Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6946987.5                      49 END     2           3        4                (no blast hit)
     2   2.0    0Xl3.1-xl256p15.3.5                         20 END     1           1        5                DEAD (Asp-Glu-Ala-Asp) box polypeptide 1 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:6643417.5                      12 PI      86        106     1503                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012837485 Xl3.1-IMAGE:3436989-IMAGp.5.5 - 64 ESTs
                                                                       ........-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                         Xl3.1-IMAGE:3436989-IMAGp.5.5                                                                                                                                                                                                                                                                                       CTCAGAACCCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCTTGAGGAGATGGAAGAGTTTGCCAAGGAGCTGAAACAGAAGCGGGTGGCACTGGGTTATACCCAAGGAGACATTGGCCACGCCCTGGGAATATTATACGGGAAGATGTTCAGCCAGACGACTATCTGCCGCTTTGAGTCCCTGCAACTGACCTTCAAAAATATGTGTAAACTCAAACCCCTATTGGAGCAGTGGCTGGGAGAGGCGGAGAATAATGACAACCTACAGGAGATGATCCACAAGGCCCAGATTGAGGAGCAGAACCGCAAGCGGAAGATGAGGACCTGCTTTGATACTGTTCTAAAGGGCCAACTAGAGGGCCACTTCATGTGCAATCAGAAACCTGGTGCCAGGGAGCTGACGGAAATTGCCAAAGAACTGAGTCTGGAGAAAGATGTGGTGAGGGTCTTGTTCTGCAACCGGCGGCAGAAGGAGAAGAGCAAATTCAGAATGTCCAAGGGGCATGAGTTTGTGGGTGGTGCCAGTCCTGGATCCATCCAATCAGAACACATTTCTTTCACCCCCATTCCAGCTAATTCCCAGGACTATGGATTGGCCTCTCTACACCCCAACCGAGCCCCCTTCTACCCACCTCCCTTCCCCAGGAATGAGCTGTTCCCTCACATGGCTCCGGGGATATCTATGGGGGTCCTGACCGGCTGAGCCCACTGATTTTATTTCCGAATCTGCTGAACTGGTCTTACTGGGAATTGTGCTTTTATTATTCTTTTATGGGAGGAGGAGGAGTTGGGGCAGTTGTTGAACTACAGCCCTTGGTTCTGGCTTAGGGAACGTGGATCTGGGGTCTCCTCCACATTGAATGTTGTCCCTTGTCCTGATCGTTGTACTTGTAGGGCTGGGGATGGTTCTTTGAGTCCCCAGAGCAGGACTCTTCTATTACCAGCACTTGTTAACTTGCACTGCATTATGGGATGGGGGATTATTTCTACTAAAGAGACTGGCATAGGCTTTAATAATGTTCCATAGGTTTATAGTGTAACGTCTGGATACAATGGAGCAGCAGTCGGTTCCTCCAATCCACTCTTTCTGCTACATTGTATCAGGGGTAGAACTATAGTGTCTGTCTGCACTGCTGGATCTGACTCCAGAAACACAGCCGGACAGATACTGCTTCTATACCTCTGGTTACTGATGCTGTGCTGCTATGGGTGCCAATGTTTGTCAGGGAAAAGTTTTTGTTCCTCAATCGCATGGATTGTAAGCTCTTGGGGGGGTAACTCTTCTGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCTGTGTGTGTGTGGGGGGGTGTACCCTGAAATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACTGCCTTATTCTTCCAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012722673                                                                                                                                                                                                                                                                                             ACCCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCTTGAGGAGATGGAAGAGTTTGCCAAGGAGCTGAAACAGAAGCGGGTGGCACTGGGTTATACCCAAGGAGACATTGGCCACGCCCTGGGAATATTATACGGGAAGATGTTCAGCCAGACGACTATCTGCCGCTTTGAGTCCCTGCAACTGACCTTCAAAAATATGTGTAAACTCAAACCCCTATTGGAGCAGTGGCTGGGAGAGGCGGAGAATAATGACAACCTACAGGAGATGATCCACAAGGCCCAGATTGAGGAGCAGAACCGCAAGCGGAAGATGAGGACCTGCTTTGATACTGTTCTAAAGGGCCAACTAGAGGGCCACTTCATGTGCAATCAGAAACCTGGTGCCAGGGAGCTGACGGAAATTGCCAAAGAACTGAGTCTGGAGAAAGATGTGGTGAGGGTCTTGTTCTGCAACCGGCGGCAGAAGGAGAAGAGCAAATTCAGAATGTCCAAGGGGCATGAGTTTGTGGGTGGTGCCAGTCCTGGATCCATCCAATCAGAACACATTTCTTTCACCCCCATTCCAGCTAATTCCCAGGACTATGGATTGGCCTCTCTACACCCCAACCGAGCCCCCTTCTACCCACCTCCCTTCCCCAGGAATGAGCTGTTCCCTCACATGGCTCCGGGGATATCTATGGGGGTCCTGACCGGCTGAGCCCACTGATTTTATTTCCGAATCTGCTGAACTGGTCTTACTGGGAATTGTGCTTTTATTATTCTTTTATGGGAGGAGGAGGAGTTGGGGCAGTTGTTGAACTACAGCCCTTGGTTCTGGCTTAGGGAACGTGGATCTxxGGxxTCCTCCACATTGAATGTTGTCCCTTGTCCTGATCGTTGTACTTGTAGGGCTGGGGATGGTTCTTTGAGTCCCCAGAGCAGGACTCTTCTATTACCAGCACTTGTTAACTTGCACTGCATTATGGGATGGGGGATTATTTCTACTAAAGAGACTGGCATAGGCTTTAATAATGTTCCATAGGTTTATAGTGTAACGTCTGGATACAATGGAGCAGCAGTCGGTTCCTCCAATCCACTCTTTCTGCTACATTGTATCAGGGGTAGAACTATAGTGTCTGTCTGCACTGCTGGATCTGACTCCAGAAACACAGCCGGACAGATACTGCTTCTATACCTCTGGTTACTGATGCTGTGCTGCTATGGGTGCCAATGTTTGTCAGGGAAAAGTTTTTGTTCCTCAATCGCATGGATTGTAAGCTCTTGGGGGGGTAACTCTTCTGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCTGTGTGTGTGTGGGGGGGTGTACCCTGAAATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACTGCCTTATTCTTCCAAAAAAAAAAAAxAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                            5     9    13    19    18    23    21    28    23    29    28    32    28    32    29    33    30    33    30    33    30    33    31    33    31    33    30    33    32    33    31    33    32    33    32    33    30    33    33    33    32    32    32    32    32    32    32    32    32    32    32    33    32    33    28    33    32    33    32    33    31    33    32    33    32    33    29    33    30    31    31    32    30    30    28    30    27    29    27    30    24    29    25    29    25    28    25    28    26    27    24    28    26    27    25    26    25    26    20    26    21    26    20    26    18    24    17    22    15    20    12    19    12    19    13    18    10    18    13    18    11    18    12    18    10    18    11    18    10    18     8    18     7    18     7    17     5    17     4    16     5    15     5    14     5    13     5    12     5    11     4     9     3     8     3     8     3     8     3     5     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     1     2     1     2     1     2     1     2     1     3     1     2     1     2     1     2     1     2     1     2     1     2     1     4     2     4     3     6     3     6     3     6     3     6     3     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     6     7     8     9     8     9     8     9     8    10     8    10     8    10     8    10     8    10    10    12    10    12    10    12    11    13    10    13    12    13    11    13    11    15    11    15    11    15    10    15    10    15    13    16    14    17    15    18    15    18    15    18    14    18    14    18    14    18    14    19    14    19    14    19    14    19    14    19    14    19    14    19    14    20    13    20    13    20    13    20    17    21    16    21    17    21    16    21    16    20    16    20    16    20    16    19    16    19    16    19    16    19    17    20    16    19    16    19    15    18    16    18    15    18    13    17    13    17    11    15    10    14     7    10     5     8     4     4
