Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 90%

 1012837497 Xl3.1-IMAGE:6641854.5.5 - 110 ESTs
                                                                       ..-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6641854.5.5                                                     GATTGGTTGGACACCGATCGTCGGGCCAAATACGAACAGACAGCTGGAAACCGATCGGGCTTGTGGCCCAGACAGCTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGCCTCTACGAAGCTCAACGACCGCTCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGCACCATTTCGGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAACCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCGTCCTTATTTACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATCCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCCCCAGAGCAGACGTATTACTTCGACACATTGACCGCTCTGAACTTCGCTGCCAAATCCAAGCAGATCATTAACAAGCCTTTCAGCCGGGAAACCACCCAGACCGTGGCTCAGCCAGCCATGAAGAGGCCCAGGGAGGAAGCAGAGCACATAGCCGGTTCTCAGAAAAGAAAGAAATCCAAAACTGACTCCACAGAGTCGTCTCCCAATTCTTCAATGGAATCGACGGGCAAACGGAAACTCAATTTGGCTTCGCTGGATTCCGCTGTGGTAGAGAGGCTGCTGAAACTGGATAAGATCCTGACAGAGAAGGGAAAGAAGGAGGCGCAGCTCTTGAGCACCCCCAAGAGAGAGCGAATGGCACTGCTGAAGAAATGGGAGGAAAGTCAGATGGAGATCGAGAGACTAAAGGAGAAGCAAAAGGAGCTGGAGCAGAAAGCGATGGAAGCAGAGGCTCGACTGGAGAAATCCAATAACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCAGAGGCAGAAACACATCCACAGCGAAGGTCAAGAAAGTGCTGCGTGTACTGCCCATGCAGGGGAACAGCCAGTTACAAAGCACCGTAGAGGAGGGGATCCCAGTCTTTGAGAAGAAGAAAAAGAAGAAACAGGTCACATGTGAGGGGCTTGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGCTACTCAACACCGGCTCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTGATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTATATTCTTCCAAATCAAGTCCATGTCTTTCTGTAAAATAAACGTTTTTGGTTTTTTTTAAACATATATTCTCCAGTTTCTTATGAAAGTTCACATTTCACAGTATCGGGGACATGCAAGGTTGGGTGTGTGTTCAGAAGAAGCTGGGGGAGACGCTCGGAATAAATACATTCTCTACCTCCTAGTTCTCTTCTCCCCATTCTCTCTTTCTGTTGTAAAAGCAGCAGTATCTTTTTCTTTCAGAATTCCTCTTCTTTTTGAGCTCTGTTAAAATTCTGTGTTCTATTTAAAGGGGAACTATCGCGAAAATGAAAATTTAATA
                                                  Xl3.1-CHK-1012721312                                                           TTGGACxCxxxxCxxxxxGCCAAATACGAAxxGAxAGxxxGxAACCGATCGGGCTTGTGGxxxxxxCxxxxxGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGCCTCTACxAAxCTCAACGACCGATCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGCACCATTTCGGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAACCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCGTCCTTATTTACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATCCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCCCCAGAGCAGACGTATTACTTCGACACATTGACCGCTCTGAACTTCGCTGCCAAATCCAAGCAGATCATTAACAAGCCTTTCAGCCGGGAAACCACCCAGACCGTGGCTCAGCCAGCCATGAAGAGGCCCAGGGAGGAAxCAGxxCACATAGCCGGTTCTCAGCAAAGAAAGAAATCCAAAACTGACTCCACAGAGTCGTCTCCCAATTCTTCAATGGAATCGACGGGCAAACGGAAACTCAATTTGGCTTCGCTGGATTCCGCTGTGGTAGAGAGGCTGCTGAAACTGGATAAGATCCTGACAGAGAAGGGAAAGAAGGAGGCGCAGCTCTTGAGCACCCCCAAGAGAGAGCGAATGGCACTGCTGAAGAAATGGGAGGAAAGTCAGATGGAGATCGAGAGACTAAAGGAGAAGCAAAAGGAGCTGGAGCAGAAAGCGATGGAAGCAGAGGCTCGACTGGAGAAATCCAATAACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCAGAGGCAGAAACACATCCACAGCGAAGGTCAAGAAAGTGCTGCGTGTACTGCCCATGCAGGGGAACAGCCAGTTACAAAGCACCGTAGAGGAGGGGATCCCxGTxTTTGAGAAGAAGAAAAAGAAGAAACAGGTCACATGTGAGGGGCTTGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCxxxxAGxxxAxxATCCTGxxACTxxxCAxCxxxxxCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTGATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATxxxGxxGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTATATTCTTCCAAATCAAGTCCATGTCTTTCTGTAAAATAAACGTTTTTGGTTTTTTTTAAACATATATTCTCCAGTTTCTTATGAAAGTTCACATTTCACAGTATCGGGGACATGCAAGGTTGGGTGTGTGTTCAGAAGAAGCTGGGGGAGACGCTCGGAATAAATACATTCTCTACCTCCTAGTTCTCTTCTCCCCATTCTCTCTTTCTGTTGTAAAAGCAGCAGTATCTTTTTCTTTCAGAATTCCTCTTCTTTTTGAGCTCTGTTAAAATTCTGTGTTCTATTTAAAGGGGAACTATCGCGAAAATGAAAATTxxxxxATCAGG
                                                      consensus depths                                                          3     6     4     8     5    10     5    12     7    15     8    18    12    28    16    32    23    37    24    37    25    39    25    39    35    40    36    40    36    41    36    41    27    41    39    43    38    43    39    42    39    42    37    42    40    42    39    43    41    43    27    43    42    43    43    43    42    43    42    44    43    44    44    45    43    45    44    46    41    46    42    47    46    47    46    47    46    47    45    46    41    45    42    45    39    45    41    45    39    43    35    43    38    43    35    41    37    43    37    43    37    44    38    44    38    44    32    44    35    44    31    43    30    42    29    42    29    42    29    42    27    40    26    40    26    40    22    39    24    39    20    39    21    37    22    36    20    36    19    36    20    36    20    33    20    32    17    30    17    29    15    28    15    27    16    27    15    26    15    25    15    24    15    21    13    19    13    17    14    15    11    14    12    14    12    14    12    15    10    13    10    13    10    13    10    13    10    12    10    12    10    12    10    12     9    11     9    11     8    11     9    11     8    11     9    11     9    11     8    11     7    11     7    11     7    11     6    11     4    12     7    11     6    11     5     9     5     9     5     9     3     9     5     8     5     8     4     7     4     6     4     6     4     6     3     5     2     5     2     5     2     5     2     5     2     5     2     4     2     4     2     4     3     5     3     5     4     6     4     6     4     7     6     9     6     9     7    10     7     9     7     8     7     8     6     9     6     9     6    10     8    10     7    10     7    10     9    12     7    14     9    14     6    17     6    18     6    19     6    19     6    20     6    20     7    22     7    22     8    23     7    24     9    27    10    28    10    29    10    29    12    30    12    30    13    31    13    31    13    31    13    31    13    31    13    31    13    32    14    34    14    36    15    37    20    37    22    37    21    38    22    38    23    40    23    40    23    41    24    41    24    41    24    39    23    39    17    38    22    38    23    38    23    38    21    36    22    36    22    37    20    38    21    38    21    38    19    38    18    38    19    38    19    38    18    40    16    40    17    40    16    40    15    40    16    40    14    39    12    39    14    39    12    37    11    36     9    36    10    37    10    37     9    37     9    37     9    27     8    26     8    23     7    15     7    12     6    10     6     8     3     5     3     4     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5
  5   1   2       e>1                            Xl3.1-IMAGE:6641854.5                                         TCCTCACCCTCCGATTGGTTGGACACCGATCGTCGGGCCAAATACGAACAGACAGCTGGAAACCGATCGGGCTTGTGGCCCAGACAGCTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGCCTCTACGAAGCTCAACGACCGCTCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGCACCATTTCGGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAACCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCGTCCTTATTTACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATCCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCCCCAGAGCAGACGTATTACTTCGACACATTGACCGCTCTGAACTTCGCTGCCAAATCCAAGCAGATCATTAACAAGCCTTTCAGCCGGGAAACCACCCAGACCGTGGCTCAGCCAGCCATGAAGAGGCCCAGGGAGGAAGCAGAGCACATAGCCGGTTCTCAGAAAAGAAAGAAATCCAAAACTGACTCCACAGAGTCGTCTCCCAATTCTTCAATGGAATCGACGGGCAAACGGAAACTCAATTTGGCTTCGCTGGATTCCGCTGTGGTAGAGAGGCTGCTGAAACTGGATAAGATCCTGACAGAGAAGGGAAAGAAGGAGGCGCAGCTCTTGAGCACCCCCAAGAGAGAGCGAATGGCACTGCTGAAGAAATGGGAGGAAAGTCAGATGGAGATCGAGAGACTAAAGGAGAAGCAAAAGGAGCTGGAGCAGAAAGCGATGGAAGCAGAGGCTCGACTGGAGAAATCCAATAACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCAGAGGCAGAAACACA
  5   1   2       e>1                            Xl3.1-IMAGE:7296972.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAATAACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCAGAGGCAGAAACACATCCACAGCGAAGGTCAAGAAAGTGCTGCGTGTACTGCCCATGCAGGGGAACAGCCAGTTACAAAGCACCGTAGAGGAGGGGATCCCTGTTTTTGAGAAGAAGAAAAAGAAGAAACAGGTCACATGTGAGGGGCTTGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACAGGCTCAGTAAAGGAACTGAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCCTTTTAAAAATGTGGAAGAGTTGGCGTGTTTGGAAGGAATCTCTGCTAAACAAGTATCGTCCTTTATAAAGGCAAATATCATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGGCTGCGGCCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTCCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGTGCCAACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGTTTTTTTTTGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTGTGTGTGTGTCTGTGTGTGTTTGTGTGTGTGTGTATGTGTCTCTTGAGTGACTGCCCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAATATATATATATACTCCTTACCCCATGTGCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTATATTCTTCCAAATCAAGTCCATGTCTTTCTGTAAAATAAACGTTTTTGGTTTTTTTTAAACATATATTCTCCAGTTTCTTATGAAAGTTCACATTTCACAGTATCGGGGACATGCAAGGTTGGGTGTGTGTTCAGAAGAAGCTGGGGGAGACGCTCGGAATAAATACATTCTCTACCTCCTAGTTCTCTTCTCCCCATTCTCTCTTTCTGTTGTAAAAGCAGCAGTATCTTTTTCTTTCAGAATTCCTCTTCTTTTTGAGCTCTGTTAAAATTCTGTGTTCTATTTAAAGGGGAACTATCGCGAAAATGAAAATTTAATACAATCTTCATCATAGTGAAGTA
  5   1   2       e50                               Xl3.1-XL417b13ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATAACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCCGAGGCAGAAACACATCCACAGCGAAGGTCAAGAAGGTGCTGCGTGTGCTGCCCATGCAGGGAAACAGCCAATTACAGAGCACCATAGAGGAGGGGATCCCAGTCTTTGAGAAGAAGAAAAAGAAACAGGTCACATGTGATGGGCATGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACCGGCTCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTGATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTATTCCAAAAAATCCATGTCTTTGTGAAATAAAACAGTTTGGT
  5  -1   2      2-75                            Xl3.1-IMAGE:7296384.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACGTGAATGACAGAGACGACTGCTGAGAGCGCAGAGAGATCTGAATACTCACACGGCTCGTAAGAACTCAATCCTGCAGAGATCGAGACAGAAGGCCAAGCTGATATCGGCTGAGAGAGTCAATGGGCTCTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCAGGCTGAGACCTGTGACATCATCAGGCTGTGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCCTGAGTGAATGGCTGCCCCAATGGGGTGAATGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTAGAAGTTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACCAATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCACGTTATTCCAAAAAATCCATGTCTTTGTGAAATAAAACAGTTTGGTTTTTTTTTTTTAAAAAAAAAAAAAAAAACTCGAGGGGGGCCCGTACCCAATCGCCTTAGATCCCCGG
