Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4684051.5                      60 PI      92          1     1803                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012837475 Xl3.1-IMAGE:8739497.5.5 - 70 ESTs
                                                                       .-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8739497.5.5                                                                        AGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGAATGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGACCCTTAAATGTATTTAGATTCAATAAAAGTCTTGGAAT
                                                  Xl3.1-CHK-1012722217                                                                              TCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGAATGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGACCCTTAAATGTATTTAGATTCAATAAAAGTCT
                                                      consensus depths                                                                            11    12    16    25    27    28    27    30    33    34    33    34    34    34    33    34    34    34    33    34    34    34    34    34    33    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    33    33    33    33    35    35    34    34    33    34    34    35    32    34    34    34    34    34    33    34    32    34    34    34    33    34    32    34    32    34    31    33    32    34    30    33    30    33    30    33    30    33    28    33    28    33    28    33    28    33    29    33    30    34    28    33    27    33    24    33    25    33    24    33    23    33    20    32    17    31    17    31    17    31    11    29    13    28     9    27     8    26     7    23     7    23     8    22     7    21     8    18     8    18     9    18     9    17    10    17    10    16    10    16    10    13    11    12    11    12    10    12    10    11    11    12    11    12    12    13    12    13    13    14    13    14    13    14    13    18    13    18    13    19    13    21    13    22    14    22    14    22    14    22    14    22    14    21    14    22    13    22    17    22    16    25    17    25    19    24    20    24    20    24    19    24    20    25    21    25    20    25    21    25    22    27    22    27    22    27    23    28    24    28    24    28    24    28    24    27    24    26    24    26    24    26    24    26    24    27    24    27    23    27    23    26    23    26    22    26    19    25    19    25    20    24    20    23    19    23    19    23    19    23    19    23    19    23    18    23    20    23    20    23    20    23    20    23    20    23    19    22    18    22    18    22    18    22    17    21    17    19    16    18    16    18    17    19    16    19    16    19    15    19    16    19    16    19    16    19    16    19    16    19    16    19    15    17     9    13     8    12     4     9     4     6
  5   1   2       e>1                            Xl3.1-IMAGE:8739497.5                                                            GGATCAGTCGTGAGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAG
  5   1   2       e>1                            Xl3.1-IMAGE:7207824.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGAATGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGACCCTTAAATGTATTTAGATTCAATAAAAGTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                        --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----A-C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------AT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        T-----------
                                               BLH ATG      33     953                                                                        
                                               BLH MIN      30     315                                                                        
                                               BLH OVR      33      74                                                                        
                                               EST CLI       8      35                                                                        
                                               ORF LNG      33       7                                                                        
