Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

 This cluster: approximate FL confidence score = 93%

 1012837456 Xl3.1-IMAGE:6317239.5.5 - 48 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                       6     9    12    15    22    23    23    24    23    24    23    24    24    25    24    25    24    26    26    26    26    26    26    26    26    26    26    26    25    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    25    26    25    26    25    26    25    25    25    25    25    25    25    25    24    25    23    24    23    24    23    24    23    24    23    25    23    26    23    26    24    27    24    27    24    27    25    28    28    30    27    30    25    30    26    30    28    32    27    33    30    35    30    35    27    35    25    34    26    32    24    31    21    30    22    29    21    29    20    29    20    29    19    27    18    28    17    26    17    25    16    23    17    19    17    19    17    18    18    18    18    19    19    19    19    19    19    19    19    20    19    20    19    20    18    20    18    20    19    20    19    20    19    20    19    20    19    20    18    20    20    21    17    21    18    21    18    21    18    21    17    21    17    21    17    21    17    21    17    21    16    21    17    22    17    22    16    22    16    22    16    22    16    22    16    22    16    22    14    20    14    20    14    20    10    19     6    19     5    16     4     8     4     6     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     3
  5   1   2       e50                            Xl3.1-IMAGE:4970064.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTCTCGCTATCCCTACTAGCACCCTTTGTGACTGTTGTGCACTATGCTTTGTGTCCCTTGTGGGGTCTTTCTCTGGCACAGTCCCTGTCTCATGTTCCATCTGACAGTTGCTTAGCAATATCTGCCAGACATTATAAGGGTTAGTGGTTACTGGCCGTCCTTGTGCCACTCCTGCTCTCAGTCTGTGTCCAGTGTAACCCATAAACTGTGTATGTGCCAGGGCTTGAGTGAGTTCTACTCTCTTATACACAAATGGGGGAGAGAGAGTCCAACTCTGTTTAGTAGCCGCCATTATTCCCTGCCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCTGAAGCCCAATGTTAGAGCACTCACACATACTCACACTGCCCAACTCAGTGTCACACAAATAAAGACTTATTTTTTTTCAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTATGACACTGCTGCATGCAGTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCATGTTCCATCTGACAGTTGCTTAGCAATATCTGCCAGACATTATAAGGGTTAGTGGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGTCCAGTGTAACCCATAAACTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCTACTCTCTT
                                                                   SNP                                                                                                                  T-----------
                                                                   SNP                                                                                                                                                                                                      ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------C-
                                               BLH ATG       7     650                                                                  
                                               BLH OVR       7      53                                                                  
                                               EST CLI       0      26                                                                  