                                                                   VAR                                                                 GCACGCCTCACC
                                                                   VAR                                                                             GCTTGCGGGGCC
                                                                   VAR                                                                                         AGGAGAGACTGT
                                                                   VAR                                                                                                     GGCGGAAGTTGGAGAGTTTGAGTTCCAGCTGAGGGTGAATATTGTATCGTGCGCTCGACTGCAGAGCGTGGTTATTAGTGTTCGAGAGTCCGAAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                 GCGACCACAGTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCACAACCAGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACAGGTCACATGTGATGGGCATGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACTACTCAACACAGGCTCAGTAAAGGAACTGAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCCTTTTAAAAATGTGGAAGAGTTGGCGTGTTTGGAAGGAATCTCTGCTAAACAAGTATCGTCCTTTATAAAGGCAAATATCATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGGCTGCGGCCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTCCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGTGCCAACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGTTTTTTTTTGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTGTGTGTGTGTCTGTGTGTGTTTGTGTGTGTGTGTATGTGTCTCTTGAGTGACTGCCCCAGTGGGGTGAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGTGGCTGCAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAATATATATATATACTCCTTACCCCATGTGCTTCAGCAGCATTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCGTTATTCCAAAAAATCCATGTCTTTGTGAAATAAAACAGTTTGGT
                                                                   SNP                                                                                                                                                                                                     ---G--------
                                                                   SNP                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                     ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                 -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                         -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                     --T----C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                         -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --CA--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----T-----A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----G------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----A------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----A-----A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----T-----A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --C--------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----G-C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T--T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----A-------
                                               BLH ATG     153     337                                                     
                                               BLH MIN     114     278                                                     
                                               BLH MPR     114     278                                                     
                                               BLH OVR     153      33                                                     
                                               EST CLI      62      21                                                     
                                               ORF LNG     153       6                                                     
  5   1   2       e>1                            Xl3.1-IMAGE:6641854.5                                         TCCTCACCCTCCGATTGGTTGGACACCGATCGTCGGGCCAAATACGAACAGACAGCTGGAAACCGATCGGGCTTGTGGCCCAGACAGCTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGCCTCTACGAAGCTCAACGACCGCTCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGCACCATTTCGGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAACCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCGTCCTTATTTACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATCCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCCCCAGAGCAGACGTATTACTTCGACACATTGACCGCTCTGAACTTCGCTGCCAAATCCAAGCAGATCATTAACAAGCCTTTCAGCCGGGAAACCACCCAGACCGTGGCTCAGCCAGCCATGAAGAGGCCCAGGGAGGAAGCAGAGCACATAGCCGGTTCTCAGAAAAGAAAGAAATCCAAAACTGACTCCACAGAGTCGTCTCCCAATTCTTCAATGGAATCGACGGGCAAACGGAAACTCAATTTGGCTTCGCTGGATTCCGCTGTGGTAGAGAGGCTGCTGAAACTGGATAAGATCCTGACAGAGAAGGGAAAGAAGGAGGCGCAGCTCTTGAGCACCCCCAAGAGAGAGCGAATGGCACTGCTGAAGAAATGGGAGGAAAGTCAGATGGAGATCGAGAGACTAAAGGAGAAGCAAAAGGAGCTGGAGCAGAAAGCGATGGAAGCAGAGGCTCGACTGGAGAAATCCAATAACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCAGAGGCAGAAACACA
                                                  Xl3.1-CHK-1012686300                                               CCCTCCGATTGGTTGGACxCxxxxCxxxxxGCCAAATACGAAxxGAxAGxxxGxAACCGATCGGGCTTGTGGxxxxxxCxxxxxGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGCCTCTACxAAxCTCAACGACCGATCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGCACCATTTCGGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAACCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCGTCCTTATTTACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATCCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCCCCAGAGCAGACGTATTACTTCGACACATTGACCGCTCTGAACTTCGCTGCCAAATCCAAGCAGATCATTAACAAGCCTTTCAGCCGGGAAACCACCCAGACCGTGGCTCAGCCAGCCATGAAGAGGCCCAGGGAGGAAxCAGxxCACATAGCCGGTTCTCAGCAAAGAAAGAAATCCAAAACTGACTCCACAGAGTCGTCTCCCAATTCTTCAATGGAATCGACGGGCAAACGGAAACTCAATTTGGCTTCGCTGGATTCCGCTGTGGTAGAGAGGCTGCTGAAACTGGATAAGATCCTGACAGAGAAGGGAAAGAAGGAGGCGCAGCTCTTGAGCACCCCCAAGAGAGAGCGAATGGCACTGCTGAAGAAATGGGAGGAAAGTCAGATGGAGATCGAGAGACTAAAGGAGAAGCAAAAGGAGCTGGAGCAGAAAGCGATGGAAGCAGAGGCTCGACTGGAGAAATCCAATAACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCAGAGGCAGAAACACATCCACA
  5   1   2       bld Ov1  5g                         IMAGE:6318639.5p CGGTTCTCGCCTTCCTATTGGTTGGTTGCAAGCTTGGCCGCCAAATACGAAAGGAGATACAGTAACCGATCGTCGGGCTTGCGGGGCCCAGACAGCTGGAGGCGGAAGTTGGAGAGTTTGAGTTCCAGCTGAGGGTGAATATTGTATCGTGCGCTCGACTGCAGAGCGTGGTTATTAGTGTTCGAGAGTCCGAAGCGAGGCGGGAATGGTTCTTACTGGGCCTCTCCAAAGAGAGTCGGTGAGTATGGCGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGATGAGAAGGATGAAGCTAAAGCGACCACAGTGTGTGTCAGGGGCCTGGACTCTCAGTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGNGGCAGGGAAAACTCACACAATGCTGGGGAACCCCAATCAGCCTGGTGTGATCCCTCGGGCTGNTAGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATANACATGTCATATGTGGAGATTTACCAGGGAGAGGTCATGGATCTGCTGGAGCCAAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCAAAAAATGATCCATTNCTTTTGCAGATTTCNGATGAGCATTTTATCCCCTGCCAGGTCAGAACCCGTACCCGTGGCCCTCTACGAAGGCTCAATGGACGGATCCCAGTCGGCAGCCCACGCCCGGGGT
  5   1   2       bld Oo1  5g                         IMAGE:6643063.5p     CCTCGTTTGTGCGTGAGGCTTGGTCCACGTGAAAGATCCTCACCCTCCGATTGGTTGGACGCACGCCTCACCGCCAAATACGAAAGGAGAGACTGTAACCGATCGGGCTTGTGGCCCAGACAGCTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTTATGTGGAGATTTACCAGGAGAAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGGATCCCGGGCGTGACCCTAAAACTATCAATTCCCTTTTTGGAGATTTCGATGCGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGGCCTTCAACAAACTCAACGACC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074322.5p         GACCCACGCGTCCGCTTGGTCCACTTGAAAGATCCTCATCCTCCGATTGGTTGGACGCACGCCTCACCGCCAAATACGAAAGGAGAGACTGTAACCGATCGGGCTTGTGGCCCAGACAGCTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGAGGGCGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCTGTTAGAGACTTG
  5   1   2       bld Thy  5g                         IMAGE:8549722.5p          CCTGTTTTNNNNGAGCACCGAAAGAATTGTCCCCAATACGAAAGGAGATACAGTAACCGATCGTCGGGCTTGCGGGGCCCAGACAGCTGGAGGCGGAAGTTGGAGAGTTTGAGTTCCAGCTGAGGGTGAATATTGTATCGTGCGCTCGACTGCAGAGCGTGGTTATTAGTGTTCGAGAGTCCGAAGCGAGGCGGGAATGGTTCTTACTGGGCCTCTCCAAAGAGAGTCGGTGAGTATGGCGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGATGAGAAGGATGAAGCTAAAGCGACCACAGTGTGTGTCAGGGGCCTGGACTCTCAGTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCACACAATGCTGGGGAACCCCAATCAGCCTGGTGTGATCCCTCGGGCTGTTAGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGAGATTACCAGGAGAAGTCATGATCTGCTGGAGCCAAGAACAAGACCTCCCATCCGAGAGACAAGACATACATCTGATCCGGGCGTGACAAAATGATCATCTTTGCGATTCGATGACTTTATCTGCAGTCGACGTACGTGCTCACAGCTAT
  5   1   2       bld DMZ  5g3  in                         xl320p05.5p                                 GTGAAAGATCCTCACCCTCCGATTGGTTGGACGCACGCCTCACCGCCAAATACGAAAGGAGAGACTGTAACCGATCGGGCTTGTGGCCCAGACAGCTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGAGGGCGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCA
  5   1   2       bld Oo1                             IMAGE:5078750.5p                                               CTGGACCGGTCCGGAATTTTCGGGATCACCGCCAAATACGAAAGGAGATACCGTAACCGATCGGGCTTGTGGCCCAGACAGCTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGAGGGCGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCCGGCCGTTTAGGGAATTGCTGCAGATGGACCCGGATGGCGGCCCGTGCCCCCTGAGAATGAGAACTGGACTTATACCATAACCCATGTTCTTATGGGGAGAATTACCAGGACAAAGGTCATGGGACCCTGCTGAAGCCCCAAAAACAAGGGCCCTCCCCCTTCCCGGGGAGGACCAATGACCCTAAGCCTTCNCTGGATCCCGCGGGGGGGCACCCTAGAGAACTTATACACTGCTTTTCGGGAGAAATCCCAAAAAATGTCTGAACTTGGGCGAACCTCCCCAGGGGGTACGGAAATACACTTTTTCCTGGGGACCCCTCCCCCGAGGCGCGAACAGAGCTTcccccccccccGAGGCGTCATGATAAGGGGTCCTGCCCAGGGCTTCACGCCTGCTATGGAAACACTGCGCCATTGTTTTGGCCCAACN
  5   1   2       bld Emb1 5g                         IMAGE:6635341.5p                                                             AGTAACCGATCGTCGGGCTTGCGGGGCCCAGACAGCTGGAGGCGGAAGTTGGAGAGTTTGAGTTCCAGCTGAGGGTGAATATTGTATCGTGCGCTCGACTGCAGAGCGTGGTTATTAGTGTTCGAGAGTCCGAAGCGAGGCGGGAATGGTTCTTACTGGGCCTCTCCAAAGAGAGTCGGTGAGTATGGCGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGATGAGAAGGATGAAGCTAAAGCGACCACAGTGTGTGTCAGGGGCCTGGACTCTCAGTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCACACAATGCTGGGGAACCCCAATCAGCCTGGTGTGATCCCTCGGGCTGTTAGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGAGATTTACCAGNGAGAAGGTCATGGATCTGCTGGAGCCAAAGAACAAAGACCTCCCCATCCCGAGAGACAAAGACCATAACATCCTGATCCCCGGGCGTGACCCCAAAAATGATCAATTTCTTTTGCCAGATTTCCATGAAGCCATTTTATCCCCTGGCCAGTCAAGAACCCGCTACCCGTGGGCCCTTCTACGAAAGGCTCCAATGAACCCGATT