  5   1   2       e>1                            Xl3.1-IMAGE:8739497.5                                                            GGATCAGTCGTGAGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAG
                                                  Xl3.1-CHK-1012687501                                                                  GTCGTGAGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAG
  5   1   0       chi Te1                             IMAGE:6929264.5p GGGGTAGGCAGGCAGGAGTGAGTGCATGTGGATATATTCCCCTGCATATAGCTTTCGTGGGATCAGTCGTGAGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTTGCATCCAAAAAATCTGATAAGGAATATCTGGCTATTGGAGGCTTGGCAAAATTTGCCCGGGCATCCGCAAAGGTTGCACCTTGGTGAAAATTGGGAAGCCGGTAAAAAATGGACCAGTTTTTTCCTGTACAAAAACATTTTTTGGGAAAAGGGGTCCCTTTCGAATTTGGAACCCAACTTTTTTGCCAAAATTTTCTCCCAAAACACCCCCCGGGGAATGTTTTACCCGGCCCAAAAAACCCCTCTCTGGGGGGGAATTccccccccccccATTTTTTTCGGGGGAAAACCTGGGGTTTTTGGA
  5   1   2       add Ov1  5g3  in                    IMAGE:5048189.5p                                                GACGCGTGGGCGGACGCGTGGGTGAGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCCGGCATCCGCACAGTTGGCACTTGGTGAAAATTGGGAAGCTGTTAAGAATGGACAGGTTATTACTGTACAGACCATTTCTGGAACAAGATCACTTCGGAATTGAGGCCACTTTTTGCAAGAATCTACCAGACAGCCGTGATGGTTAACTGCCAAAACATCCTGGGGGCATCCCACACCCATAATTCCGGAAGCTGGGTTTGAAGGGAAAGGTTACCGGGAATACGAACCCAAAACTGGGGGT
  5   1   2       bld Ov1  5g                         IMAGE:6316179.5p                                                ATAGCTTTCGTGGGATCAGTCGTGAGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAACAAAAGCAGTGGAATAGAGCTGGCAACCCTTATGCAAGAGTCCGACGCCTCCTTCCCATTTTTTTGACATGGGCTTACCAAGGATTTTGCCAGTTGGGAGACACTTGATAGAGAATGCCCTGGGGCTTGTCCCGCCCACTTCATTCCCAGGAAGGGGAAATCT
  5   1   2       bld Em10 5g                         IMAGE:7983432.5p                                                         GATTCCCGGGATGTGAGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTAGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCTAGAGTCGACGCCTCTTCCCATC
  5   1   2       bld Sp1  5g                         IMAGE:4174724.5p                                                          TTCCACCTGAAAGCAGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGGTTTGAACCCACTTTTTGCCAAGA
  5   1   2       bld Tad2 5g                         IMAGE:6935738.5p                                                           GGGGTCAGTCGTGAGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTAGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAAAAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATTCCTAGCAAGAGCAGTGGGAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCCTCT
  5   1   2       bld Tad2 5g                         IMAGE:6933899.5p                                                              GGGAGTCGTGAGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCGTGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGNGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTTGTTCCATGCCCGGTGCCTCATAAATCCTACAGGGTGTAGATCCCTAAAGCAAGAGCAGTGGGAAAAGAACTTGGCAACCCTTTATGCCAAGAAGTCGAACGCCTTCCTTCCCCCATTCA
  5   1   2       bld Tad1 5g                         IMAGE:6938398.5p                                                              GGGAGTCGTGAGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAAGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAAGTGAAAGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCCTAAATCCCAGAACAGAGCATCATCTTGGTCCATGACCTGTGCTCATAATCCCTACAAGGTGTAGAATCCCTAAGCCAAGAAGCAAGTGGAAAAGTAGCTGGGCAGCCCTTATTGCCAAGAGTTCGAACGCCCTTCTTTCCCATTTTCA
  5   1   2       bld Tail 5g3  in                    IMAGE:8542276.5p                                                                   GTCGTGAGCTTCTCTCTTCTTGCAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTNAAGCAGAGCAGTGGAAAGAGCTGGCAGCCTTTATGCAGAGTCGACGCCTCTTCCATTCTTNGACATNGGCTACNAGGATTNGCAGTGNAGAACTGATAAGATGCTGGGCTGTNCGCACTCATCCAGAG
  5   1   2       bld Panc 5g3  in                    IMAGE:8735404.5p                                                                   TCGTGAGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCCGGTATTACGATCCCAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAATCCCAGAAACAGAGCATCATCTTGTTCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAGCAGAGCAGTGAAAGAGCTGCAGCCTTTATGCAGAGTCGACGCCCTCCTCCATTCTTGACTGCTTACAGATGCAATGGGAAACCTGTATAGAGATGCTGGCCTTTCCGCACTCTCATCCGAGGAATCATTAGTCGTCAACTAAGCGAACTGGATGTAGTGGACCGTGTGCCACTAACTGGATTCGCCATGTATCTGA
