAATGGTTGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATCTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTCTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACACTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTCTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCACCTACTATTCCAT
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073425.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCTGTACATTACAGAAATAGGCCAGATAAGCATAAAAATGTTACATGTATGATTTCTTACTGTAATGTTCATGGGGCAAGCATTATGACCCCAGCATTTACAGTTTAACTTATTTAGAATTTTGCCTGCTGTTCATTTCCAGTACAATATTTCAGATTTTGAACTCAGATGCTCAAATTAAGAGAACAGAGTGAGCCCAAAACCCTGATGAATGGCTTGTTAACAGCATTAGTGTTAAGAAGAATATTGACAGCTACAGATGAACTTTAAATGATTTTTTAACACTTTTAAATGTGTCACCCCCCCTACTATTCCATCCAAATAAAATTTTTTGATTGTTCCCCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)