  5   1   2       bld DMZ  5g                              xl317m24.5p                                                             AGTAACCGATCGTCGGGCTTGCGGGGCCCAGACAGCTGGAGGCGGAAGTTGGAGAGTTTGAGTTCCAGCTGAGGGTGAATATTGTATCGTGCGCTCGACTGCAGAGCGTGGTTATTAGTGTTCGAGAGTCCGAAGCGAGGCGGGAATGGTTCTTACTGGGCCTCTCCAAAGAGAGTCGGTGAGTATGGCGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGATGAGAAGGATGAAGCTAAAGCGACCACAGTGTGTGTCAGGGGCCTGGACTCTCAGTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCACACAATGCTGGGGAACCCCAATCAGCCTGGTGTGATCCCTCGGGCTGTTAGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGANCCAAAGAACAAAGAC
  5   1   2       bld Emb4 5g                         IMAGE:5514677.5p                                                                       CTCACCGCCAAATACCAATGGAGAGACTGTAACCGATCGGGCTTGTGGCCCAGACAGCTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCTCAGAACAAGGACCTCCCCATCCGAGAGGACAAN
  5   1   2       bld Egg3 5g                         IMAGE:6326501.5p                                                                         GGTCGATTCCCGGGCGAAGGAGAGATCTAACCGATCGGGCTTGTGGCCCAGACAGCTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGAGGGCGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACAATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGCCTCAACCAAACTCAACGACCGCTCCAGTCGCAGCCACGCTGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGCACCAT
  5   1   2       bld Oo1  5g                         IMAGE:6643090.5p                                                                                   CGGGGCCCGACAGCTGGAGGCGGAAGTTGGAGAGTTTGAGTTCCAGCTGAGGGTGAATATTGTATCGTGCGCTCGACTGCAGAGCGTGGTTATTAGTGTTCGAGAGTCCGAAGCGAGGCGGGAATGGTTCTTACTGGGCCTCTCCAAAGAGAGTCGGTGAGTATGGCGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGATGAGAAGGATGAAGCTAAAGCGACCACAGTGTGTGTCAGGGGCCTGGACTCTCAGTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCACACAATGCTGGGGAACCCCAATCAGCCTGGTGTGATCCCTCGGGCTGTTAGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCAAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCAAAAAATGATCAATTCTTTTGCAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGTACCGTGGCCTCTACGAAGCTCAATGACCGATCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGGTCAGAAGAGTCAGCAGGGGGGTACCATTTTCGGCAGCTGA
  5   1   2       add Ga18      in                      xlk112j21ex.5p                                                                                       GGGCCAGACAGCTGGNGNNAAGTTGGAGAGTTTGAGTTCCAGCTGAGGGTGAATATTGTATCGTGCGCTCGACTGCAGNNNNGGTTATTAGTGTTCGAGAGTCCGAAGCGANNNNNAATGGTTCTTACTGGGCCTCTCCAAAGAGAGTCGGTGAGTATGGNGAAGGGTGAGCATNNNGNNTCAGCACAAGAAGNCCTCCTGTGCC
  5   1   2       bld Spl  5g3  in                    IMAGE:8464208.5p                                                                                          GGAGAGACTGTAACCGATCGGGCTTGTGGCCCAGACAGCTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAAACCAAGACCTCCCCATCCGAGAAGACAAAGACCTAACATCCTGATCCGGGCGTGACCTAAAACTATCATTCTTTTGAGATTCGAGCGCTTTTATCCCGCG
  5   1   2       bld Oo1  5g                         IMAGE:5084473.5p                                                                                                CTGGACCGGTCCGGATTCCCGGGATCAGACAGCTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAAGAAGGTCATGGAATCTGCTTGGAGCCCCAAGAACAAAGGACCTCCCCATCCGAAGAGGACCAAAGAACCTTAACCTCCCTGATTCCCGGGGCGTGGACCCCTTAAAAAACTATCCAATTTCCTTTTTAAAGATTTTCCCATTGAACATTTTTTAATTCCCTGCCCAATTCAGAAAACCGCCAACGGTTGTGCCCTTCAAACCCAAAAT
  5   1   2       bld Oo1  5g                         IMAGE:6641854.5p                                                                                                   TGGTACCGGTCCGGAATTTTCGGGATCAGCTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGGCTCAACCAAACTCAACGACCGCTTCAGTCGCAGCCACGCTGTGTTACTGATCAAGGTCCCAGAAGAGTCAGCAGGTGGGCACCATTTCCGCAGCTGATTTGGAAAGCTCTACCTGATAGGACTTGGCCTGGATCAGGAAGATAACCGGCGCACGGGAAACCCAAGGAATCCT
  5   1   2       bld Emb4 5g                         IMAGE:5570939.5p                                                                                                      ACCGATCGGGCTTGTGGCCCAGACAGCTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGNCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCCAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCCATGAACATTTTATCCCTGCCAGTCAGAACCGGACCGGGGGCCTCAACCCAACTCAACGACCCTTCCCAGTCCCAGCCACGCTTGTGGTTACCGGATCAAGGGC
  5   1   2       bld Oo1  5g                         IMAGE:6861104.5p                                                                                                      TGCGATGTTGGAGAGTTTGAGTTCCAGCTGACGGTGAATATTGTATCGTGCGCTCGACTGCAGAGCGTGGTTATTAGTGTTCGAGAGTCCGAAGCGAGGCGGGAATGGTTCTTACTGGGCCTCTCCAAAGAGAGTCGGTGAGTATGGCGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGATGAGAAGGATGAAGCTAAAGCGACCACAGTGTGTGTCAGGGGCCTGGACTCTCAGTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCACACAATGCTGGGGAACCCCAATCAGCCTGGTGTGATCCCTCGGGCTGTTAGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCAAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCANAAAATGATTCATTCTTTTGCAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAAACCGTACCGTGGGCCTCTACGAAGCTCAATTGACCGATCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGGTCCAAAAAAGTCAGCAAGGTGGTACCATTTTCGGCCAGCTTGAATGGAAAGCTCTAACCTTGATGGACC
  5   1   2       chi Oo1                             IMAGE:6861820.5p                                                                                                        GGAAGTTGGAGAGTTTGAGTTCCAGCTGAGGGTGAATATTGTATCGTGCGCTCGACTGCAGAGCGTGGTTATTAGTGTTCGAGAGTCCGAAGCGAGGCGGGAATGGTTCTTACTGGGCCTCTCCAAAGAGAGTCGGTGAGTATGGCGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGATGAGAAGGATGAAGCTAAAGCGACCACAGTGTGTGTCAGGGGCCTGGACTCTCAGTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCACACAATGCTGGGGAACCCCAATCAGCCTGGTGTGATCCCTCGGGCTGTTAGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGGAGATTTACCAGGAGAAAGGGCATGGGATTCTGCTGGAAGCCCAAAGAAACAAAGGACCCTCCCCCCATCCGAAGAGGGACAAAAGACCCATTAACCTTTCCCTGAATTCCCCGGGGCCGTTGAACCCCCaaaaaaaaTGGATCCCAATTTCCTTTTTGGCCAGAAATTTTTCGAAATGAGAGCCCATTTTTTAATA
  5   1   2       bld Oo1  5g                         IMAGE:6640824.5p                                                                                                                   AGTTTGAGTTCCAGCTGAGGGTGAATATTGTATCGTGCGCTCGACTGCAGAGCGTGGTTATTAGTGTTCGAGAGTCCGAAGCGAGGCGGGAATGGTTCTTACTGGGCCTCTCCAAAGAGAGTCGGTGAGTATGGCGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGATGAGAAGGATGAAGCTAAAGCGACCACAGTGTGTGTCAGGGGCCTGGACTCTCAGTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCACACAATGCTGGGGAACCCCAATCAGCCTGGTGTGATCCCTCGGGCTGTTAGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCAAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCAAAAAATGATCAATTCTTTTGCAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAAACGTACCGTGGGCCTCTACGAAGCTTCATGACCGATCCAGTCGCAGCCACGCCGTGTTTACTGATCCAAGGTCCAGAAGAATTCACCAGGGTGGTACCATTTTCCGCAGGCTGACTGGAAAGCTCTACCTGATTAAACTTTGGCTTGGATCCGAAAGATAATCCGC
  5   1   2       bld Oo1  5g                         IMAGE:6860914.5p                                                                                                                   CGGCTGGTCCGGTCCGGAATTCTCCGGATGGAGCGTTGAGGATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGNCCTCAACCAAACTCAACGACCGCTCCAGTCGCAGCCACGCTGTGTTACTGATCAAGGTCCCAGAAGAGTCAGCAGGTGGCACCATTTTCGGCAGCTGATTGGGAAGCTCTACCTGATAGACCTTGGCTGGATCAGAAGATTACN
  5   1   2       bld Thy  5g                         IMAGE:8549281.5p                                                                                                                   AGTTTGAGTTCCAGCTGAGGGTGAATATTGTATCGTGCGCTCGACTGCAGAGCGTGGTTATTAGTGTTCGAGAGTCCGAAGCGAGGCGGGAATGGTTCTTACTGGGCCTCTCCAAAGAGAGTCGGTGAGTATGGCGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGATGAGAAGGATGAAGCTAAAGCGACCACAGTGTGTGTCAGGGGCCTGGACTCTCAGTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCACACAATGCTGGGGAACCCCAATCAGCCTGGTGTGATCCCTCGGGCTGTTAGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGAGATTTACCAAGAGAAGGTCATGGATCTGCTGGAGCCAAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACATTACATCCTGATCCCGGGCGTGACCCAAAAATGATCAATTCTTTGCAGATTCGATGAGCATTTATCCTGCCAGTCGAACCTACCGGGCCTCTCGAACTCATGACGATCATTCCAGCCCGCTGGCTTT
  5   1   2      seed Oo1  5g                         IMAGE:6644004.5p                                                                                                                      CTGGACCGGTCCGGATTCCTTGCATGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGCGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGCCTCAACCAAACTCAACGACCGCTCCAGTCGCAGCCACGCTGTGTTACTGATCAAGTCCAGAAGAGTCAGCAGGTGGCACCATTTCGGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATACC
  5   1   2       add Ga18 5g3  in                      xlk113c14ex.5p                                                                                                                       AGNNNGAGTTCCAGCTGAGGGTGAATATTGTATCGTGCGCTCGACTGCNGNNNNGGTTATTAGTGTTCGAGAGTCCGAAGCGAGGNGGAATGGTTCTTACTGGGCCTCTCCAAAGAGAGTCGGTGAGTATGGNGAAGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGNNNTCAGACTGAGGCCCTACATGGATGAGAAGGATGAAGCTAAAGCGACCACAGTGTGTGTCAGGGGCCTGGACTCTCAGTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGANCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTTTTTTTGCTTATGGTCCCACGGGGGCNGGGAAAACTCACACAATGCTGGGGGAANCCCNATCAGCCTNGNGTGANCCCTCNGNCTNG
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073697.5p                                                                                                                        CCACGCGTCCGCGGACGCGTGGGGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATG
  5   1   2       bld Ga18      in                      xlk127n17ex.5p                                                                                                                        TGGCCCAGACAGCTGGNNNNCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGAGGGCGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTNNNNTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCANNNNNGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAANCCTGATCAGCCTGGAGTGATCCCTCGGGCCGNTAGGAATTGCTGCAGATGACCCGGATGGCGGCCAGNNCCCCTGAGAATGAGAACTGGACTTATACCATAACAATGTCTTATGTGGAGATTTACCAGGAGAAGGNCATGGATCTGCTGGANNCCAAGAACAAAGANCTCCCCATNCNAGAGACAAAGACCATNACATCCTGATCCCGGGCGNNACCCTAAAACTATNAANTCTTTTGGAGATTNGATGNGCATTTT
  5   1   2       bld Ov1       in                    IMAGE:8328433.5p                                                                                                                           GACAGCTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGAGGGCGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCTGTTAGAGACTTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACAATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAC
  5   1   2       bld Emb4 5g3  in                    IMAGE:4203587.5p                                                                                                                            CACGCGTCCGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGNAGATTGTCACTGGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTATGGGGGCAGTGCCCATCAGCGTGAGATCTACATGGCCTTTTGGTGCAAAATTTCCCGACTTACTATTTGGCCAAAACGCCAGGGTTTTGGTTATGGTCCCCCGGGGCCGGGGAAAATTATCCAATGCTGGGAAACCCTAACAACCGGGAGTGACCCCTTGGCCC
  5   1   2       bld Ga10 5g                         IMAGE:3558079.5p                                                                                                                            ACAGCTGGNGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCTGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGNGCCAGNCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGNGNTNNNGCTTATGGNCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGGAACCC
  5   1   2       bld Oo1  5g                         IMAGE:6641933.5p                                                                                                                                CTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCCTGCAGTCAGAACCGCACCCGTGGGCCTCACCAAACTCAACGACCGCTCCAGTCGCAGCCACGCTGTGTTACTGATCCAGGGTCCAGAAAGAGTCAGCAAGGTGGCACCATTTTCGGCAGCTTGATTGGAAAAGCTCTACCCCTGGATAGACTTGGNCTGGATCGAAGAAACC
  5   1   2       bld Oo1  5g                         IMAGE:6643173.5p                                                                                                                                CTGGAGGCGGCAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTTGGAGATTTCGATGCGCATTTTATCCCTGCCAGTCAGAAACGCACCGTGGCCTCAACCAAACTCAACGACCGCTCCAGTCGCAGCCACGCTGTGTTTACTGATCAAGGGTCCAGAAGGAGTCAGCAGGGTGGCACCATTTTCGGCAGGCTGAATTGGAAAGCTCTACCTGAATAGAACTTGGNCTGGGATCAAA
  5   1   2       bld DMZ  5g3  in                         xl278b01.5p                                                                                                                                   GAGGCGGNAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGNGAATGGTTCTTACTGGGCCTCCCCAAAGANAGTCGGTGAGTATGGTGAAGAGGGCGAGCATGTTGGATCANCACAANAAGTCCTCCTGTGCCCGGNTGCGTGTANCCNTCANACTGANGCCCTACNTGNANGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCANCTGNAGAAACCANCTGGAGACCATGCANTACCANTTTGATGCATTTTATGGGGACAGTGCCAGTCANCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCNCGCACTTACTCNTTGG
  5   1   2       bld Ga18      in                      xlk101h05ex.5p                                                                                                                                    TGGAGNNNCAATTGGAGCGTTGAGGAATCAGCTGAGGGGNTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTNNNNTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCNCNNNTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACAGGNCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGAATTGCTGCAGATGACCCGGATGCGGCCAGTGNCCCTGAGAATGAGAACTGGACTTATACCATAACAATGTCTTATGTGGAGATTTACCANGAGAAGGTCATGGATCTNCTGGAGNCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCNTGCCAGTCAGAACNNNNCGTGGNCTC
  5   1   2       bld Ov1  5g                         IMAGE:5048363.5p                                                                                                                                          CAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGGGGAGATT
  5   1   2       bld Oo1  5g                         IMAGE:5085176.5p                                                                                                                                          CAATTGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCCTTTTGGAGATTTCGATGCGCATTTTATCCCTGCCAGTCAGAAACGCACCGTGGCCTCAACCAAACTCAACGACCGCTCCAGTCGCAGCCACGCTGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTTGGCACCCATTTCCGCCAGCTGGATTGGAAAAGCTCCTACCTGATAGAACTTGGGCCTGGGATTCAGAAAAATAACCCGGCGCCACCTGGGAAACCCCAGGC
  5   1   2       bld Tbd7 5g3  in                         XL066d05.5p                                                                                                                                              GGGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGAGGGCGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACAATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAG
  5   1   2       bld DMZ  5g3  in                         xl280m22.5p                                                                                                                                               GGAGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGAGGGCGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACAGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACAATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATT
  5   1   2       bld Thy  5g3  in                    IMAGE:8546496.5p                                                                                                                                                 AGCGTTGAGGAATCAGCTGAGGGGCTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGAGGGCGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGACGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCATCTGGAGACCATGCAGTACCAATTTGATGCATTTTATGGGGACAGTGCCATTCAACGTGAGATCTTCATGGGTGCTGTGTGCCTCGTTCTCCCGCACTTACTCATTGGCTAGAACGCCGGTGATTTTGCTTATGGAACGCCTGGGTCATGGTATACTAATACTATGCTTTTG
  5   1   2       bld Ga15 5g                            XL424i03ex.5p                                                                                                                                                                       CGTGGTTATTAGTGTTCGAGAGTCCGAAGCGAGGCGGGAATGGTTCTTACTGGGCCTCTCCAAAGAGAGTCGGTGAGTATGGCGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGATGAGAAGGATGAAGCTAAAGCGACCACAGTGTGTGTCAGGGGCCTGGACTCTCAGTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCACACAATGCTGGGGAACCCCAATCAGCCTGGTGTGATCCCTCGGGCTGTTAGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCAAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCAAAAAATGATCAATTCTTTTGCAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGTACCGTGGCCTCTACGAAGCTCAATGACCGATCCAGTCGCAGCCACGCCGTGTTACTGATCAAGG
  5   1   2       bld Emb4 5g                         IMAGE:5542525.5p                                                                                                                                                                         CTTTATTGTTCGGTCTATTCCAGCGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTNTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAAACGCACCGTGGCCTCAACCAAACTCAACGACCGCTCCCGTCGCAGCCACGCTGTGTTACTGATCAAGGGCCAGAAGAGTCAGCAGGGTGGGCACATTTTCCGGCAGCTGATTTGGAAAAGCTCCTACCTGATAAAAACTTGGGCTTGGATCCAAAAAGATAACCCGGGCGCCCCTGGGAAAACCCAAGGGAAT
  5   1   2       bld Oo1  5g                         IMAGE:6641148.5p                                                                                                                                                                                                CGCGTGAGTCGGGAATGGTTCTTACTGGGCCTCCCCAAAGAGAGTCGGTGAGTATGGTGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGTGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTNTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGCCTCAACCAAACTCAACGACCGCTCCAGTCGCAGCCACGCTGTGTTACTGATCAAGGGTCAGAAGAGTCAGCAGGTGGCACCATTTCGGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCCTGGATCAGAAGATAACCGGCGCACTGGAAAACAAGGAATCGAACTTAAAGGGAGAGTGGAGGCCATTACCTCGTCCCTTATTACGCTCCCCCCAAAATTGGTGGGATTGCTCTGAAACCCAG
  5   1   2       bld Ga14                              Ga14-p12c12.5p                                                                                                                                                                                                                  TCTTACTGGGCCTCNCCAAAGAGAGTCGGTGAGTATGGCGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTNAGCCGTCAGACTGAGGCCCTACATGGATGAGAAGGATGAAGCTAAAGCGACCATAGTGTGTGTCAGGGGCCTGGACTCTCAGTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGGTCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCACACAATGCT
  5   1   2       bld Oo1                             IMAGE:6856772.5p                                                                                                                                                                                                                                                        GCGAAGCGGGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGATGAGAAGGATGAAGCTAAAGCGACCACAGTGTGTGTCAGGGGCCTGGACTCTCAGTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCACACAATGCTGGGGAACCCCAATCAGCCTGGTGTGATCCCTCGGGCTGTTAGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCAAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCAAAAAATGATCAATTCTTTTGCAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGTACCGTGGCCTCTACGAAGCTCAATGACCGATCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGTACCATTTCGGCAGCTGACTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAATCGGCGCACTGGAAACCAAGGGATCCGACTAAAGGAAAGTGGAGCCATTAACTCGTCCTTATTTCCCCTCAGGCAAAGTGGTGGATGCTCTGAACCAGGGGCCTGCC
  5   1   2       bld Oo1                             IMAGE:3403810.5p                                                                                                                                                                                                                                                                GGTGAGCATGTTGGATCAGCACAAGAAGTCCTCCTGTGCCCGGGTGCGTGTAGCCGTCAGACTGAGGCCCTACATGGATGAGAAAGATGAAGCTAAAGCGACCACAGTGTGTGTCATGGGCCTGGACTCTCACTTGCTGGAGATTGTCAGCTGGACAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTATATGGGGACAGCGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTGCTTGCTTATGGTCCTACGGGGGCATGGAAAACTTACACAATTGCTGTGAACTCCATATAGCCTGGTGTGATCCCGTCGGCTGTTAGAGACTTGCTGCGGATGAGACCGACATGTAACAGTGCCCATGAGAATGAAAACTGGACTTATACCTTGTATTTGTTATAT
  3  -1   2       bld Bla2      in                    IMAGE:7296384.3p                                                                                                                                                                                                                                                                                                                                  GCCCTACATGGAGGAGAAGGAGGAAGATAAAGTGCCCACGGCGTGTGTCAGGGGCCTGGACTCTCACTCGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGCGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACAGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACGATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCTGCTAGTCAGAACCGCACCGTGGCCTCAACCAAACTCAACGACCGCTCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGCACCATTTCGGCAGCTGATTGGAAAGCTCTACC