  5   1   2       bld Tad2 5g                         IMAGE:6933338.5p                                                                     GGGAGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGAATGCTGGGTTGGGAGGTGAAGGGGTTACCGGGTATTACGATCCCAAGACTTGTGGGGTTTGGATTTTGCTGGTGCACTGGGATGACCCTCTCCTAAAATCCAAACAATCTCGCGCACAGGACAAGAGTACTCTTAAGN
  5   1   2       bld Te2  5g3  in                    IMAGE:7390412.5p                                                                       GAGCTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATATCCTACAGGTGTAGATCCCTAGCAGAGCAGTGGAAGACTGGCAGCCTATGCAGATCGACGCTCTTCCATTCTTGACATGCTACANGATTGCAGTGAACCTGATAAATGCTGGCTGCGCACTCTCAGAGGATCATTATGTGCCATCTTGCAA
  5   1   2       bld Bone 5g3  in                    IMAGE:8740138.5p                                                                          CTTCTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCAGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGTGAAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGTGTAGATCCTAAGCAGAGCAGTGAAAGAAGCTGCAGCCTTATGCAAGAGTCCGACCGCCCTTCTTCCCATTCTTGACTGCTTACCAGATTTGGCATGGAAACCTGATAGAAATGCTGGCTGTCCGCCACTCCATCAGAAGGAATCATAATGGCTGTTCCAATCCTATGCCAAGACCTGGAATTGTTTGTAACGGTTGGCATTCCTGTGAATTGCGCAATGTATGCTTAGGA
  5   1   2       bld Int2 5g                         IMAGE:8530475.5p                                                                           CTTCTCTCTTCTTGCAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAAGCAGAGCAGTGGAAAGAGCTGGCAGCCTTATGNCAGAGTCG
  5   1   2       bld Eye1 5g                         IMAGE:6945509.5p                                                                            TTCTCTCTTCTTGCAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCCGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACCATCCCCAGACTTGTGGGTTTGATTTTGCCTGGGTGCACTGGGATGACCTCTCTTAAATCCCCGGAACAGAGCATCATCTTGTTCCATGCCTGGGGCTCATAAACCCTACCGGTGTAGATTCCTCAACCAAAGCCAATGGAAAAGAACTGGGCAGCCTTTATGCCAAGAATTAGAAGCCCTCTTCCCAtttttttttACTGGGGCTTACCCAAGGAATTTCCCCCCGGGAAACACCCCAATAAAAATTCCCTGGGGTGGTTCTCCCACTTTCTTTCCTGGGAGGGGAACCACATTTTAGTGGTGGGCTCCATTCCCTTTTGGCCCAGAAAAATAGGGAAATTGTTTTG
  5   1   2      seed Sp1  5g                IMAGE:4963924-IMAGp.IMAGp                                                                             CTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAAGAGCTGGCAGCCTTATGCAAGAGT
  5   1   2       bld Bone 5g3  in                    IMAGE:8739497.5p                                                                             CTCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCAGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAGAGTCGACGCCTCTTCCATTCTTTGACATGCTTACCAAGGATTTGCCAGTGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTCATCAGAAGGGATCATTTAGTGCTGTCTCATCCTATGCCAGAACATGAATGCATGTCACGTGTGGTGCATCACTGGTACTTGGCAATGTGAATGCTCT
  5   1   2       bld Oo1  5g                         IMAGE:6859870.5p                                                                              TCTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGCACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTAGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGGAAATCCTAAGCAAGAGCAGTGGAAAAAAGCTGGGCAGCCCTTAATGCAAAAATCGAACGCCTCCTTCCCATTCTTTTGAAGATGGCTTTACCGAAGGGATTTGGCCCGGTGGCAGACACCTGAATAAAAAAATCCCCTGGGGCTGGCCCGCCACCTTCCATCCCAGNAAGGGGAAACCATTTTAGGCGCCTGTCCTCCAATCCTATTGCCCAAGAAACACTTGGGGAATCCTCATGGGTGCAAACCGTGGTTTGGGTGGCGCTTTTCCTGGTGCGAAC
  5   1   2       bld Int2 5g                         IMAGE:8529614.5p                                                                              CTCTCTTCTTGCAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACGGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCTGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGACCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCCTATGCAAGAGTCGACGCCTCTTCCATTCTTTGACATGGCTTACCAGGATTTNGCAGTGAGATCTGATAAGATGCCTGGCTGTCGCCC
  5   1   2       bld Sp1       in                    IMAGE:4963924.5p                                                                               CTCTTCTTGCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTG
  5   1   2       bld Te2  5g                         IMAGE:7393199.5p                                                                               TCTCTTCTTGCAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCAGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAAGTGTAGATCCTAAAGCAGAGCAGTGGAAGAGCTGGCAGCCTTATGCAAGATCCACGCTCTTCCATTTCTTGACATGCTACCANNGATTGCAGTGAGAACTGATGAGATCCTGGCTGTCGCACT
  5   1   2       bld Int2 5g                         IMAGE:8526521.5p                                                                               TCTCTTCTTGCAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCAGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAAGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTATATCCCAAACAGACATCATCTTGTTCCATGCCTGTGCCTTAATCTACAGGTGAGATCTAACAAGACCTTGAAAGACCGGCGTCTATTAAAGTCACGCTCTCCATTTTGGATTGCTCCAGGATTCATGGATACTGAAATATTTGGCTTCCCCTTACCTAAGATATTATTCTTATCTAGCAAAGGATGTTTAATTTATACCTAATCTTTTAAGATGAGATCTATTA
  5   1   2       bld Int2 5g                         IMAGE:8529387.5p                                                                               CTCTCTTCTTGCAACATGGCACTGCTGCCCCTAAGGGCCTTGTTGGAGTGGCTCGNTGCCAGCCCTGCTTCTTTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTCTCAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGttttttttATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGNCAGAGTCGACGCCTCTTTCCATTCTTTGACATGGCTTACAAGGATTT
  5   1   2       bld Gas9 5g                              BG409708.5p                                                                                CCCACGCGTCCGCATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCCGGTATTACGATCCCCAGACTTGTGGGGTTTGATTTTGCTGGGTGCACTGGATGACCTCTTTAAAATCCCAAACAGAAGCATCATCTTGGTCCATGCCTGNGCTCATAATCCTACAGGNGTAGA
  5   1   2       bld Emb4 5g3  in                    IMAGE:5536588.5p                                                                                  CTTCTTGCAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTTATGCAGAGTCGACGCCTCTTCCATTTCTTGACATGGCTTACCANNGGATTGCAGTGGAGAACTGATAGGATG
  5   1   2       bld FaBN 5g3  in                    IMAGE:8074599.5p                                                                                       TGCAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCAGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAATCCCAGAACAGAGCATCATCTTGTTCATGCCTGTGCTCTATCCTACAGTGAGATCTAAGCAGAGCATGGAAGACTGGCAGCTATGCAGATCGACCCTCTCCATCTTGACTGCTTACAGATTGCAGTGAACCTGATAAATCTGCTGCGCACTCTC
  5   1   2       bld FaBN 5g                         IMAGE:8078000.5p                                                                                       GCAAACATGGCACTGCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCAGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATTCTCAACAAGAGCAATGGAAAGAGCTGGCAGCCTTTGCTAGAATTGACCCCTCTTCCATTCTTTGAAATGCTTACAAAGATTTGCCAGTGAAACACTGATAAAATTGCTGGGCTGTCGCCCATTCTTCAGAAGGAA
  5   1   2       add Sp1       in                    IMAGE:4174725.5p                                                                                               GGCACTGCTGAAGTCTGGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAAAGCAAGCTCCTGGAGGTCTCATGTAGAGATGGGCCCACCTGACCCAATTCTGGGTGTGACAGAGGCTATGAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGCGCGTAATGCTGAAGCTCAGGTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTGGGCAGAGATCGCCCGGGCATCCGCACAGCGGGCACTTGGTGAAAATTGTGAAGCTGTCAAGAATGGACAGTGTATGACTGTACAGACCATGGCTGGAACAAGATCACTTCGGATTGAAGCCAACTTTGGGCACAGATTCTACAAGCACAGCCGTGAT
  5   1   2       bld Emb4                            IMAGE:4680614.5p                                                                                                     GACGCGTGGGCGGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAATCCCAGAACAGAGCA
  5   1   2       bld Ga12      in                         XL143g01.5p                                                                                                      GCTGAAGTCTCGGCTCCTTGTTGGAGTGGCTCGTTGCCGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCAGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAG
  5   1   2       bld Tail      in                    IMAGE:8542993.5p                                                                                                                GGCTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCAGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAAGCAGAGCAGTGGAAAGAGCTGGCAGCCTTTATGCAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAGGGGATTGCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTCATCCAGAAGGGAT
  5   1   2       bld Eye1                            IMAGE:6946203.5p                                                                                                                  CTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGGCTGTCCGCCACTTCATCCCAGAGGGAAATCATTTTAGTGCTGTCTCAATCCTATGCCCAGAACATGGGATTGTATGGTGAAACGTGTTGGGTGCATTCCCCTGTAAGT
  5   1   2       bld Te2                             IMAGE:7392997.5p                                                                                                                  CTCCTTGTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCAGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTTATGCAGAGTCGACGCCTCTTCCATTTCTTGACATGGCTTACCAGGATTNNGCAGTGAGCACTGATAGAGATGCTGGCTGTCCGCACTTCATCAGAGGAATCATTNATGCTGCTCATCTATGCAGACATGGATGATGTGACTGTNGGCTT
  5   1   2       bld Spl                             IMAGE:8462113.5p                                                                                                                        GTTGGAGTGGCTCGTTGCCAGCCCTGCTTGGCTGTGGTACAGGGCAGAGCAAGCTCCTGGTGGTCTCATGTTGAGATGGGCCCACCTGATCCAATTCTGGGTGTGACAGAGGCTTTTAAACGTGACACTAACCCCAAGAAGATGAACTTGGGTGTGGGAGCTTATCGGGATGACAATGGCAAACCTTATGTCCTAAGCAGTGTGCGTAAGGCTGAAGCTCAGTTGGCATCCAAAAATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCCTCTTCCATTCTTGACATGGCTTACCAGGANNNTGCAGTGAGCACTGATAGAGATGCTGGGCTGTCGC
  5   1   2       bld Tad1                            IMAGE:6936723.5p                                                                                                                                                                                                                                                                                                                                                                 GGATCTGGATAAGGAATATCTGCCTATTGGAGGCTTGGCAGAGTTTGCCCGGGCATCCGCACAGTTGGCACTTGGTGAAAATTGTGAAGCTGTTAAGAATGGACAGTTTATTACTGTACAGACCATTTCTGGAACAGGATCACTTCGGATTGGAGCCAACTTTTTGCAAAGATTCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAATTTGCAATGATGCTGAGGAGGCAAAACGAGTGGAGTTCCCAGATAAAGAATTTTGATCCCCCCCAATGTATTCCCAACCCCTCCCACTGGAATGGGACCACCGGAATAAGCAACCATCTTATTTTTGGAACCCCAACCCTGGAACCT
  5   1   2       bld Te1                             IMAGE:6929656.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTACAAGTACAGCCGTGATGTTTACCTGCCAAAACCATCCTGGGGCAATCACACACCAATATTCCGGGATGCTGGGTTGGAGGTGAAGGGTTACCGGTATTACGATCCCAAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGACTGGAGCACGGATAGCAGCATCTATTTTGACGCAACCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGGAATGGCTAACAGAATAATTATGCATGCGAGAACCAGCTTGGTTTTCAACCCTTAAAAAAAGAAAGAATCCATTCCACAAACTGGGCAGCCACAATAAATTGTACCAGAAATTGGGCCAGGTTTCCGGCCTTTTAACAGGGGCCTTTTCGGGCCCAAAAAAGCCAAGGGTCCAT
  5   1   2       e>1                            Xl3.1-IMAGE:7207824.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGAATGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGACCCTTAAATGTATTTAGATTCAATAAAAGTC
                                                  Xl3.1-CHK-1012687728                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGAATGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGACCCTTAAATGTATTTAGATTCAATAAAAGTCTTGGAA
  5   1   2       bld Tail                            IMAGE:8544804.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGATCCCAGACTTGTGGGTTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGAATGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAGTAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTC
  5   1   2       bld Brn3                            IMAGE:8537452.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGATTTTGCTGGTGCACTGGATGACCTCTCTAAAATCCCAGAACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGAATGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATTCAGCAATAATGGTTACCTTGCTCATGCTATTCACCNNAGTGACCAATGAGGGACTCAGACATCTACAAGCTGCCCTTGTGAGCACCTGACACCAGACCCAGAGCACTTATATTATGCCCATGCTAGCTATTGTTTTCCTCT
  5   1   2       bld Egg1                               PBX0094G04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACAGAGCATCATCTTGTTCCATGCCTGTGCTCATAATCCTACAGGTGTAGATCCTAAGCATGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGAATGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGAC
  5   1   2       add Eye1                            IMAGE:6958053.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCCTAAGCAAGAGCAGTGGAAAGAGCTGGCAGCCTTATGCAAGAGTCGACGCCTCTTCCCATTCTTTGACATGGCTTACCAAGGATTTGCCAGTGGAGACACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGAATGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTTCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCCTTCCGCAGAGCAGGTCGAACGTCTCATCCAAGAATTCTTCATCTTCCTTGACAAGGATGGACGTATTTTCGGTTGCCGGAATAACATCAGCCAAATAAGGGTAACCTTGCTCATGGCCATTCACCCGGTGGACCCAATTGAGGGGACTCCaaaaaatccaaaaaaCTTGCCCTTTTTGGAACACCTTTGACCAACCCGACCCCCAGAAAACCCttttttatttttgtcccccaaatggcttaaaaaatttttgttttttttccccccccccaaaaaaactggttccaaaaccccccacaaatggctttttggggaaaacaaaacctggttgggggcccttcccgggaaaaaaaaattttccccccaaaaaaaaTTCCGCCCCCTTTTGGAATACCGGGCTAAAA
  3   1   2       bld Te2  5g3  in                    IMAGE:7390412.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACTGATAGAGATGCCTGGGCTGTCCGCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGAATGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTGAGGCTCTACCTCCTAAGACGT
  5   1   2       bld Ga15                               XL426g17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCCACGNCGNTCCGNAATCAATTTAGNTGCNTGNTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGNTGNTTGGTGCATTCACTGNTAGNTTTGCAGNTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGAATGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGGTTGGTCCTTCCATGGAAGAACTTTCACCTAA
  3   1   2       chi Ga12      in                         XL143g01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCACTTCATCCAGGAGGGAATCAATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGACTGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACATCGGGCTTCTGTCCCACACTATCCAGGTGACTCTGGCTGCCCACTTCCCGGCTGAATTTGATGCCACAGCCCAGGCTGCTTGGGACAAGTTCCTCGCCGCCATCTCCACTGTTCTTACCTCCAAGTAAAGATAAGCCTGTGACAATAACACATCACATCTATGGACCATTTCCAGCAAATCCATGTCCTGTTCATTAAACTTAATAAAACTGTTCTCTGAAAAAA
  5   1   2       bld Skin                            IMAGE:8643997.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTAGTGCTGTCTCAATCCTATGCCAAGAACATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGAATGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCGGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACCACCAGACCCAAGAAGCACTTATTATTTATGCCCCAACGCTTAACATATTTGTTTTTCACTCCTCATAGAACTGGTCGATACCCCAAATGCATTTGTGCAGACCACTTGGTGGTCCTTCCATGAAGACTTTCACTAAAACATCCCCTTTTGATCTGGTAATGGATCATAAGTGAAGCTCCTCTCACATAAAGAATGGTCCTAGACTGATATGTAGAGCTAACTCATATGGGGAAAGACTGATGATCTGAATCTAAACCTCTTGTTGAGCTACTGTGATAATCATCACAGCAATG
  5   1   2       bld Bone                            IMAGE:8743900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGGGATTGTATGGTGAACGTGTTGGTGCATTCACTGTAGTTTGCAGTGATGCTGAGGAGGCAAAGCGAGTGGAGTCCCAGATAAAGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGACTGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACATCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGACCTGAATTGAGTCTGATATTTCCTTAGAACACTTTCTTTGTTTTGAGGGCTATAACTTGCTAGATTATATCTATTTCGACTAAGCATAGATGGTTGAGAGTAACGTATAGCACCTCTTAGGATTTTGTTCTTTACATACCGCGCTG
  5   1   2       bld Tbd7                                 XL107d21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGATTTTGATCCGCCCAATGTATTCCAACCCTCCACTGACTGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACATCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATT
  5   1   2       chi Brn1                            IMAGE:6956183.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACCCTCCACTGAATGGAGCACGGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTACCTCACATAAAAAGAAATTGGTCCTAAGAAACTGAAATATNGTTAGATGCTTTAGAACTTCATTAAATGGGGGGGAGAAGAGAACCCTGGAATTGAAAGTCTGGATATTTTCCTTAGAACACCCTTTCCTTTGGGTTTGGAAGGGCTAAAAACCTTGGCTAAGAATTTTTAAAAAACCTATTTTCCAAAACCAAGGCATAAAAATGGGTTGGGAAAGGGGAAATTAAACCCTAAA
  5   1   2       bld Tail                            IMAGE:8544558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGATAGCAGCATCTATTTTGACGCAGCCTGACCTGCGTAAGGAATGGCTCCAGGAGGTCAAGGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCTCCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTA
  5   1   2       chi Eye1                            IMAGE:7019793.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGACCGGTCCGGAATCCCGGGATGGAATGGCTAACAGAATAATTAGCATGCGAGAACAGCTGGTTTCCAACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTACCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTANGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAAATTATTCCTTTGGTTTTCCTGGGGGAACAGGAAGTCCTGCCAATGGATTAAACTGAACCAGCCTGTTTTACCAAGCCTTTTTGGGCAGAACTTGTTAAAATGTTAAATGTTCCCAAAATCAAAA