  5   1   2      ests                      Xl3.1-IMAGE:3436989-IMAGp.5                                                                                                                                                                                                                                                                                       CTCAGAACCCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCTTGAGGAGATGGAAGAGTTTGCCAAGGAGCTGAAACAGAAGCGGGTGGCACTGGGTTATACCCAAGGAGACATTGGCCACGCCCTGGGAATATTATACGGGAAGATGTTCAGCCAGACGACTATCTGCCGCTTTGAGTCCCTGCAACTGACCTTCAAAAATATGTGTAAACTCAAACCCCTATTGGAGCAGTGGCTGGGAGAGGCGGAGAATAATGACAACCTACAGGAGATGATCCACAAGGCCCAGATTGAGGAGCAGAACCGCAAGCGGAAGATGAGGACCTGCTTTGATACTGTTCTAAAGGGCCAACTAGAGGGCCACTTCATGTGCAATCAGAAACCTGGTGCCAGGGAGCTGACGGAAATTGCCAAAGAACTGAGTCTGGAGAAAGATGTGGTGAGGGTCTTGTTCTGCAACCGGCGGCAGAAGGAGAAGAGCAAATTCAGAATGTCCAAGGGGCATGAGTTTGTGGGTGGTGCCAGTCCTGGATCC
  5   1   2      ests                                 Xl3.1-XL162m04.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATCTGGGGTCCCCTCCACATTGAATGTTGTCCCTTGTCCTGATCGTTGTACTTGTAGGGCTGGGGATGGTTCTTTGAGTCCCCAGAGCAGGACTCTTCTATTACCAGCACTTGTTAACTTGCACTGCATTATGGGATGGGGGATTATTTCTACTAAAGAGACTGGCATAGGCTTTAATAATGTTCCATAGGTTTATAGTGTAACGTCTGGATACAATGGAGCAGCAGTCGGTTCCTCCAATCCACTCTTTCTGCTACATTGTATCAGGGGTAGAACTATAGTGTCTGTCTGCACTGCTGGATCTGACTCCAGAAACACAGCCGGACAGATACTGCTTCTATACCTCTGGTTACTGATGCTGTGCTGCTATGGGTGCCAATGTTTGTCAGGGAAAAGTTTTTGTTCCTCAATCGCATGGATTGTAAGCTCTTGGGGGGGTAACTCTTCTGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCTGTGTGTGTGTGGGGGGGTGTACCCTGAAATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACTGCCTTATTCTTCCAAAAAAAAAAAAAAAG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                       -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                           A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                       G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------C-
                                               BLH ATG     159     558                                                                                                                                                                                                                                                                                       
                                               BLH MIN     159     122                                                                                                                                                                                                                                                                                       
                                               BLH OVR     159      83                                                                                                                                                                                                                                                                                       
                                               EST CLI       0      36                                                                                                                                                                                                                                                                                       
                                               ORF LNG     159       7                                                                                                                                                                                                                                                                                       
  5   1   2      ests                      Xl3.1-IMAGE:3436989-IMAGp.5                                                                                                                                                                                                                                                                                       CTCAGAACCCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCTTGAGGAGATGGAAGAGTTTGCCAAGGAGCTGAAACAGAAGCGGGTGGCACTGGGTTATACCCAAGGAGACATTGGCCACGCCCTGGGAATATTATACGGGAAGATGTTCAGCCAGACGACTATCTGCCGCTTTGAGTCCCTGCAACTGACCTTCAAAAATATGTGTAAACTCAAACCCCTATTGGAGCAGTGGCTGGGAGAGGCGGAGAATAATGACAACCTACAGGAGATGATCCACAAGGCCCAGATTGAGGAGCAGAACCGCAAGCGGAAGATGAGGACCTGCTTTGATACTGTTCTAAAGGGCCAACTAGAGGGCCACTTCATGTGCAATCAGAAACCTGGTGCCAGGGAGCTGACGGAAATTGCCAAAGAACTGAGTCTGGAGAAAGATGTGGTGAGGGTCTTGTTCTGCAACCGGCGGCAGAAGGAGAAGAGCAAATTCAGAATGTCCAAGGGGCATGAGTTTGTGGGTGGTGCCAGTCCTGGATCC
                                                  Xl3.1-CHK-1012687449                                                                                                                                                                                                                                                                                             ACCCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCTTGAGGAGATGGAAGAGTTTGCCAAGGAGCTGAAACAGAAGCGGGTGGCACTGGGTTATACCCAAGGAGACATTGGCCACGCCCTGGGAATATTATACGGGAAGATGTTCAGCCAGACGACTATCTGCCGCTTTGAGTCCCTGCAACTGACCTTCAAAAATATGTGTAAACTCAAACCCCTATTGGAGCAGTGGCTGGGAGAGGCGGAGAATAATGACAACCTACAGGAGATGATCCACAAGGCCCAGATTGAGGAGCAGAACCGCAAGCGGAAGATGAGGACCTGCTTTGATACTGTTCTAAAGGGCCAACTAGAGGGCCACTTCATGTGCAATCAGAAACCTGGTGCCAGGGAGCTGACGGAAATTGCCAAAGAACTGAGTCTGGAGAAAGATGTGGTGAGGGTCTTGTTCTGCAACCGGCGGCAGAAGGAGAAGAGCAAATTCAGAATGTCCAAGGGGCATGAGTTTGTGGGTGGTGCCAGTCCT
  5  -1   2       chi Egg3                            IMAGE:6323076.5p TTGGCTCATCGGGGCTTTTTTATCAGTNCACGTGCGGAATTTCTCCTTGTGAAAAGCCCCCGGGATCTCCCTGTGCCCCATTCCCGGGCGTTTCGGTCACGGGGGTGCCGGGTTCCCTCCCGCTGCGGGGTCTCCGGGTTTCGCTCTTTTGGGATTCGGACGAGAGGGTGTCGGTTCCCCCCCGCGACCAGGTGTTTGTCTTTGAGGAGCTGGAGACGCCGCATCTCCGCTCATTCCCGGGGCCCGTAGTTTCCAGGTGACTCCAGCTCCGCCCGGAACCGCCCGGACACGCCCCCCGCGGAGGGACTGGATTCTTTTTTGTGCTGCTAATTCATTTGTGGTTCTGTATTTGGGAAGCGCCTAGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGACGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGAGGTGATGAGAAGCCCCAACAAAAAGAGTGTGAGCTGGTGGTAGGCCCGGGAATC