  5   1   2       bld Ooc2                            IMAGE:3746719.5p                                                                                                                                                                                                                                                                                                                                                                                                      CGCTGGAGATTGTCAACTGGAGAAACCAGCTGGAGACCATGCAGTACCAGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGGTCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCACACAATGCTGGGGAACCACAATCAGCCTGGTGTGATCCCTCGGGCTGTTAGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCAAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCANAAAATGATCAATTCTTTTGCAGATNTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGTACCGTGGCCTCTACGAAGCTCAATGACCGATCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGTNCAGAGAGTCAGCAGG
  5   1   2       bld DMZ  5x3  out                        xl335o12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCCCTCTCTACACAGGTTTGATGCATTTTATGGGGACAGCGCCAGTCAGCGTGAGATCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCACACAATGCTGGGGAACCCCAATCAGCCTGGTGTGATCCCTCGGGCTGTTAGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCAAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCAAAAAATGATCAATTCTTTTGCAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGTACCGTGGCCTCTACGAAGCTCAATGACCGATCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGTACCATTTCGGCAGCTGACTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAATCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCCTCCTTATTCACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCCGAATTCCATACAGAGACAGCAAGCTGACGAGACTGCTGCA
  5   1   2       bld Oo1                             IMAGE:6638374.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGACAAAGAGGCTGGTACCGGTCCGGATTCTTCGATTAATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCATACAATGCTGGGGAACCCTGATCAGCCTGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGCCTCAACCAAACTCAACGACCGCTCCAGTCGCAGCCACGCTGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGCACCATTTCGGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAACCGGCGCACTGGAAACCAAGGAATCCGACTANAGGAGAGTGGAGCCATTAACTCGTCCTTATTTACGCTCAGCANAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCCGAATCCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCCCCAGAGCAGACGTATTACTTCGACACATTGACCGCTCTGAACTTCGCTGCCAAATCCAAGCAGATCATTAACAAGGCCTTTCAGCCGGGGAAACCACCCAGAAACGTGGCTCAGCCAGCCATGAAAGAGGGCCCAGGGNAGGAAGCAGAAGGCCACAACCCAGGTTCTCGGGCAAAAGAAAGAAAATCC
  5   1   2       bld Tbd7      in                         XL109h13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTCAGCGTGAGGTCTACATGGGCTCTGTGTGCCACATTCTCCCGCACTTACTCATTGGCCAGAACGCCAGTGTTTTTGCTTATGGTCCCACGGGGGCAGGGAAAACTCACACAATGCTGGGGAACCACAATCAGCCTGGTGTGATCCCTCGGGCTGTTAGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCAAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCAAAAAATGATCAATTCTTTTGCAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGTACCGTGGCCTCTACGAAGCTCAATGACCGATCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGTACCATTTCGGCAGCTGACTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAATCGGCGCACTGGAAACC
  5   1   2       bld Oo1                    IMAGE:6638374-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAACCCTCGATCAGCCTCGGAGTGATCCCTCGGGCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGCCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGCCTCAACCAAACTCAACGACCGCTCCAGTCGCAGCCACGCTGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGCACCATTTCGGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAACCGGCGCACTGGAAACCAAGGAATCCCACTAAAGGAGAGTGGAGCCATTAACTCGT
  5   1   2       bld Oo1                             IMAGE:5084063.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGCCTCAACCAAACTCAACGACCGCTCCAGTCGCAGCCACGCTGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGCACCATTTCGGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAACCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCGTCCTTATTTACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATCCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAAGCGCCCACAGTGTTAATGAATCACTTAACATTCNCCCCCAGAAACCAGAACCGTATTTAACTTTTCGAACCACATTTGGACCCGGCTTCCTGGAAACTTTTCCGCCTGGCCCCAAAAATTCCCCAAAAGGCAAGGAATTCCCCTTTTAAAACCCAAAGAGGCCCCtttttttttccaaggccccgggggggggaaaaaaaaccccccccACC
  5   1   2       bld Oo1                             IMAGE:5084194.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCGTTAGGGAATTGCTGCAGATGACCCGGATGGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGCCTCAACCAAACTCAACGACCGCTCCAGTCGCAGCCACGCTGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGCACCATTTCGGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAACCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCGTCCTTATTTACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATCCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCCCCAGAGCAGACGTATTACTTCGACACATTGACCGCTCTGAACTTCGCTGCCAAATCCAAGCAGATCATTAACAAGCCTTTTCGCCGGGAAACCACCCAGACCGTGGGCTCAGCCCAGCCGTGAAAGAAGCCCCGGGGAGGGAAACAAGAAGGCCACCAACCCCGGTTTCCCCGGGCaaaagaaaagaaaaatcccaaaaaaCTGGGACTTCTCACCAGAAGGTCCGTTTCTTCCCCCAAATTTCCTTTCACAATGGGGAAATTCCCGCACCT
  5   1   2       bld Ga12      in                         XL146g21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAGACTTGCTGCAGATGAGCCGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCAAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCAAAAAAATGATCAATTCTTTTGCAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGTACCGTGGCCTCTACGAAGCTCAATGACCGATCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGTACCATTTCGGCAGCTGACTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAATCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCCTCCTTATTCACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATTCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCC
  5   1   2       bld Ga15      in                       XL478k03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGACAGCGGCCAGTGCCCCTGAGAATGAGAACTGGACTTATACCATAAACATGTCATATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCAAAGAACAAAGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCAAAAAAATGATCAATTCTTTTGCAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGTACCGTGGCCTCTACGAAGCTCAATGACCGATCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGTACCATTTCGGCAGCTGACTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAATCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCGTCCTTATTCACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATTCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCCCCAGAGCAGACGTATTACTTCGACACATTGACGGCTCTGAACTTCGCTGCTAAATCCAAGCAGATCATTAACAAGCCTTTCAGCCAGGAAACCACCCAGACCGTGGTTCAGCCAGCCATGAAGAGGCCCAGGGAGGAAACAGGCCACATAGCCGGTTCTCAGAAAAGAAAGAAATCCAAAAAATGACTCCACTGAGTCGTCTCCCAATTCATCAATGGACACAGCGGGCAAACAGAA
  5   1   2       bld DMZ       in                         xl259j14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATAACCATGTCTTATGTGGAGATTTACCAGGAGAAGGTCATGGATCTGCTGGAGCCCAAGAACAAGGACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCTAAAAACTATCAATTCTTTTGGAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGCACCGTGGCCTCAACCAAACTCAACGACCGCTCCAGTCGCAGCCACGCTGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGCACCATTTCGGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAACCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCGTCCTTATTTACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATCCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCCCCAGAGCAGACGTATTACTTCGACACATTGACCGCTCTGAACTTCGCTGCCAAATCCAAGCAGATCATTAACAAGCCTTTCAGCCGGGAAACCACCCAGACCGTGGCTCAGCCAGCCATGAAGAGGCCCAGGGAGGAAGCAGAGGCCACAACCAGTTCTCGGCAA
  5   1   2       bld Oo1                             IMAGE:6639933.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCTCCCCATCCGAGAGGACAAAGACCATAACATCCTGATCCCGGGCGTGACCCaaaaaaaaTGATCAATTCTTTTGCAGATTTCGATGAGCATTTTATCCCTGCCAGTCAGAACCGTACCGTGGCCTCTACGAAGCTCAATGACCGATCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGTACCATTTCGGCAGCTGACTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAATCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCCTCCTTATTCACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATTCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCCCCAGAGCAGACGTATTACTTCGACACATTGACGGCTCTGAACTTCGCTGCTAAATCCAAGCAGATCATTAACAAGCCTTTCAGCCAGGAAACCACCCAGACCGTGGTTCAGCCAGCCATGAAGAGGCCCAGGGGAGAAACAGGCCACATAGCCGGTTCTCAGAAAAGAAAGAATCCANAATGACTCCACTGAGTCGTCTCCCATTTCATCATGGACACAGCGGGCAAACAGAAAACTCATTTGGNCACGCTGGATCCCCGCTGNGGGTAAAGAGGCTGCTGAAAACTGGNATAAGATCCNTGACCCGAGAAAGGGAAAAGAGAAAGGCCCNNAGCTCTTTTGAGCACCCCCANGAGAAAACCGAATGGCCACTGCCTGNANNAAAAATGGGGGAGGGAAAGTTCCCGAAATGGGGAAATCCGGAGAGAACCTAaagggggaaaacgccaaaaaggggccctcggaagcccaaaaaaacgcaaattggaaaccccaaaaaGCCCTCCCCACTTGGGGAA
  5   1   2       bld Emb1                            IMAGE:6864499.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACGCGTGGGCGGACGCGTGGGATTTTATCCCTGCCAGTCAGAACCGTACCGTGGCCTCTACGAAGCTCAATGACCGATCCAGTCGCAGCCACGCCGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGTACCATTTCGGCAGCTGACTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAATCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCGTCCTTATTCACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATTCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCCCCAGAGCAGACGTATTACTTCGACACATTGACGGCTCTGAACTTCGCTGCTAAATCCAAGCAGATCATTAACAAGCCTTTCAGCCAGGAAACCACCCAGACCGTGGTTCAGCCAGCCATGAAGAGGCCCAGGGAGGAAACAGGCCACATAGCCGGTTCTCAGAAAAGAAAGAAATCCAAAAATGACTCCACTGAGTCGTCTCCCAATTCATCAATGGACACAGCGGGCAAACAGAAACTCAATTTGGCAACGCTGGATCCCCGCTGTGGTAGAGAGGCTGCTGAAACTGGATAAGATCCTGAACCGAAAACGGAAAGAAGAATGCCCAGCTCTTGAGCACCCCCCAGAGAGAGCGAATGGCACTGCTGAAGAAATGGGGAAGAAAGTCATATGGGAGATCGGAGAGACTTAAAGGGAGAAGCACAAAGGGAGCCTGGGAACATAATAAGCGGATGGGAAAGCACAAAGCCTCCGAACTGGTAGGAAAATCCCCAATAACCTCTC