  3   1   2       bld Te2                             IMAGE:7391497.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCTGTTAAGAAAGGCTCCAGGGGTCAAGGGAATGGTAACGGATAATTACCATGGGGACCAGCTGGTTCCCACCTTAAAAAAGAGGATCCATCCACAATGGCAGCACATAGTGAACAGATTGGCATGTTCTGCTTTACAGGCTTTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTAATGTGATCATTAGGTGAGGCTCTACTCACAAAAGAATGCACTTNNCNTCC
  3   1   2       bld Bone 5g3  in                    IMAGE:8740138.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCACATTTATTTTGGAGCGAGCTGACCTGTTAAGAATGTTCAGAGTCAAGATGGTACCGATATGCATGGGGAACAGCTGGTTCACTAAAAGAAGATCATCCAAATGGCAGCACATAAGTGACAGATGCATGTTCGCTTTACAGGCTTCGCAGAGCAGGTCGAACATTCATCAAGGAATTCTCAATCTACAATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACAATCAGCAAAATAATGGTTACTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTTTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTTTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTTTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGC
  3   1   2       bld Panc 5g3  in                    IMAGE:8735404.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCTGACCTGTGCGTAAAGGAATGGTTCCCAGGAGTCAAGAATGCTAACGATATAGCATGCGGACCAGCTGTTCACTTAAAAAGAGATCCATCCACACTGCAGCACATAAGTGACCAGATGGCATGTTCTGCCTACAAGCATCGGCCAGAAGCAGGTCGAACGTCTCATCAAGAATCTCCATTCTACATGACGAAGGATGGACGTATTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTACCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTTTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATTTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGACCCTTAAATTTTTAGTTCTCTTAAG
  3   1   2       bld Tail 5g3  in                    IMAGE:8542276.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGACTGCGTAAGAATGCTCCAGAAGGTCAAGGGAATGCTACAGAATAATAGCATGCGAGACAGCTGTTCCAACTAAAAAAGAAGATCATCACAACTGCAGCACATAAGTGACCAGATTGGCATGTCTGCTTACAGGCGTCGGCCAGAGCAGGTCGAACGTCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTACCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTTTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGGAGGGA
  3   1   2       bld Bone 5g3  in                    IMAGE:8739497.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCCAGAGGGTTCAAGGATTGCTACGAATATAGCATGCGAGAACAGTGTTTCACTAAAGGAGATCATCACAACTGCAGCACTTAGTGACAGATTGCATGTCTGCTTACAGGCTTCGGCCAGAGCAGGTCGAACATCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTTTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCCAATTCCCCCT
  3   1   2       bld Tail      in                    IMAGE:8542993.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTCAGAGTCAAGGATGCTACCGATATAGGCATGCGAACAGCTGTTCACTTAAAAGAGATCATCACACTGCAGCACATAGTGAACAGATGCATGTTCTGCTTTACAGGCTCGCCAGAGCAGTCGAACGTCTCATCAAGGAATCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCGAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTACATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTTTGATATTTCCGTAGACACCTTTTTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGAAACGGGAGTAACCTATAGCAACTCTTTAGAATTGTCTTGCTACAGCTGGCAGTTAAAGCTTTTTGGTGGCTATAGGTTACTTTTATATATTTGAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTTTGCAATGGATTAACTGACCATCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGGGAGGGAAGAATCAATCCCCCTTAAATTTTTTTTAGATTTTACTTCTGT
  3   1   2       bld Tad1                            IMAGE:6878550.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCCTGCGGGGACAGCTGGTTTTCCCACCTTAAAAAAGAAGGATCCATCCACAACTGGCAGCACATAAGTGACCAGATTGGCATGTTCTGCTTTACAGGCCTTCGGCCAGAGCAGGTCGAACATCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTTCAGGAGTAACATCAGCAAATAATGGCTACTNTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCCGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATC
  3   1   2       bld Te2                             IMAGE:7207970.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGTTTTCCAACCTTAAAAAAAAGAAGGATCCCATCCCCCAACGGGCCAGCACATAAGTGACCCGAATTGGCATGTTCTGCTTTTCCAGGCTTTCGGCCCAGACCAGGTCGAACATCTCTTCAAAGGATTCTTCTATCTACATGACGAAGGATGACGTTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGACCCTTAAATGTATTAGATCAATAAAAGTCCTC