  5  -1   2      seed Oo1                             IMAGE:6638629.5p   TCTTCCCACAAAAAGTTAAGGGGTTCCTTTAAGAAAAAAATTCCCCAAAGGTAGGCCGGTTTTCCCCCAGTCTTTGCCCCGTTGTAAAAAAGGTGGGGACCAGGTCCCTTGCCTTTTTATTCGCTCCTTCACTATAGGGGGCCCCTTGGTCCCAAGAAAAGCTGGGTAGGCTTAAGTTTGGGCCCCTTTGGGGGACTTCTTTGGGGCGGCCGGCAGTGGTTTGGNTTTTTGGGGTTTGGGGTGGNTTTNTNTTTNNtttttttttttttNATCAGTCTCAGAACCCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCATCAAAAAGAGTGTGAGCTTGGTTGGTTACGGACGCGTG
  5   1   2       bld Oo1  5g                         IMAGE:6642197.5p                                                                                                                                                                                                                                                       AAGGGCTGGTACNNCGGTCCGGAATTCCCTGGGATAGAACCCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGGAGTGGGGCGTCCAACACCGAGGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGNAACTGAAAGAGGATGGAATGACCCCTTGAGGAAAATGGGAAGAGTTTGCCAAGGAGCTGAAACAGAAGCGGGNTGGCACTGGGTTATACCCAAGGAGACATTGGCCACGCCCTGGGAATATAATATACGGGGAAGATGTTCAGCCAGACGACTATCTGGCCGCTTTGAGTCCCTGCAACTGACCTTTCAAAAA
  3  -1   2       bld Tbd4                            IMAGE:4059553.3p                                                                                                                                                                                                                                                                       AACTTTGGCAGATCTGAATTCCCCGGGGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAAAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAAACCAGCGGCT
  5   1   2       add Oo1  5g                         IMAGE:5084344.5p                                                                                                                                                                                                                                                                        GGGTTTATATCAGTCTCAGAACCCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTGATTTCTGGTGCGGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCGGAGCAAGTGCTGGAGATGGGCCAGCCCATATTGTAGAGCCAAACCTCCTTCCCCAACTTCACCTACAGCGCGGGAGGGGTGCAAGACGGGGGGCAATTACCAGTATTTGGGCGACGACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTGTAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGGGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCGCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTccccccccGAGGATGAGGAGGTCCCCAGTGCCTTCTCCAGTAGAGCACAAAGAGGGCTCTGGAATCCCCTCTCCCTAATAATTGCCCTCCATGTGGGGCCCTGgaaacttggaaagaggaatggaaatggacccctttggaggaaaaatggggaaaaaaGTTTTTTGCCCAAAGGGAAGGCTTGAAAAC
  5   1   2       bld Oo1  5g                         IMAGE:6643221.5p                                                                                                                                                                                                                                                                           AGGCTGGACCGGTCCGGATTCCCGGGATCTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAANNAGGATGGAAATGACCCTTGAGGAAAAGGAAGAGTTTGCCAAAGGAGCTGAAAACAGAAGCGGGGTGGCACTGGGGTTATACCCCAAGGAGACATTGGCCACGCCCTGGGAAATTAAAAAACGGGAAAGATGGTTCAGCCCAGACGACTATTCTGCCCGCTTTGNAGTCCCTGCAACTGGACCCTTCAAAA
  5   1   2       bld Emb4 5g                IMAGE:5572318-IMAGp.IMAGp                                                                                                                                                                                                                                                                                   CAGTCTCAGAACCCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGATATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGGCGTCCAACACCGAGGATGAGGAGGTCCC
  5   1   2       bld Ov1  5g                         IMAGE:6318067.5p                                                                                                                                                                                                                                                                                    AGTCTCAGAACCCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAAGTCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAAAAGGATGGAATGACCCTTGAGGGAATGGAAGAGTTTGCCAAGGAACTTGAACAAGAACCGGGGGGCACTGGGGTTATCCCCAAGGAAAACTTTGGCCCCGCCCCTGGGGAAATTTATACGGGGAAATTGTTCAGCCCGAAGAACTTTTTGCCGCTTTTGAATCCCTGCAACTGGACCTTCAAAAAATGGGGAAACTCCAACCCCTATTTGAAACAATGGGCTGGGAAAAGCGCGTTAAAAAATGGACACA
  5   1   2       bld Kid  5g                         IMAGE:4032173.5p                                                                                                                                                                                                                                                                                       CTCAGAACCCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCCTTTGAGAGATGGAAAGAGTTTGCCAAGGAGCTGAAACAGAAGCGGGTTGGCACTGGGG
  5   1   2       chi Oo1                             IMAGE:6640566.5p                                                                                                                                                                                                                                                                                        TCTCGAACCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGGTCTGTCAGTGAAGGGGAGGCCTCCAGTTCCCCTTTCCCCCATTCTCCCCTGGTGCCTTTCCTTTGCCCAATATGGGCATTATCCCCTCCTGGCAGCCAGGGGACCTTAACCAACCCAGGCTTACACTCTTTTTTGATGGGGGGGTGAATGAAAAAGCCCCCAAAAGGTTTTCGGTACAAAGGCCAACGGGCCTTCCCTTAGGGAAAggggggggggTCCAAAACCCCCGAGGGTTTTAGGGAGGGGCCCCCCAAGGGGCCCTTTCCTCCCGTTAAAAGCCCaaaaaaaagggggctctctgtgaaacccccccccccccAAAAAAAGAGGCCCCCGTGGGGGGC
  5   1   2       bld Ooc3 5g                IMAGE:3436989-IMAGp.IMAGp                                                                                                                                                                                                                                                                                         CTGGAATTCCCCGGGTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCTTGAGGAGATGGAAGAGTTTGCCAAGGAGCTGAAACAGAAGCGGGTGGCACTGGGTTATACCCAAGGAGACATTGGCCACGCCCTGGGAATATTATACGGGAAGATGTTCAGCCAGACG