  3   1   2       bld Ov1       in                    IMAGE:8328433.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGCACCGGGCCTCAACCAAACTCAACGACCGCTCCAGTCGCAGCCACGCTGTGTTACTGATCAAGGTCCAGAAGAGTCAGCAGGTGGCACCATTTCGGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAACCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCGTCCTTATTTACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATCCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCCCCAGAGCAGACGTATTACTTCGACACATTGACCGCTCTGAACTTCGCTGCCAAATCCAAGCAGATCATTAACAAGCCTTTCAGCCGGGAAACCACCCAGACCGTGGCTCAGCCAGCCATGAAGAGGCCCAGGGAGGAAGCAGAGGCCACAACCAGTTCTCGGCAAAGAAAGAAATCCAAAACTGACTCCACAGAGTCGTCTCCCAATTCTTCAATGGAATCGACGGGCAAACGGAAACTCAATTTGGCTTCGCTGGATTCCGCTGTGGTAGAGAGGCTGCTGAAACTGGATAAGATCCTGACAAAAAAAAAAAAAAAG
  5   1   2       bld Ga18      in                      xlk107i09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAAGTCCAGAAGAGTCAGCAGGTGGNACCATTTCGGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAACCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCGTCCTTATTTACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATCCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCCCCAGAGCAGACGTATTACTTCGACACATTGACCGCTCTGAACTTCGCTGCCAAATCCAAGCAGATCATTAACAAGCCTTTCAGCCGGGAAACCACCCAGACCGTGGCTCAGCCAGCCATGAAGAGGCCCAGGGAGGAAGCAGAGNNCACAACCAGTTCTCGGCAAAGAAAGAAATCCAAAACTGACTCCACAGAGTCGTCTCCCAATTCTTCAATGGAATCGACGGGCAAACGGAAACTCAATTTGGCTTCGCTGGATTCCGCTGTGGTAGAGAGGCTGCTGAAACTGGATAAGATCCTNACAGAGAAGGGAAAGAAGGAGNNNNNGTCTTGAGCACCCCCAAGAGAGAGCGAATNNNACTGCTGAAGAAATGG
  5   1   2       bld Oo1                             IMAGE:6639180.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCAGCTGATTGGAAAGCTCTACCTGATAGACTTGGCTGGATCAGAAGATAACCGGCGCACTGGAAACCAAGGAATCCGACTAAAGGAGAGTGGAGCCATTAACTCGTCCTTATTTACGCTCAGCAAAGTGGTGGATGCTCTGAACCAGGGGCTGCCCCGAATCCCATACAGAGACAGCAAGCTGACGAGACTGCTGCAGGATTCCCTGGGAGGAAGCGCCCACAGTGTTATGATCACTAACATCGCCCCAGAGCAGACGTATTACTTCGACACATTGACCGCTCTGAACTTCGCTGCCAAATCCAAGCAGATCATTAACAAGCCTTTCAGCCGGGAAACCACCCAGACCGTGGCTCAGCCAGCCATGAAGAGGCCCAGGGAGGAAGCAGAGGCCACAACCAGTTCTCGGCAAAGAAAGAAATCCAAAACTGACTCCACAGAGTCGTCTCCCAATTCTTCAATGGAATCGACGGGCAAACGGAAACTCAATTTGGCTTCGCTGGATTCCGCTGTGGTAGAGAGGCTGCTGAAACTGGATAAGATCCTGACAGAGAAGGGAAAGAAGGAGGCGCAGCTCTTGAGCACCCCCAAGAGAGAGCGAATGGCACTGCTGAAGAAATGGGAGGAAAGTCAGATGGAGATCGAGAGACTAAAGGAGAAGCAAAAGGAGCTGGAGCAGAAAGCAATGGAAGCAGAGGCTCGACTGGAGAAATCCAATAACTCTGACCTGTCAGACTCCAGTGTCAGTGGAAACACTTTCCGGGCCCCTCTCCGAGGCAGAAACACATCCCACAGCGAAGTCAAGAAAGGTGCTGGCGTGTGCTGCCCATGCAGGGGAAACAGCCCAATTACAGNAAGCACCATAGAAGGGAGGGGNATCCCCAGTTCTTT
  5   1   2       add Ga14                               Ga14-p17h9.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ANNCAGGGGTCTGCCCCGAATTCCATACAGAGACAGCANNGCTGACGAGACTGCTGCAGGATTCCCTGTGGAGGAAGCGCCCACAGTGTTATGATCACTATCATCGCCCCAGAGCAGACGTNTTACTTCGACACATTGACGGTTCTGAACTTCGCTGCTAAATCCANGCATCTCATTAACAAGCCTTTCAGCCATTGAAACCACCCAGACCGTGGTTCAGCCAGCCATGAAGAGGCCCAGGGAAGGAAACAGGCCACATAGCCGGTTCTCAGANANNAAAGAAATCCAAAAATGACTCCACTGAGTCGTCTCCCAGTTCATCAATGGACACAGCGGGCAAACAGAAACTCAATTTGGCAA
  3  -1   2       add Bla2      in                    IMAGE:7296972.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGAAACAGGCCACATAGCCGGTTCTCAGAAAAGAAAGAAATCCAAAAATGACTCCACTGAGTCGTCTCCCAATTCATCAATGGACACAGCGGGCAAACAGAAACTCAATTTGGCAACGCTGGATCCCGCTGTGGTAGAGAGGCTGCTGAAACTGGATAAGATCCTGACCGAGAAGGGAAAGAAGAAGGCCCAGCTCTTGAGCACCCCCAAGAGAGAGCGAATGGCACTGCTGAAGAAATGGGAGGAAAGTCAGATGGAGATCGAGAGACTAAAGGAGAAGCAAAAGGAGCTGGAGCAGAAAGCGATGGAAGCAGAGGCTCGACTGGAGAAATCCAATAACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCAGAGGCAGAAACACATCCACAGCGAAGGTCAAGAAAGTGCTGCGTGTACTGCCCATGCAGGGGAACAGCCAGTTACAAAGCACCGTAGAGGAGGGGATCTCTGTTTTTGAGAAGAAGAAAAAGAAGAAACAGGTCACATGTGAGGGGCTTGAGAACCAGCCCACGTGGGAAATGACATGAGGACGACCTGCTTGAAGCGGCAGGAGAGATCCTGAACTACTCACACAGCTCAGTAAGGACTGAATCCTGCAGAGATCGAGACAGAAGCANCTGATATGGCTGAGAGATCATGGCTTTAAATGTGAGAGTGCGTGTTGAAGACCTGCTACATACTCTTTAAGCATACGACACTCCGCGACTGCTC
  5   1   2       e>1                            Xl3.1-IMAGE:7296972.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAATAACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCAGAGGCAGAAACACATCCACAGCGAAGGTCAAGAAAGTGCTGCGTGTACTGCCCATGCAGGGGAACAGCCAGTTACAAAGCACCGTAGAGGAGGGGATCCCTGTTTTTGAGAAGAAGAAAAAGAAGAAACAGGTCACATGTGAGGGGCTTGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACAGGCTCAGTAAAGGAACTGAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCCTTTTAAAAATGTGGAAGAGTTGGCGTGTTTGGAAGGAATCTCTGCTAAACAAGTATCGTCCTTTATAAAGGCAAATATCATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGGCTGCGGCCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTCCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGTGCCAACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGTTTTTTTTTGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTGTGTGTGTGTCTGTGTGTGTTTGTGTGTGTGTGTATGTGTCTCTTGAGTGACTGCCCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAATATATATATATACTCCTTACCCCATGTGCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTATATTCTTCCAAATCAAGTCCATGTCTTTCTGTAAAATAAACGTTTTTGGTTTTTTTTAAACATATATTCTCCAGTTTCTTATGAAAGTTCACATTTCACAGTATCGGGGACATGCAAGGTTGGGTGTGTGTTCAGAAGAAGCTGGGGGAGACGCTCGGAATAAATACATTCTCTACCTCCTAGTTCTCTTCTCCCCATTCTCTCTTTCTGTTGTAAAAGCAGCAGTATCTTTTTCTTTCAGAATTCCTCTTCTTTTTGAGCTCTGTTAAAATTCTGTGTTCTATTTAAAGGGGAACTATCGCGAAAATGAAAATTTAATACAATCTTCATCATAGTGAAGTA
                                                  Xl3.1-CHK-1012689052                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCAGAGGCAGAAACACATCCACAGCGAAGGTCAAGAAAGTGCTGCGTGTACTGCCCATGCAGGGGAACAGCCAGTTACAAAGCACCGTAGAGGAGGGGATCCCTGTTTTTGAGAAGAAGAAAAAGAAGAAACAGGTCACATGTGAGGGGCTTGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACAGGCTCAGTAAAGGAACTGAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCCTTTTAAAAATGTGGAAGAGTTGGCGTGTTTGGAAGGAATCTCTGCTAAACAAGTATCGTCCTTTATAAAGGCAAATATCATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGGCTGCGGCCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTCCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGTGCCAACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGTTTTTTTTTxxATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTGTGTGTGTGTCTGTGTGTGTTTGTGTGTGTGTGTATGTGTCTCTTGAGTGACTGCCCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAATATATATATATACTCCTTACCCCATGTGCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTATATTCTTCCAAATCAAGTCCATGTCTTTCTGTAAAATAAACGTTTTTGGTTTTTTTTAAACATATATTCTCCAGTTTCTTATGAAAGTTCACATTTCACAGTATCGGGGACATGCAAGGTTGGGTGTGTGTTCAGAAGAAGCTGGGGGAGACGCTCGGAATAAATACATTCTCTACCTCCTAGTTCTCTTCTCCCCATTCTCTCTTTCTGTTGTAAAAGCAGCAGTATCTTTTTCTTTCAGAATTCCTCTTCTTTTTGAGCTCTGTTAAAATTCTGTGTTCTATTTAAAGGGGAACTATCGCGAAAATGAAAATTTAATAGAATCTTCATCATAGTGAAGTAAGAAAG
  5   1   2       bld Ga12      in                         XL192e20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCTGGAGCAGAAAGCGATGGAAGCAGAGGCTCGACTGGAGAAATCCAATAACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCAGAGGCAGAAACACATCCACAGCGAAGGTCAAGAAAGTGCTGCGTGTACTGCCCATGCAGGGGAACAGCCAGTTACAAAGCACCGTAGAGGAGGGGATCCCTGTTTTTGAGAAGAAGAAAAAGAAGAAACAGGTCACATGTGAGGGGCTTGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACAGGCTCAGTAAAGGAACTGAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCCTTTTAAAAATGTGGAAGAGTTGGCGTGTTTGGAAGGAATCTCTGCTAAACAAGTATCGTCCTTTATAAAGGCAAATATCATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGGCTGCGGCCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTCCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGANGC
  5   1   2       bld Neu5                              Neu5-82E14A.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAATAACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCAGAGGCAGAAACACATCCACAGCGAAGGTCAAGAAAGTGCTGCGTGTACTGCCCATGCAGGGGAACAGCCAGTTACAAAGCACCGTAGAGGAGGGGATCCCCGTTTTTGAGAAGAAGAAAAAGAAGAAACAGGTCACATGCGAGGGGCTTGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACGGGCTCAGTAAAGGAACTGAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCCTTTTAAAAATGTGGGAGAGTTGGCGTGTTTGGAAGGAATCTCTGCTAAACAAGTATCGTCCTTTATAAAGGCAAATATCATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGGCTGCGGCCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTCCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTTGAGGCAAGTTTGGCTTGTTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGTGCCAACCGGGCCGCTTGGATTGTTTTGTTAAAGTGAGTTCAAACGCCGAAGACTTTGGGTTTAAAAGGttttttttttGCATTTGTAATGTTCACAATTTTAATTCTACTATTTTAATTATGAGCCtgtttgtggttgtgtgtgtgtgtttattgtgGTCCTTTTTGGAGTGGAACTTGGCCCCAATGGGGGGTGGAAATTGAATGGCTTGCCAATTGTGGGTTTGGGCaaaaaaaaaataaccagtttttcccttgcttggggggggAGGGCCCCAACCTTTGAAACCCCTGGGCTTCCTGGGGGAAAAAtttttattttttAACTCCCCTTAACCCCCATGTGCTTTTAAAGTTTTACTTGGATTCACCTTTT
  5   1   2       bld Ga18      in                      xlk121d23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCAGAGGCAGAAACACATCCACAGCGAAGGTCAAGAAAGTGCTGCGTGTACTGCCCATGCAGGGGAACAGCCAGTTACAAAGCACCGTAGAGGAGGGGATCCCTGTTTTTGAGAAGAAGAAAAAGAAGAAACAGGTCACATGTGAGGGGCTTGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACAGGCTCAGTAAAGGAACTGAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCCTTTTAAAAATGTGGAAGAGTTGGCGTGTTTGGAAGGAATCTCTGCTAAACAAGTATCGTCCTTTATAAAGGCAAATATCATGAGCAGCATNNNNGCTGAAACCTGTACCATCATCAGGCTGCGNNCCGGGTCATACACGCTCCAAGGGCCACTGANTTTATTCCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGNNTAAATCTNA
  5   1   2      seed Egg1                               PBX0046F05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACGAGGCGTGTACTGCCCATGCAGGGGAACAGCCAGTTACAAAGCACCGTAGAGGAGGGGATCCCTGTTTTTGAGAAGAAGAAAAAGAAGAAACAGGTCACATGTGAGGGGCTTGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACAGGCTCAGTAAAGGAACTGAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCCTTTTAAAAATGTGGAAGAGTTGGCGTGTTTGGAAGGAATCTCTGCTAAACAAGTATCGTCCTTTATAAAGGCAAATATCATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGGCTGCGGCCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTCCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGTGCCAACCGGCCGCTGGATGTTTT
  3   1   2       add Ga18                             rxlk158a21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACGCGTGGGNGGNCGCGTGGGGAAAAAGAAGAAACAGNTCACATGCGAGGGGCTTGAGANCCAGCCCNCGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAANCTACTCAACACAGGCTCAGTAAAGGAACTGAAATCCCTGCAGAGGATCGGAGACAAGAAGNNCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGNCCTTTTAAAAATGTGGAAGAGTTAGCGTGTTTGGAAGGAATCTCTGCTAAACAAGTATCGTCCTTTATAAAGGCAAATATCATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGGCTGCGGNCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTCCTCNCCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGNNNNACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGTTTTTTTTTTGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTCTGTGTTTGTGTGTGTGTGTGTGTATGTGTCTCTTGAGTGACTGCCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAATATATATATATATACTCCTTACCCCATNNCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTATANTCTTCCAANTCAANNCCNNT