  3   1   2       bld Emb4 5g3  in                    IMAGE:5536588.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCANGTCTGCTTACAGCCTTCGGCCAGAGCAGGTCGAACGTCTCATCAGGAATTCTCCATTCACATGACGAAGGATGGACGTATTTCGGTNGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTACCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCATATTATGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAAGGGG
  3   1   2      seed Te2       in                    IMAGE:7207824.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGATCGAACATCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGACCCTTAAATGTATTAGATCGAATAAAAGTTCGA
  5   1   2       bld Te2       in                    IMAGE:7207824.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCGAACATCTCATCAAGGAATTCTCCATCTACATGACGAAGGATGGACGTATTTCGGTTGCAGGAGTAACATCAGCAAATAATGGTTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCATGACCCTTTAATGTATTTAGATTTCATAAAAGTCTTGGAAATCTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGG
  3   1   2       bld FaBN 5g3  in                    IMAGE:8074599.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGCAGTCGACATTCATCAGAATTCTCATCTCATGACGAGGATGGACGTATTCGGTTGCAGGAGTACATCAGCAAATAATGGTACCTTGCTCATGCTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGACCCTAAATGATTAGTTCTACTCTCC
  5   1   2       bld Lmb2      in                    IMAGE:8636422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TggggggggggggggggggggTGGCGTCGATTCGAATTCGTCCCAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTACCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGACCCTTAAATGTATTTAGATTCAATAAAAGTCTTGGAATCTGGA
  5   1   2       bld Egg1                               PBX0081G05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTATTCACCAGGTGACCAAATGAGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCTCCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTA
  3   1   2       bld Lmb2      in                    IMAGE:8636422.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATGAGGGGACTCAAGACATCTACCAAGCTGCCCCTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTACCTTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGACCCTAAATGATTAGTCAAAANCCACCCNNNNNCCCC
  5   1   2       bld Ga15      in                       XL445p14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGGGACTCAAGACATCTAACAAGCTGCCCTTGTTGAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCTCCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCANGGACTTTGGTGAGGGAANAATCNATGACCCTTAAATGTATTT
  3   1   2       bld Ga15      in                       XL445p14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCACCTTGACAACCAGACCCAAGAAGCACTTATTATTTATGCCCCAATGCTTAGCATATTTGTTTTTCACTCCTCATAGAACTGTTCGATACCCCAAATGCATTTGTGCAGACAACTTGTTGGTCCTTCCATGAAGAACTTTCTCCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTNGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTNGTTTTCTGGNGGAACAGAAGTCTGCAANGGATTAACNGACCAGCNGTATACAAGCTTTNGGCAGACTGTAAANGTAGTGTCCAATCAAAGACCTCAGGGACTT
  5   1   2       bld Ooc3                            IMAGE:3472494.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACAACTTGTTGGTCCTTCCATGAAGAACTTTCACCTAAAACATTCGTCCTTTTGATTCTGTTTAATGTGATCATTAGGTTGAGGCTTCTTCCCTCACATAAAAAGAAATTGGTCCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTCTGATATTTCCTTAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTA
  3   1   2       chi Sp1       in                    IMAGE:4963924.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTAAGAACTGAAATATGTTAGATGCTTAGACTTCATTAATGGGGGAGAGAGAACCTGAATTGAAGTTTGATATTTCCTTAGACCCCTTTCTTTGTTTTGAGGGCTATCCCCTCCTAGAATTTATTATTTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAAGGGGGGGGGGTGAAAAAAAAAATACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAAAATACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGACCCTTAAATGTATTTAGATTCAATAAAAGTCTTGGAATCTGA
  3   1   2       bld Sp1       in                    IMAGE:4174725.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGACACCTTTCTTTGTTTTGAGGGCTATAACTTGCTAGAATTTATAATCTATTTCAGACTAGGCATAGATGGTTGGAAGGGAGTAACCTATAGCAACTCTTTAGAATTTTGTCTTACTACAGCTGGCAGTTAAAGCTATTTGGTGGCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGACCCTTAAATGTATTTAGATTCAATAAAAGTCTTGGAATCTGAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5048189.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTATAGGTTACTTAAAATTATTCCTTTGTTTTCTGGTGGAACAGAAGTCTGCAATGGATTAACTGACCAGCTGTATACAAGCTTTTGGCAGACTGTAAATGTAGTGTCCAATCAAAGACCTCAGGGACTTTGGTGAGGGAAGAATCAATGACCCTTAAATGTATTTAGATTCAATAAAAGTCTTGGAATCTGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)