  5   1   2       bld Emb1 5g                         IMAGE:6636644.5p                                                                                                                                                                                                                                                                                           GAACCCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCCTCGCTAGGNGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCCTGGAACTGAAGGAGGATGGAATGACCCCTTGAGGAAAATGGAAGAAGTTTGCCCAAGGAGCTGAAACCAGAAGCGGGTGGCCACTGGGGTTATACCCCAGGT
  5   1   2       bld Egg3 5g                         IMAGE:6868717.5p                                                                                                                                                                                                                                                                                            ATTCCCGGGGGCCTTGCTGGTTAGGGGATTCTTTTTTGTGCTGCTAATTCATTTGTGGTTCTGTATTTGGGAAGCGCCTAGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGACGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGAGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCTTGAGGAGATGGAAGAGTTTGCCAAGGAGCTGAAACAGAAGCGGGTGGCACTGGGTTATACCCAAGGAGACATTGGCCACGCCCTGGGAATATTATACGGGAAGATGTTCAGCCAGACGACTATCTGCCCGCTTTGAGTCC
  5   1   2       bld Ov1  5g                         IMAGE:8332750.5p                                                                                                                                                                                                                                                                                             AACCCAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCNACACCCGAGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAT
  5   1   2       bld Oo1  5g                         IMAGE:5078775.5p                                                                                                                                                                                                                                                                                               CCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGGATGAGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGGCCTGGAACTGAAGAGGATGGGATGACCCTTGAGGAGATGGAAGAGTTTGCCAGGGAGCTTGAAACGAAACGGGTGGGCACTGGGTTATTACCCAGGGAGACATTGGGCCACGCCCTGGGGAATATTTTCCGGGGAAGATGGTTCACCC
  5   1   2       bld Oo1  5g                         IMAGE:6860279.5p                                                                                                                                                                                                                                                                                               CCAAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGGACTGAAGAGGATGGAATGACCCTTGAGGAGATGGAAGAGTTTGCCCAAGAGCTGAAACAGAAGCGGGTGGGCACTGGGGTTATACCCAAGGGAGACATTGGCCCACGCCCC
  5   1   2       bld Ooc3 5g                         IMAGE:3437226.5p                                                                                                                                                                                                                                                                                                CCAGGCACTTGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGATGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTGTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTTCAACTGCCTCGCTAGGGAGTGGG
  5   1   2       bld Egg4 5g3  in                    IMAGE:3743021.5p                                                                                                                                                                                                                                                                                                   GGAATTCCCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGATGAGGATGGTTCTGTCAGTGAATGGAGGTCCTGCAAGTCCTCTTTGCCCAATTCTCTCCTGGTGCCTTCCTGTGCCCAAATTTTGCATTATCCCCTCCTGCAGCAGGGGAACCTAACCAACCAAACTCACACTCTTTTTGATTGGGGTGGATCGAAGCCCCCACCAGCACATACAAGCCCA
  5   1   2       bld Ga12 5g3  in                         XL212m10.5p                                                                                                                                                                                                                                                                                                   GGCACTTGCTGGTTTAGGGGATTCTGGTTTTTGCTTCTAATTAATTTGTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAGCATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAACCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCGTGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCATTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCT
  5   1   2       bld Ooc3      out                   IMAGE:3436820.5p                                                                                                                                                                                                                                                                                                        TGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGANCCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAAACCCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCA
  5   1   2       bld Oo1  5g                         IMAGE:3403793.5p                                                                                                                                                                                                                                                                                                         TGCTGGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGANGAGGATGGTTCTGTCATTGAATGAAGGTCCTTCACTTCTCCTTCCGCCTGTTATTCTATGGCTGCCTTCTTCGGT