  3   1   2       add Ga18      in                      xlk121d23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNNGNAAANGNAGNNACAGGTCACATNNGAGGGGCTTGANNNCCNGCCCNCGTNGGAAATGNACATGAGGACAGNCCTGCTTNAGANNNGCAAGNAGAGAATCCTGAAACTACTCAACACAGGCTCAGTAAAGGAACTGAAATCCCTGCAGAGGATCGGAGACAAGNANNCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCCTTTTAAAAATGTGGAAGAGTTGGCGTGTTTGGAAGGAATCTCTGCTAAACAAGTATCGTCCTTTATAAAGGCAAATATCATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGGCTGCGGCCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTCCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGNNNNACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTTTTTTGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTGTGTGTGTGTCTGTGTGTGTTTGTGTGTGTGTGTATGTGTCTCTTGAGTGACTGNCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAATATATATATATACTCCTTACCCCANNNCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTATNTTCTTCCAANTCAANNCC
  3   1   2       add Ga18 5g3  in                      xlk113c14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ANNNAANCNGNTNANNTNNNNANGGGGCNTTGANNANCAGCCNNCNTNGGAAANGNACNTGAGGANNANACCTGCTTGANAGCNGCAAGGANAGANNCCTGNAACTACTCAACNNGGGCTCAGTAAAGGANCTGAAATCCCTGNAGAGGNTNGGAGACNAAGAAGNCNNAGCTGATTATTGNCTGNAGAGAAGTCNAATGGNNNTTTTAAAAATGTGGAAGAGTTGGCGTGTTTGGAAGGAATCTCTGCTAAACAAGTATCGTNCTTTATAAAGGCNNNNATCATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGNCTGCGGCCCGGGTCATACACGCTCCAAGGGCCACTGATTTTNTTCCTCACCAACANCTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGTNCCAACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGTTTTTTTTTTGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTCTGTGTGTGTGTGTGTCTGTGTGTGTTTGTGTGTGTGTGTATGTGTCTCTTGAGTGACTGCCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAATATATATATATATATATATACTCCTTACCCCATNNCTNCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTATTATNTTCTTCCAANTCAANNCCNNTC
  3   1   2       add Ga18      in                      xlk112j21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGNNNTNAGNNCCNGCCCNCGNNGGAATGAACNNGAGGACAGANCNGCTTGAGAGNGGNANGNAGAGNATCCTGNAACTNCTCAACACGGGCTCAGNNAAGGNNCTGAAATNCCTGCAGAGNATCGGAGACAAGAAGNCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGNCCTTTTAAAATGTGGNAGAGTTGGCGTGTTNNGAAGGANTCTCTGCTAAACAAGTATCGTCCTTTATAAAGGCAAATATCATGAGCANNATCGCCAGCTGAAACCTGTACCATCATCAGGCTGCGGCCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTNCTCNCCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATNNNNNACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGTTTTTTTTTTGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTCTGTGTGTGTGTGTGTCTGTGTGTGTTTGTGTGTGTGTGTATGTGTCTCTTGAGTGACTGNCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAATATATATATATATATATATACTCCTTACCCCATGTNCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTATTATATTCTTCCAANTCAAGNCC
  5  -1   2       bld Emb4                            IMAGE:4970600.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCTGGAGGCTGGACAGCCACGTGAAAGACAGAGACGACTGCTGAGACGCAAGAGAGATCTGAACTACTCACACGGCTCAGTAAGGACTGAAATNCCTGCAGAGATCGGAGACAAGAGGCCAAGCTGATTATTGCTGGGAGAGAAGTCAATGGGCCTTTTAAAAATGTGGAAGAGTTGGCGTGTTTGGAAGGAATCTCTGCTAAACAAGTATCGTCCTTTATAAAGGCAAATATCATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGGCTGCGGCCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTCCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGTGCCAACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGttttttttttGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTCtgtgtgtgtgtgtgtgtgtgtctgtgtgtgtttgtgtgtgtgtgtatgtgtCTCTTGAGTGACTGCCCCATGTGGGGTGAATGAGTGGCTGCAATTGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACTATTGAAACCACTGGCTCCTGTGTAAatatatatatatatatatatataCTCCTTACCCCATGTGCTTCAGCATGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTATTATATCTTCCAAATCAAGTCCATTCTTCGAAAAAAAGAA
  5   1   2       bld Emb1                            IMAGE:6634176.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACAGGCTCAGTAAAGGAACTGAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCCTTTTAAAAATGTGGAAGAGTTGGCGTGTTTGGAAGGAATCTCTGCTAAACAAGTATCGTCCTTTATAAAGGCAAATATGATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGGCTGCGGCCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTCCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGTGCCAACCGGCCGCTGGATGTGTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGttttttttttGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTCtgtgtttgtgtgtgtgtgtgtgtatgtgtCTCTTGAGTGACTGCCCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAatatatatatatataCTCCTTACCCCATGTGCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCGGGTNGTTTTATATTCTTCCCAATCAAGTCCATGTCTTTCTGTAAAATAAACGttttttgggtttttttAAACCTATATTCTCCCGGTTTCCTTATGAAAAGGTCAACATTTTCCCAGGTATT
  5  -1   2       bld Bla2      in                    IMAGE:7296972.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCCTGAAAATATTCCAACACAGGTCCAGTAAAGGAACTGAAATCCTTGCAGAGGATCGGAGACAAGAAGGCCAAGTTGATTTTTGGCTGGAGAGAAGTCAATGGGCCTTTTAAAAATGTGGAAGAGTTGGCGTGTTTGGAAGGAATCTCTGCTAAACAAGTATCGTCCTTTATAAAGGCAAATATCATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGGCTGCGGCCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTCCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGTGCCAACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGtttttttttGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCtgtgtgtgtgtgtctgtgtgtgtttgtgtgtgtgtgtatgtgtCTCTTGAGTGACTGCCCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAatatatatatataCTCCTTACCCCATGTGCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTATATTCTTCCAAATCAAGTCCATGTCTTTCTGTAAAATAAACGtttttggttttttttaaacaaaaaaaaaaaaaaaaaaaa
  3   1   2       add Ga18      ?                        xlk61f04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATNCCTGNNGAGGNTCGGNNGACAAGNAAGNNCAAGCTGNTNTNNNCTGNAGAGAAGTCAANNGNCCTTTTAAAANGTGGAAGAGTTGGCGTGTTNGGANGGAATCTCTGCTNNCAAGTATNGTCCTTTATAANGGCAAATATCATGAGCNNNATCGCCAGCTGAANCCTGTACCATCATCAGGCTGCGGNCCGGGTCATACACGCTCCAAGGGCCNCNGNTTTTATTCCTCNCCAACANCTTNNNNTCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGTNCCAACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGTTTTTTTTTTGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTCTGTGTGTGTGTGTGTCTGTGTGTGTTTGTGTGTGTGTGTATGTGTCTCTTGAGTGACTGNCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAATATATATATATATATATATACTCCTTACCCCATGTNCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTATTATATTCTTCCAANTCAAGNCCnnnnnnnnGTAA
  3   1   2       bld Ga12      in                         XL192e20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GNTAAACAAGTATCGTCCNTTATAAAGGCAAATATCATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGGGTGCGGNCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTCNTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATNTGAGGCAAGTTTGGCTGTTTTTGCNCCAGCCCCCTGCAAACACGAACCAAATGTGCCAACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGTTTTTTTTTGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTGTGTGTGTGTCTGTGTGTGTTTGTGTGTGTGTGTATGTGTCTCTTGAGTGACTGCCCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAATATATATATATACTCCTTACCCCATGTGCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTATATTCTTCCAAATCAA
  3   1   2       add Ga18      in                       xlk52g10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGGCAAATATCATGAGCAGCATCGCCAGCTGAAACCTGTACCATCATCAGNCTGCGGCCCGGGTCATACACGCTCCAAGGNCCNCTGATTTTATTCCTCNCCAACANCTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATNNNNAACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGTTTTTTTTTGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTGTGTGTGTGTCTGTGTGTGTTTGTGTGTGTGTGTATGTGTCTCTTGAGTGACTGCCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAATATATATATATACTCCTTACCCCATGTNCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTATATTCNTCCAANTCAANNCCNNT
  5   1   2       bld Ga18      in                       xlk52g10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATATCATGAGCAGCATNNNNGCTGAAACCTGTACCATCATCAGGCTGCGGCCGGGTCATACACGCTCCAAGGGCCACTGATTTTATTCCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGTGCCAACCGNNCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGtttttttttGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCtgtgtgtgtgtgtctgtgtgtgtttgtgtgtgtgtgtatgtgtCTCTTGAGTGACTGCCCCAGTGGGGTGAATGAGTGGNTGCAATGTGGTTTGGCAGAGAAGTAACANTAGTTTCCATGCTGTGTGAGGNACCAACATTGAAACCACTGGCTCCTGTGTAAatatatatatataCTCCTTACCCCATGTGCTTCANNAGCATTTACTGCAGTCACATTGCAGGAAGGNTCTGCTGGTGTTTTTATATTCTTCCAAATCAAGTCCATGTCTTTCTGTAAATNAACGTTTTTGNNTTTTTT
  3   1   2       bld Tbd7      in                         XL109h13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACACGCTCCAAGGGCCACTGATTTTATTCCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTCTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGTGCCAACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGTTTTTTTTTGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTGTGTGTGTGTCTGTGTGTGTTTGTGTGTGTGTGTATGTGTCTCTTGAGTGACTGCCCCAGTGGGGTGAATGAGTGNCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAATATATATATATACTCCTTACCCCATGTGCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTACTGCTGGTGTTTTTATATTCTTCCAAATCAAGTCCATGTCTT
  3   1   2       bld Ga12      in                         XL146g21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTCACCAACAACTTGAAATCCCTGAGCTCCTTATGGCAAAACTNTGAAGTGTAAATCTGAGGCAAGTTTGGCTGTTTTTGCACCAGCCCCCTGCAAACACGAACCAAATGTGCCAACCGGCCGCTGGATGTTTTGTTAAAGTGAGTTCAACGCCGAGACTCTGGTTTAAAGGTTTTTTTTTTGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTTTGTGTGTGTGTGTGTGTGTATGTGTCTCTTGAGTGACTGCCCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTAAACCACTGGCTCCTGTGTAAATATATATATATACTCCTTACCCCATGTGCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTAATTCTTCCAAATCAAGTCCAT
  3   1   2       bld Neu7                                 XL025o18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTTTTTTTTTTGCATTTGTAATGTTCACATTTTATTCTACTATTTTATTATGAGCCTGTCTGTGTGTGTGTGTGTCTGTGTGTGTTTGTGTGTGTGTGTATGTGTCTCTTGAGTGACTGCCCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAATATATATATATATATATATACTCCTTACCCCATGTGCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTATTATATTCTTCCAAATCAAGTCCATGTCTTTCTGTAAAATAAACGTTTTTGGTTTTTTTTAAACATATATTCTCCAGTTTCTTATGAAAGTTCACATTTCACAGTATCGGGGACATGCAAGGTTGGGTGTGTGTTCAGAAGAAGCTGGGGGAGACGCTCGGAATAAATACATTCTCTACCTCCTAGTTCTCTTCTCCCCATTCTCTCTTTCTGTTGTAAAAGCAGCAGTATCTTTTTCTTTCAGAATTCCTCTTCTTTTTGAGCTCTGTTAAAATTCTGTGTTCTATTTAAAGGGGAACTATCGCGAAAATGAAAATTTAATAGAATCATCTTCATCATAGTGAAGTAAGAAAGTTTCNAATACAACTAAATAAAAG