                                               ORF LNG       7       4                                                                  
  5   1   2       bld Tbd7      in                         XL109f02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCCTATATCATGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGgtgtgccagtgtgtgccgtgtgttctcctgtgtgtCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCA
  3   1   2       bld Skin      in                    IMAGE:8641212.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGAAGTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAAGAGGTGTCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGTTGCGACATCTCAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCGGAATCTACAGGAGCCGTCTCCCCCTCTAGCACTTCCCACTCCCTTNGCCCAAAATGGGNNNNNNNTTAAA
  5   1   2       bld Skin      in                    IMAGE:8641212.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGTCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGTTGCGACATCTCAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGgtgtgccagtgtgtgccgtgtgttctcctgtgtgtCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCGGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTTCCACCTCCCTCTGCATGCAATAAACTTGTATGTNGaaaaaaaaaaanannaanaaaaaaaaaaaaaaGGCGGCG
  5   1   2       bld Tbd7      in                         XL108f02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGCTGGGAGACGGGCTGTTCCTGCAGTGCTGTAAGGAGGTGGCAGAGTTGTACCCCAAGATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGtgtgccagtgtgtgccgtgtgttctcctgtgtgtCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCC
  3   1   2       bld Tbd7      in                         XL108f02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATCCAGTTTGATACAATGATTATTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTCCCACCTCCCCTCTGCATGCAATAAACTTGTATG
  3   1   2       bld Tbd7      in                         XL109f02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGACAACTGCTGCATGCAGTTGGTGCAGAATCCGTACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATTGATAACCTGGCAGCTGGGCTGGTGGGGGGCGCAGGAGTGGTGCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTCCCACCTCCCCTCTGCATGCAATAAACTTGTATG
  3   1   2       bld Ov1                             IMAGE:4054992.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTTCAGAATACGCCGTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCCGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCAGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTCCCACCTCCCCTCTGCATGCAATAAACTTGTATGTGAAGCC
  3   1   2       bld He1  5g3  in                    IMAGE:4408522.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGTTTGAGACGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTTCTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACAACTGACATGGGAGGTTATGCTACTTCTCTGGATTACACACAGGCTGTCATATCCAACCTCAACTGATGGCATCTGTGCCCACAACGGCTTCCTGAGGGTGTGCCAGTGTGTGCCGTGTGTTCTCCTGTGTGTCCCAGCACAATCCCTGCTCTGCCCGTAGCCCGTGCGTCTGCTTGCACTTCTTATTTATTATCTGAAGAATAATGACTGGATCCCAGCGTGTGATTGGCCAACGAGCTCCATCGGAATCTACAGGAGCCGTCTCCCCCTTCTAGCACTTTCCCACCTCCCCTCTGCATGCAATAAACTTGTATGTGAAGCCA
  5   1   2       e50                            Xl3.1-IMAGE:4970064.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTCTCGCTATCCCTACTAGCACCCTTTGTGACTGTTGTGCACTATGCTTTGTGTCCCTTGTGGGGTCTTTCTCTGGCACAGTCCCTGTCTCATGTTCCATCTGACAGTTGCTTAGCAATATCTGCCAGACATTATAAGGGTTAGTGGTTACTGGCCGTCCTTGTGCCACTCCTGCTCTCAGTCTGTGTCCAGTGTAACCCATAAACTGTGTATGTGCCAGGGCTTGAGTGAGTTCTACTCTCTTATACACAAATGGGGGAGAGAGAGTCCAACTCTGTTTAGTAGCCGCCATTATTCCCTGCCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCTGAAGCCCAATGTTAGAGCACTCACACATACTCACACTGCCCAACTCAGTGTCACACAAATAAAGACTTATTTTTTTTCAAAAAAA