  5   1   2       bld Egg3 5g                         IMAGE:6325840.5p                                                                                                                                                                                                                                                                                                             TCCCGGGGGGGATTCTTTTTTGTGCTGCTAATTCTTTGTGGTTCTGTATTTGGGAAGCGCCTAGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGACGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTATGATGGAGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCCGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAAGATGGAATGACCCCTTGAGGGAGATGGAAGAGTTTGCCAAGGGAGCTGAAACAGAAAGCGGTGGGCACTTGGGTTATTACCCCAAGGAGACTTTGGCCACGCCCCTGGGGAATATTATTACGGGGAAAGGATGTTTCAGCCCAGAACGACCTATCTTGCCCGGCTTTTGGAAGTCCCCTGGCAACCTGGAACCTTTCaaaaaaaaT
  5   1   2       bld Ooc3 5g                IMAGE:3436820-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                             GGTTTAGGGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAAAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCTTGAGGAGATGGAAGAGTTTGCCAAGGAGCTGAAACAGAAAGCGGGTGGCACTGGGTTATACCCAAGGAGACATTGGCCACGCCCTGGGAATATTATACGGGAAGAT
  5   1   2       bld Egg4 5g                         IMAGE:3742857.5p                                                                                                                                                                                                                                                                                                                  GGAATTCCCTTTTTTGTGCTGCTAATTCATTTGTGGTTCTGTATTTGGGAAGCGCCTAGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCATCCCATATTGTACAGCCAAACCTACTTGCCCAACTTCACCTACAGCCCATGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGATGAAACGCCGGGGAGTTGCCATGCTGCTTACTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGACGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGATGATGGTTCTGCCAGTGAACGGGAGGTCTCCAATTCGCCTTCCACCCGTACTCCC
  5   1   2       bld Oo1  5g                         IMAGE:6638754.5p                                                                                                                                                                                                                                                                                                                    GGGATTCTGTTTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCCTGGAACTTGAAAAGGATGGAATGACCCTTTGAAGGAGATGGAAAGAGTTTGCCCAAGGGAGCTTGAAAACCAGAAAACCGGGTTGGGCACCTGGGGTTTAATACCCCCAAGGGAAAACCTTTGGGGccccccgcccccTGGGGGAAATATTTATTTACCCGGGGAAAAAATGGTTTTCAAGCCCCAGGGAACGAAACTA
  5   1   0       chi Ov1                             IMAGE:6317574.5p                                                                                                                                                                                                                                                                                                                       ATTCTTTTTTGTGCTGCTAATTCATTTGTGGTTCTGTATTTGGGAAGCGCCTAGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGACGGCTTTCCACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGNTCTGTCAGTGAAGGGAGgtcctcccagtccccttccccccaatctccccctgtggcctcccTTTTGCCCATATGGGCATTATCCCCTCCTGGGCAGCAGGGGAACCTTACCCAACCCAAGCTCACACTTCTTTTTGATTGGAGGGGATGAAAAAGCCCCAACAGTTTCCTTCACAAGTCAAACGGGCTTCCTTTGGGAAAgggggggggCCCCAAACCCCCAAGGATTAAGGAGGGGCCCCCAGGGGGCATTTTCCCGTTAAAACCGAAAAAAAAGGGCCCCTGGGGAAAcccccccccccccaaaaaaaggccccctgggggggcccccgggaactttaaaaaaggagttggaaatggccccccTTGGGGGAGAA
  5   1   2       bld Ga12 5g3  in                         XL172k17.5p                                                                                                                                                                                                                                                                                                                         TCTGGTTTTTGCTTCTAATTAATTTGTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAGCATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCATCCCATATTGTACAACCAAACCTCCTTCCCCAACTTCACCTACAGCCCANGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCANCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCGTGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTC
  5   1   2       bld Ga12 5g3  in                         XL207g21.5p                                                                                                                                                                                                                                                                                                                           TGGTTTTTGCTTCTAATTAATTTGTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAGCATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAACCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCGTGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCATTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCTCAACAGTCTCGTCACAGTCCAACNGCCTCGCTAGG
  5   1   2       bld Emb1 5g                         IMAGE:6866325.5p                                                                                                                                                                                                                                                                                                                              TTTTTGCTTCTAATTCATTTCTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCATTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAAANAGAGGTCTCTGTAATCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCCTTGAGGAGATGGGAAAATTTTGCCAAGGACCTGAAACAGAAGCGGGGTGGCACTGGGGTTATACCCCAGGGAGACTTGGGCCACGCCCCGGGGAATATTATACCGGAAAGAATGTTTCACCCC
  5   1   2       bld Ga12 5g3  in                         XL142b20.5p                                                                                                                                                                                                                                                                                                                                        GNATTAATTTGTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGAGCATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAACCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCGTGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCATTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCTCAACAGTCTCGTCACA
  5   1   2       bld Ga12 5g3  in                         XL148f02.5p                                                                                                                                                                                                                                                                                                                                            AATTTGTGGTTCTGTATTTGGGAAGCGCCTTGGTCATTCTGANCATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTATTTTTGGGCCTGAGCAAGTGCTGGACATGGACCAGCCCATATTGTACAACCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGT
  5   1   2       bld Ga12 5g3  in                         XL162m04.5p                                                                                                                                                                                                                                                                                                                                             TAATTTGTGGTTCTGTATTTGGGAAGCGCCTTGGTATTCTGAGCATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAACCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCGTGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCATTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCTCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAG
  5   1   2       bld Ooc3 5g3  out                   IMAGE:3437011.5p                                                                                                                                                                                                                                                                                                                                                                   AAGCGCCTTGGTCATTCTGAACATTTAATTCCCAGGCCTTGGGTTGGAAGAGTTGGTAGTTTGGGCCTGAGCAAGTGCTGGAGATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCATGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCATAATTTGGTGCCCATGATGAAGAAACTGTGGGGAGTTGCCTTGCTGCTGCCTTTGACTGGAACCTGTTCCCTCACTTTCAGATCTCTAACCATGCGGCTTCCAACAGCTCTGGATATCCATGTCCAGAGGGAAGAACTGAGGATGATGGTTCTGTCAGTGAAGGGAGGTGCTCCAGTTCCCCTTCCTCCAATTCTGCCGTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCATTCTGGCAGCATGGGAACCTAACCAACTAAGCTCACACTCTTCTTGATGGGGGTGATGAGAATCCCCTACAAGTCTGTCACTGTTCTACGGCCTCTCTA
  5   1   2       bld Ooc2      in                    IMAGE:3746312.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTCCCTGTTATAAAATCAGAATTGGGTGCCCATGAAGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTAAGTGAAGGGAGGTCCTACAGTTCCCCTTCCCCCAATTCTACCCTGGTGCCTTCATTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTATCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGATGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGACAGAGGTCTCTGTAGTTCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCTTGATGAGATGGAAGAGTTTGCCAAGGAGCTGAAACAGAAGCGGGGTGCACTGGGTTATACTCAAAGAGACATTGGACACGCTCTGCGAATATTATACNGGGAGATGTTCAGCCAGACGACTATG
  5   1   2       bld Oo1                             IMAGE:6642978.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCTTGAGGAGATGGAAGAGTTTGCCAAGGAGCTGAAACAGAAGCGGGTGGCACTGGGTTATACCCAAGGAGACATTGGCCACGCCCTGGGAATATTATACGGGAAGATGTTCAGCCAGACGACTATCTGCCGCTTTGAGTCCCTGCAACTGACCTTCAAAAATATGTGTAAACTCAAACCCCTATTGGAGCAGTGGCTGGGAGAGGCGGAGAATAATGACAACCTACAGGAGATGATCCACAAGGCCCAGATTGAGGAGCAGAACCGCAAGCGGAAGATGAGGACCTGCTTTGATACTGTTCTTAAAGGGCCAACTGGAGGGCCACTTCATGTGCAATCAGAAAACCTGGTGGCCAGGGAAGCTGACGGGAAATTGCCAAAAGAACTGNAGTCTGGGAGAAAAGATGTGGTTGAAGGTTCCTGTTTTCTGCAACCGGGCGGGCAGAAAGGAANAAANAGCCAAGTTTCCAGAAATGGCCAAGGGGGGCATGGAAGTTTTTGTGGGTTTGGTTGCCCAGTTCCCTGGGAATCCCATTCCAATTCCGAAACCCCCTTTTCCCTTTTccccccccccATTTCCCGGGTTTATTTCCCCAGGGAACTTATTGGGAATTTGGGCCCCttttttttaaaacccccccccaaaccgggaagccccccccttttttaaacgccaaacttttccctttttcccccCCGGGGAAAAATGGGCCCTTTT
  5   1   2       bld Ga12      in                         XL153o18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCTTGAGGAGATGGAAGAGTTTGCCAAGGAGCTGAAACAGAAGCGGGTGGCACTGGGCTATACCCAAGGAGACATTGGCCACGCCCTGGGAATATTATACGGGAAGATGTTCAGCCAGACGACTATCTGCCGCTTTGAGTCCCTGCAACTGACCTTCAAAAATATGTGTAAACTCAAACCCCTATTGGAGCAGTGGCTGGGAGAGGCGGAGAATAATGACAACCTACAGGAGATGATCCACAAGGCCCAGATTGAGGAGCAGAACCGCAAGCGGAAGATGAGGACCTGCTTTGATACTGTTCTAAAGGGCCAACTAGAGGGCCACTTCATGTGCAATCAGAAACCTGGTGCCAGGGAGCTGACGGAAATTGCCAAAGAACTGAGTCTGGAGAAAGATGTGGTGAGGGTCTGGTTCTGCAACCGGCGGCAGAAGGAGAAGAGCAAATTCAGAATGTCCAAGGGGCATGAGTTTGTGGGTGGTGCCAGTCCTGGATCC
  5   1   2       bld Ooc3      in                    IMAGE:3436504.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGATGTTCAGCCAGACGACTATCTGCCGCTTTGAGTCCCTGCAACTGACCTTCAAAAATATGTGTAAACTCAAACCCCTATTGGAGCAGTGGCTGGGAGAGGCGGAGAATAATGACAACCTACAGGAGATGATCCACAAGGCCCAGATTGAGGAGCAGAACCGCAAGCGGAAGATGAGGACCTGCTTTGATACTGTTCTAAAGGGCCAACTAGAGGGCCACTTCATGTGCAATCAGAAACCTGGTGCCAGGGAGCTGACGGAAATTGCCAAAGAACTGAGTCTGGAGAAAGATGTGGTGAGGGTCTTGTTCTGCAACCGGCGGCAGAAGGAGAAGAGCAAATTCAGAATGTCCAAGGGGCATGAGTTTGTGGGTGGTGCCAGTCCTGGATCCATCCAATCAGAACACATTTCTTTCACCCCCATTCCAGCTAATTCCCAGGACTATGGATTGGCCTCTCTACACCCCAACCGAGCCCCCTTCTACCCACCTCCCTTCCCCAGGAATGAGCTGTTCCCTCACATGGCTCCGGNGATATCTATGG
  5   1   2      ests                                 Xl3.1-XL162m04.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATCTGGGGTCCCCTCCACATTGAATGTTGTCCCTTGTCCTGATCGTTGTACTTGTAGGGCTGGGGATGGTTCTTTGAGTCCCCAGAGCAGGACTCTTCTATTACCAGCACTTGTTAACTTGCACTGCATTATGGGATGGGGGATTATTTCTACTAAAGAGACTGGCATAGGCTTTAATAATGTTCCATAGGTTTATAGTGTAACGTCTGGATACAATGGAGCAGCAGTCGGTTCCTCCAATCCACTCTTTCTGCTACATTGTATCAGGGGTAGAACTATAGTGTCTGTCTGCACTGCTGGATCTGACTCCAGAAACACAGCCGGACAGATACTGCTTCTATACCTCTGGTTACTGATGCTGTGCTGCTATGGGTGCCAATGTTTGTCAGGGAAAAGTTTTTGTTCCTCAATCGCATGGATTGTAAGCTCTTGGGGGGGTAACTCTTCTGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCTGTGTGTGTGTGGGGGGGTGTACCCTGAAATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACTGCCTTATTCTTCCAAAAAAAAAAAAAAAG
                                                  Xl3.1-CHK-1012688427                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGxxxCCTCCACATTGAATGTTGTCCCTTGTCCTGATCGTTGTACTTGTAGGGCTGGGGATGGTTCTTTGAGTCCCCAGAGCAGGACTCTTCTATTACCAGCACTTGTTAACTTGCACTGCATTATGGGATGGGGGATTATTTCTACTAAAGAGACTGGCATAGGCTTTAATAATGTTCCATAGGTTTATAGTGTAACGTCTGGATACAATGGAGCAGCAGTCGGTTCCTCCAATCCACTCTTTCTGCTACATTGTATCAGGGGTAGAACTATAGTGTCTGTCTGCACTGCTGGATCTGACTCCAGAAACACAGCCGGACAGATACTGCTTCTATACCTCTGGTTACTGATGCTGTGCTGCTATGGGTGCCAATGTTTGTCAGGGAAAAGTTTTTGTTCCTCAATCGCATGGATTGTAAGCTCTTGGGGGGGTAACTCTTCTGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCTGTGTGTGTGTGGGGGGGTGTACCCTGAAATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACTGCCTTATTCTTCCAAAAAAAAAA
  5   1   2       add Ov1       in                    IMAGE:5073459.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGTCCGGTGGGTGGTGCCAGTCCTGGATCCATCCAATCAGAACACATTTCTTTCACCCCCATTCCAGCTAATTCCCAGGACTATGGATTGGCCTCTCTACACCCCAACCGAGCCCCCTTCTACCCACCTCCCTTCCCCAGGAATGAGCTGTTCCCTCACATGGCTCCGGGGATATCTATGGGGGTCCTGACCGGCTGAGCCCACTGATTTTATTTCCGAATCTGCTGAACTGGTCTTACTGGGAATTGTGCTTTTATTATTCTTTTATGGGAGGAGGAGGAGTTGGGGCAGTTGTTGAACTACAGCCCTTGGTTCTGGCTTAGGGAACGTGGATCTGGGGTCCTCCACATTGAATGTTGTCCCTTGTCCTGATCGTTGTACTTGTAGGGCTGGGGATGGTTCTTTAAGAGTCCCCAGAGCAGGACTGTTCTATTACCAGCACTTGTTAATTTGCACTGCATTATGGGATGGGGGATTATTTCTACTAAAGAGACTGGCATAGGCTTTAATAATCTTCCATAGGTTTATAGTGTAACGTCTGGATACAATGGAACAGCAGTCGGTTCCTCCAATCACTCTTTCT
  5   1   2       bld Egg1                               PBX0158B11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGCTGAACTGGTCTTACTGGGAATTGTGCTTTTATTATTCTTTTATGGGAGAAGGAGGAGTTGGGGCAGTTGTTGAACTACAGCCCTTGGTTCTGGGTTAGGGAACGTGGATCTGGGGTCCTCCACATTGAATGTTGTCCCTTGTCCTGATCGTTGTACTTGTAGGGCTGGGGATGGTTCTTTGAGTCCCCAGAGCAGGACTCTTCTATTACCAGCACTTGTTAACTTGCACTGCATTATGGGATGGGGGATTATTTCTACTAAAGAGACTGGCATAGGCTTTAATAATGTTCCATAGGTTTATAGTGTAACGTCTGGATACAATGGAGCAGCAGTCGGTTCCTCCAATCCACTCTTTCTGCTACATTGTATCAGGGGTAGAACTATAGTGTCTGTCTGCACTGCTGGATCTGACTCCAGAAACACAGCCGGACAGATACTGCTTCTATACCTCTGGTTACTGATGC
  5   1   2       bld Ov1       out                   IMAGE:5072950.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGCGTGGATCTGGGGTCCTCCACATTGAATGTTGTCCCTTGTCCTGATCGTTGTACTTGTAGGGCTGGGGATGGTTCTTTAAGAGTCCCCAGAGCAGGACTGTTCTATTACCAGCACTTGTTAATTTGCACTGCATTATGGGATGGGGGATTATTTCTACTAAAGAGACTGGCATAGGCTTTAATAATCTTCCATAGGTTTATAGTGTAACGTCTGGATACAATGGAACAGCAGTCGGTTCCTCCAATCCACTCTTTCTGCTACATTGTATCAGGGGTAGAACTATAGTGTCTGTCTGCACTGCTGGATCTGACTCCAGAAACACAGCCGGACAGATACTGCTTCTATACCTCTGGTTACTCATGCTGTGCTGCTATGGGTGCCAATGTTTGTCAGGGAAATGTTTTTGTTCCTCAATCGCATGGATTGTAAGCTC
  5   1   2       bld Emb1                            IMAGE:5156331.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACAGCCCTTGGTTCTGGGTTAGGGAACGTGGATCTGGGCTCCTCCACATTGAATGTTGTTCCTTGTCCTGATCGTTGTACTTGTAGGTGGTTCTAAGAGTCCCCAGAGCAGGACTCTTCTATTACCAGCACTTAATTTGCACTGCATTATGGGAGGGGGGATTATTTCTACTAAAGACTGGCATAGGCTTTAATAATGTTCCATAGGTTTATAGTGTAACGTCTGGATACAATGGAACAGCAGTCGGTTCTTCCAATCCACTCCTTCTACATTGTATCAGGGGTAGAACTATAGTGTCTGTCTGCACTGCTGGATCTGACTCCAGAAACACAGCCGGACAGATACTGCTTCTATACCTCTGGTTACTCATGCTGTGCTGCTATGGGTGCCAATGTTTGTCAGGGAAATGTTTTTGTTCCTCAATCGCATGGATTGTAAACTCTTGGGGGTAACTCTTCTGTTTCCGGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCTGTGTGTGTggggggggTGTACCCTGAAATGACCCTGGGAGATGGGTTGGGGGGTACCTTGAAAGGACCCAGGGAGATAACGAGACCATTAGGAGCAATCGTTTCCCTGCCCTTCAACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAAAAGCCTTGTTTTGATCTAAAATAAAGGGGGAAAGTAAATAAGTACCGGTACATTCAAGGGGAATTGGTCGCTTCCATTGAAGCCAACTTGCCACCTATTAAATTCGCCATGCTGGAAAAGGCGCTTCAACCCCCTTTTTCACCCGTTTCACGGGGACTGGGCCCCTCTAAAGGCGGCCCCCCCGGCTCCTAAATAAAGGCCTACAGGCTTCTCTACCGGGAGGCGCCAAGGGCCTATTACCCCTTCC
  5   1   2       bld Ga12      in                         XL182f18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCTGGGGTCCTCCACATTGAATGTTGTCCCTTGTCCTGATCGTTGTACTTGTAGGGCTGGGGATGGTTCTTTGAGTCCCCAGAGCAGGACTCTTCTATTACCAGCACTTGTTAACTTGCACTGCATTATGGGATGGGGGATTATTTCTACTAAAGAGACTGGCATAGGCTTTAATAATGTTCCATAGGTTTATAGTGTAACGTCTGGATACAATGGAGCAGCAGTCGGTTCCTCCAATCCACTCTTTCTGCTACATTGTATCAGGGGTAGAACTATAGTGTCTGTCTGCACTGCTGGATCTGACTCCAGAAACACAGCCGGACAGATACTGCTTCTATACCTCTGGTTACTGATGCTGTGCTGCTATGGGTGCCAATGTTTGTCAGGGAAAAGTTTTTGTTCCTCAATCGCATGGATTGTAAGCTCTTGGGGGGGTAACTCTTCTGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCtgtgtgtgtgtgggggggtgtACCCTGAAATGACCCTGGGAGAT
  5   1   2       bld Ga12      in                         XL199j17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCTGGGGTCCTCCACATTGAATGTTGTCCCTTGTCCTGATCGTTGTACTTGTAGGGCTGGGGATGGTTCTTTGAGTCCCCAGAGCAGGACTCTTCTATTACCAGCACTTGTTAACTTGCACTGCATTATGGGATGGGGGATTATTTCTACTAAAGAGACTGGCATAGGCTTTAATAATGTTCCATAGGTTTATAGTGTAACGTCTGGATACAATGGAGCAGCAGTCGGTTCCTCCAATCCACTCTTTCTGCTACATTGTATCAGGGGTAGAACTATAGTGTCTGTCTGCACTGCTGGATCTGACTCCAGAAACACAGCCGGACAGATACTGCTTCTATACCTCTGGTTACTGATGCTGTGCTGCTATGGGTGCCAATGTTTGTCAGGGAAAAGTTTTTGTTCCTCAATCGCATGGATTGTAAGCTCTTGGGGGGGTAACTCTTCTGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCtgtgtgtgtgtgggggggtgtACCCTGAAATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAA
  3   1   2       bld Ga12 5g3  in                         XL212m10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACAGATACTGCTTCTATACCTCTGGTTACTGATGCTGTGCTGCTATGGGTGCCAATGTTTGTCAGGGAAAAGTTTTTGTTCCTCAATCGCATGGATTGTAAGCTCTTGGGGGGGGTAACTCTTCTGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCTGTGTGTGTGTGGGGGGGTGTACCCTGAAATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAA
  3   1   2       bld Ga12      in                         XL199j17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGTTACTGATGCTGTGCTGCTATGGGTGCCAATGTTTGTCAGGGAAAAGTTTTTGTTCCTCAATCGCATGGATTGTAAGCTCTTGGGGGGGTAACTCTTCTGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCTGTGTGTGTGTGGGGGGGTGTACCCTGAAATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATG
  3   1   2      seed Ga12 5g3  in                         XL162m04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTTACTGATGCTGTGCTGCTATGGGTGCCAATGTTTGTCAGGGAAAAGTTTTTGTTCCTCAATCGCATGGATTGTAAGCTCTTGGGGGGGTAACTCTTCTGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCTGTGTGTGTGTGGGGGGGTGTACCCTGAAATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAAC
  3   1   2       bld Ga12      in                         XL182f18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTACTGATGCTGTGCTGCTATGGGTGCCAATGTTTGTCAGGGAAAAGTTTTTGTTCCTCAATCGCATGGATTGTAAGCTCTTGGGGGGGTAACTCTTCTGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCTGTGTGTGTGTGGGGGGGTGTACCCTGAAATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATG
  3   1   2       bld Ga12 5g3  in                         XL148f02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TACTGATGCTGTGCTGCTATGGGTGCCAATGTTTGTCAGGGAAAAGTTTTTGTTCCTCAATCGCATGGATTGTAAGCTCTTGGGGGGGTAACTCTTCTGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCTGTGTGTGTGTGGGGGGGTGTACCCTGAAATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCT
  5   1   2       bld Ov1                             IMAGE:8329979.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCACGCGTCCGTCCCCCCCAAGAGCTTACAATCCATGCGATTGAGGGGGTAACTCTTCTGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCTGTGTGTggggggggagggggTGTACCCTGAAATGACCCTGGGGGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATAACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGACCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCTAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCGCCCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGTACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTCCGACTAACACTGGGAATTGGGTCATAGCTCCCCGGACTTTGTTCTATAACTGAAGTGTGAATGATTCATTAAAAAACCGCCA
  3   1   2       bld Ga12 5g3  in                         XL142b20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGATTGTAAGCTCTTGGGGGGGTAACTCTTCTGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAAGCTGTGTGTGTGTGGGGGGGTGTACCCTGAAATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGC
  3   1   2       bld Ga12      in                         XL153o18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTTTCCAGAATATCCATTGAATTTTCATTAAATGTCTTCCTGCTTTTATATTTGCAATGAANCTGTGTGTGTGTGGGGGGGTGTACCNTGAAATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGA
  3   1   2       bld Ga12 5g3  in                         XL172k17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGAATATCCATTGAATTTTCATTAAATGTCTTCNTGCTTTTATATTTNCAATGAATCTGTGTGTGTGTGGGGGGGTGTACCCTGAAATGACCATGGNAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGANAAGCCTGTTTTGATCTAAAATAAAGGGNAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGNNATAGGTTTCTACAGGAGACCNAGGACTTTA
  3   1   2       bld Ga12 5g3  in                         XL207g21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTTATATTTGCAATGAAGCTGTGTGTGTGTGGGGGGGTGTACCCTGAAATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACG
  5   1   2       bld Egg1                            IMAGE:3301372.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCACGAGGATGACCCTGGGAGATGGGTTGGTGGGTACCTTGAAAGGACCCAGGGAGATACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATT
  5   1   2       bld Ov1                             IMAGE:8328839.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGAAATGACCCTGGGGGATGGGTTGGTCGGTACCTTGAAAGGACCCAGGGAGATAACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGACCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCTAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCGCCCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCCGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACTGCCTTATTCTTCCaaaaaaaaaaaaaaaGGGCGGCC
  3   1   2       bld Ooc2      in                    IMAGE:3746312.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGATGGGTTGGGGGGTACCTTGAAAGGACCCAGGGAGATAACGAGACAATTAGTAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTAAAAGCGTTAAAGGGACTGGGCATCTAAAGGCGCCCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTAGCAATCCATAGAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTCTACATAGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCCGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACTGCCCACCCCCCCCAA
  3   1   2       bld Egg4 5g3  in                    IMAGE:3743021.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGAAAGGACCCAGGGAGATAACGAGACAATTAGGAGCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGACCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCTAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCGCCCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGCTCCCCGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACTGCCTTATTCTTCCAAAAAAA
  3   1   2       bld Ooc3      in                    IMAGE:3436504.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGACAATTAGGATCAATCGTTCCCTGCCTGGCACTGTGGGAGTTAAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCGCCCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGGCCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACTGCCTTATTCTTCCAAA
  5   1   2       bld Egg1                               PBX0120H02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACGAGGTCGTTCCCTGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGATCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCACCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACTGCCTTATTCTT
  3   1   2       bld Ov1       in                    IMAGE:5073459.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCCTGGCACTGTGGGAGTTAATCAGCTGCCTGCATTGGTGAGCAGAGAAGCCTGTTTTGACCTAAAATAAAGGGGAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCTAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCGCCCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCCGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACTGCCTTATTCTTCCAAAAAAAAAAAAAAAG
  3   1   2       bld Emb1                            IMAGE:3402951.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGTAAATAAGTACGGTACATACAAGGGGATTGTTGCTTCTATTGATGCCAACTGCCACCTATAAAATTCTCATGCTGTAGATGCGCTTACCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCGCCCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAANGATCCCCGGAGCTTGTGTTCCTNATAACCNTGATGTGTGAACTGATTCTTTAATAAAAACTGCCTTATTCTTCCAAA
  5   1   2       bld Egg4      in                    IMAGE:3743987.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGAATTCCTTTTTTTAAGCGTTAAAGGGACTGGGCATCTAAAGGCGCCCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACTGCCTTATTCTTC
  3   1   2       bld Egg4      in                    IMAGE:3743987.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGCGCCCCCCCGTTCTACATAATGCTATAGGTTTCTACAGGAGACCAAGGACTTTAGCAATCCATATAGTATTGATATTGCAGTTATTGATGATTAGGAGGCACTGCGTCCAGGACCTGTAGATGGAGCCTGTTCTAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACACTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACTGCCTTATTCTTCCAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Oo1                             IMAGE:3405089.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAACTGTCAGTGCCCAGAGCTTTCTCTTGGAAACGGATTTATGTTTCGACTAAACCCTGGGAATTGGGTCATAAGATCCCTGGAGCTTTGTTCCTATAACCTGATGTGTGAACTGATTCTTTAATAAAAACTGCCTTATTCTTCCAAAAAAAAAAAATAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAGAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)