                                                  Xl3.1-CHK-1012707623                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTCTCGCTATCCCTACTAGCACCCTTTGTGACTGTTGTGCACTATGCTTTGTGTCCCTTGTGGGGTCTTTCTCTGGCACAGTCCCTGTCTCATGTTCCATCTGACAGTTGCTTAGCAATATCTGCCAGACATTATAAGGGTTAGTGGTTACTGGCCGTCCTTGTGCCACTCCTGCTCTCAGTCTGTGTCCAGTGTAACCCATAAACTGTGTATGTGCCAGGGCTTGAGTGAGTTCTACTCTCTTATACACAAATGGGGGAGAGAGAGTCCAACTCTGTTTAGTAGCCGCCATTATTCCCTGCCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCTGAAGCCCAATGTTAGAGCACTCACACATACTCACACTGCCCAACTCAGTGTCACACAAATAAAGACTTATTTTTTTTCAAAAAAAAAAAAA
  3   1   2       chi Emb4      in                    IMAGE:4970064.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGATTGCTGGCATGCCCACCGTATGGCAAATCATTGATACCTGGCAGTGGGCTGGTGGGGGCGCAGGAGTGGTCCCAGGAGAGAGTTACAGTTCAGAATACGCCGTGTTGAGACGGGGCGCGCGCCACCCATTCGCACAAGCCGTGGGCAGGAATATTGCGAACCCAACTGCAATGTTACTTACTGCCACCAACATGCTGCGACATCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTCTCGCTATCCCTACTAGCACCCTTTGTGACTGTTGTGCACTATGCTTTGTGTCCCTTGTGGGGTCTTTCTCTGGCACAGTCCCTGTCTCATGTTCCATCTGACAGTTGCTTAGCAATATCTGCCAGACATTATAAGGGTTAGTGGTTACTGGCAGTCCTTGTGCCACTCATGCTATCAGTATGTGTCCAGTGTAACCCATAAACTGTGATGTGCCAGGGCTTGAGTGAGTTATACATATATTATACACAAATGGGGGAGAGAGAGTCCAACTATGTTTAGTAGCCGCCATTATTCCCTGCCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCAGAAGCCCAATGTTAGAGCACTCACACATACTCACACTGCCCAATTCTAGGTCTCTCTAAA
  3   1   2       add Ov1       in                    IMAGE:8328487.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGGGCCCCCCTCACCCGGGGGGGGAGTATCCCCCCCCAATTTTTTTTCCCCCACCAGGGGGGTTTTTACCCTGGGTTCAAAATTTTTTTTGGGGGGGGAAAAAAATCTTTAAAGGGAAAGGGGGCCCCCCAATTTGTGGGTTTTTTCCAAAAAGGGGTTTTTCAGGGGGGGGGAGGGGGGGTAACATCTGGTTCCCCCAAAAGACCCCTTTGGAAATTTTTGGCCCAAAAGTTTTGGGTCCCCTGGGGGGTTTTTTTGGGGACAAATCCCTTTTAAAGTTTCCTTTGAACGGTGGTTTACAAATTTTGGCCAACCTTTTAAGGGTTTGGGGGTTACGGCCCGTCCTTGTGCCATTCCTGGTTTCAGTTTGGGTCCAGGGTAACCCATTAAACTGTGTTTGGGCCAGGGGCTTGAGTGAGTTCTACTCTCTTATACACAAATGGGGGAGAGAGAGTCCAACTCTGTTTAGTAGCCGCCATTATTCCCTGCCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCTGAAGCCCAATGTTAGAGCACTCACACATACTCACACTGCCCAACTCAGTGTCACACAAATAAAGACTTATTTTTTTTCAAAAAAAAAAAAAAAG
  3   1   2      seed Tbd7      in                         XL062g03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ANATATGGGAGGTTATTCCACGACAAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTCTCGCTATCCCTACTAGCACCCTTTGTGACTGTTGTGCACTATGCTTTGTGTCCCTTGTGGGGTCTTTCCTGGCACAGTCCCTGTCTCATGTTCCATCTGACAGTTGCTTAGCAATATCTGCCAGACATTATAAGGGTTAGTGGTTACTGGCCGTCCTTGTGCCACTCCTGCTCTCAGTCTGTGTCCAGTGTAACCCATAAACTGTGTATGTGCCAGGGCTTGAGTGAGTTCTACTCTCTTATACACAAATGGGGGAGAGAGAGTCCAACTCTGTTTAGTAGCCGCCATTATTCCCTGCCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCTGAAGCCCAATGTTAGAGCACTCACACATACTCACACTGCCCAACTCAGTGTCACACAAATAAAGACT
  3   1   2       bld Tbd3                            IMAGE:3549745.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCAGTCCCTGTCTCATGTTCCATCTGACAGTTGCTTAGCAATATCTGCCAGACATTATAAGGGTTAGTGGTTACTGGCCGTCCTTGTGCCACTCCTGCTCTCAGTCTGTGTCCAGTGTAACCCATAAACTGTGTATGTGCCAGGGCTTGAGTGAGTTCTACTCTCTTATACACAAATGGGGGAGAGAGAGTCCAACTCTGTTTAGTAGCCGCCATCATTCCCTGGCTGTTACTGAGCTCTTGGCACTAAAGTGGGCACATAGTTGGTCCATACTGGGTACAAGTGGTTTGAGCTCTAGTCTAGGCACAGTATTACAGCAGGCTGAAGCCCAATGTTAGAGCACTCACACATACTTACACTGCCCAACTCAGTGTC

In case of problems mail me! (