  3   1   2       add Ga15      in                       XL478k03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTTTTTGCANTTGTAANATNCACANTTTATTNTACTCTTTTATTATGAGCCCGTCTGTGTGTGTGnGTGTCTGTGTGTGTTTGnGTGTGTGTGTATGTGTCTCTTGAGNGACTGCCCCAGTGGGGNGAATGAGTGGCTGCAATGTCGTTTGNCAGAGAAGTAACANTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCNGTGTAAATATATATATATATATATATACTCCTTACCCCATGTGCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCNGGTGTTATTATATTCTTCCAAAT
  5   1   2       bld Ga15      in                       XL488p07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      tgtgtttgtgtgtgtgtgtatgtgtCTCTTGAGTGACTGCCCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAatatatatatataCTCCTTACCCCATGTGCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTATATTCTTCCAAATCAAGTCCATGTCTTTCTGTAAAATAAACGtttttggttttttttAAACATATATTCTCCAGTTTCTTATGAAAGTTCACATTTCACAGTATCGGGGACATGCAAGGTTGGGTGTGTGTTCAGAAGAAGCTGGGGGAGACGCTCGGAATAAATACATTCTCTACCTCCTAGTTCTCTTCTCCCCATTCTCTCTTTCTGTTGTAAAAGCAGCAGTATCTTTTTCTTTCANAATTCCTCTTCTTTTTGAGCTCTGTTAAAATTCTGTGTTCTATTTAAAGGGGAACTATCGCGAAAATGAAAATTTAATACAATCTTCATCATAGTGAAGTAAGAAAGTTTCTGAATACAACTGAAATAAAAGTTCTAAAATCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL488p07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTGTTTGTGTGnGTGTGTATGTGTCTCTTGAGTGACTGCCCCAGTGGGGTGAATGAGTGGCTGCAATGTGGTTTGGCAGAGAAGTAACAGTAGTTTCCATGCTGTGTGAGGCACCAACATTGAAACCACTGGCTCCTGTGTAAATATATATATATACTCCTTACCCCATGTGCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTATATTCTTCCAAATCAAGTCCATGTCTTTCTGTAAAATAAACGTTTTTGGTTTTTTTTAAACATATATTCTCCAGTTTCTTATGAAAGTTCACATTTCACAGTATCGGGGACATGCAAGGTTGGGTGTGTGTTCAGAAGAAGCTGGGGGAGACGCTCGGAATAAATACATTCTCTACCTCCTAGTTCTCTTCTCCCCATTCTCTCTTTCTGTTGTAAAAGCAGCAGTATCTTTTTCTTTCAGAATTCCTCTTCTTTTTGAGCTCTGTTAAAATTCTGTGTTCTATTTAAAGGGGAACTATCGCGAAAATGAAAATTTAATAGAATCTTCATCATAGTGAAGTAAGAAAGTT
  3   1   2       bld Ov1                             IMAGE:4055126.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATATATATACTCCTTACCCCATGTGCTTCAGCAGCATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTATATTCTTCCAAATCAAGTCCATGTCTTTCTGTAAAATAAACGTTTTTGGTTTTTTTTAAAAAAA
  5   1   2       bld Ov1                             IMAGE:8331388.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATTTACTGCAGTCACATTGCAGGAAGGTTCTGCTGGTGTTTTTATATTCTTCCAAATCAAGTCCATGTCTTTCTGTAAAATAAACGTTTTTGGTTTTTTTTaaaaaaaaaaaaaaaaaaaaG
  5   1   2       e50                               Xl3.1-XL417b13ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATAACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCCGAGGCAGAAACACATCCACAGCGAAGGTCAAGAAGGTGCTGCGTGTGCTGCCCATGCAGGGAAACAGCCAATTACAGAGCACCATAGAGGAGGGGATCCCAGTCTTTGAGAAGAAGAAAAAGAAACAGGTCACATGTGATGGGCATGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACCGGCTCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTGATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTATTCCAAAAAATCCATGTCTTTGTGAAATAAAACAGTTTGGT
                                                  Xl3.1-CHK-1012688959                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCCGAGGCAGAAACACATCCACAGCGAAGGTCAAGAAGGTGCTGCGTGTGCTGCCCATGCAGGGAAACAGCCAATTACAGAGCACCATAGAGGAGGGGATCCCAGTCTTTGAGAAGAAGAAAAAGAAACAGGTCACATGTGATGGGCATGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACCGGCTCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTGATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTATTCCAAAAAATCCATGTCTTTGTGAAATAAAACAGTTTGGTTTTTTT
  5   1   2       bld DMZ                                  xl295m19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTAAAGGAGAAGCAAAAGGAGCTGGAGCAGAAAGCAATGGAAGCAGAGGCTCGACTGGAGAAATCCAATAACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCCGAGGCAGAAACACATCCACAGCGAAGGTCAAGAAGGTGCTGCGTGTGCTGCCCATGCAGGGAAACAGCCAATTACAGAGCACCATAGAGGAGGGGATCCCAGTCTTTGAGAAGAAGAAAAAGAAACAGGTCACATGTGATGGGCATGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACCGGCTCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGA
  3   1   2       add Ga18      in                      xlk101h05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GNCTGNNNNAATCCNANACTCTGNCCTNTNAGNCTNCAGTGTCAGNNNAAACNCTTNNNGGGNNNNNNCGAGGNAGAAACACNTCCACNGCNNAGNTCANGNANGGTNCNGNGTGTNCNGCCCATGCAGGGAAACANCNAATTACAGAGCNCCATAGAGGAGGGGNTCCCAGTCTTTGAGAAGAAGAAAAAGAAACAGNTCACATGTGATGGGCATGAGANCCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAANCTACTCAACNCCGGCTCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGNNCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGNNNTGTNNNNTCNTNAGNCTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTNCCAATCGGCCGCTGGAGTGAGTNNAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTNNNNNNNATGACTGCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATATATTTTACTAATTATCCACCCATTNCCCACAATNNTNCGGCAGCCTGAACTGCAGGTGTTGGGTCNCGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTNTTCCAAAAA
  5   1   2       bld Oo1                             IMAGE:6640063.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATAACTCTGACCTGTCAGACTCCAGTGTCAGTGAAAACACTTTCCGGGCCCCTCTCCGAGGCAGAAACACATCCACAGCGAAGGTCAAGAAGGTGCTGCGTGTGCTGCCCATGCAGGGAAACAGCCAATTACAGAGCACCATAGAGGAGGGGATCCCAGTCTTTGAGAAGAAGAAAAAGAAACAGGTCACATGTGATGGGCATGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACCGGCTCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTANAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCANTGGNGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGGATTTCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGGGGAAatatatatatatTTTACGGGATATCCACCCCATTACCCACAATGGCTGCG
  5   1   2       chi Oo1                             IMAGE:6638438.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGATCATCCACAGCGAAGGTCAAGAAGGTGCTGCGTGTGCTGCCCATGCAGGGAAACAGCCAATTACAGAGCACCATAGAGGAGGGGATCCCAGTCTTTGAGAAGAAGAAAAAGAAACAGGTCACATGTGATGGGCATGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACCGGCTCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCAGCTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATCATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAatatatatatatTTTACTGATTATCCACCCATTACCCACAATGCTTCGGCAGCTGAAACTGGCAGGTGTTGGGTCCCCCCCGGCAGGATGGTTCTCGGCTGGGGGGTTTTTTAATCGGCCTTTAATATTTACAT
  5   1   2      seed Ga15      in                       XL417b13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCCGATAGAGGAGGGGATCCCAGTCTTTGAGAAGAAGAAAAAGAAACAGGTCACATGTGATGGGCATGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACCGGCTCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATCATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCNCTCTTGTGTAAatatatatatatTTTACTAATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGT
  3   1   2       bld Spl  5g3  in                    IMAGE:8464208.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGGTGGTGGTCAGCAGATCACAATCAGCACCTGAGAGGATCCGTTTTGGAGAGAAAGAACAGTCCATTGATGGCAGAGACCAGCCACGGGAATGAACATGAGACAGACTGCTGAGAGCGGCAGGAGAGATCCNGAAACTACTCAACACCGGCTCCGTAAAGAACTCNAATNCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATAGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTGATTATCCACCCATTACCCACAATGCTTCGGCAGCATGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTATTCCAAAAAATCCATGTCTTTTAAATAATCATTGTT
  3   1   2       bld Ga18      in                      xlk107i09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GNNNGGGNNNCNAGTCTTTNNNNNGNAGAAAAANGAANCAGNTCACATGTGANGGGNATGAGNNNCAGNCCNCGNGGGAAATGAACATGNGGACAGACCTGCTTGANAGCNGCAAGGAGAGAATCCTGAAACTACTCAACACCGGCTCCGTAAAGNNACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGNNNAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCAGCTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTNCCAATCGGCCGCTGGAGTGAGTNCAACGCAGAGACTAAAGTTTTATTATTTTATCATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGNCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTGATTATCCACCCATTACCCACAATNCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTNTTCCAAANNNNNATNNCTTT
  3   1   2       bld Ga18      in                      xlk127n17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CNAGTNTNNANANNANNAAAAANNNANNAGGTCACATGTGATGGGCATGNGNNNNNCCCACGTNGGAAATGNACATGAGGACAGNCCTGCTTGAGAGNGGCAAGGAGAGAATCCTGAAACTACTCAACACCGGCNCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAANNCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTNCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGNCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTAATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATTGCGTTATTCCAAA
  3   1   2       bld Thy  5g3  in                    IMAGE:8546496.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAGAGAAGAAAAGAACGGTCACATGGATGGCATGAGACCAGCCCACGGGGAAATGAACATGAGACAGACCTGCTGAGAGCGCAAGGAGAGAATCCTGAACTACTCAACACCGGCTCNGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGTCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCTATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTGATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTATTCCAAAAAATCCATGTCTTTGGAAAAAAC
  5   1   2       bld Egg1                               PBX0005B04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAGGTCACATGTGATGGGCATGAGAACCAGCCCACGTGGGAAATGAACATGAGGACAGACCTGCTTGAGAGCGGCAAGGAGAGAATCCTGAAACTACTCAACACCGGCTCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGC
  5   1   2       bld Egg1                               PBX0145C10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGAGGGGCAAGGAGAGAATCCTGAAACTACTCAACACCGGCTCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAatatatatatatTTTACTGATTAT
  3   1   2       bld Tbd7 5g3  in                         XL066d05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCAACACCGGCTCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGANAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCAGCTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATCATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTGATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTAAAATTACATCGCGTATTCCAAAAAATCCAA
  3   1   2       bld DMZ  5g3  in                         xl280m22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCTCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGCTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTNGGCTCCTTATGGCAAAACTNTGAAGTGTGAATNTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATCATGAGCTGGNGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCNTGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTAATTATCCACCCNTTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTATTCCAAAAAATCC
  3   1   2       bld DMZ       in                         xl259j14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGCTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTNTGAAGTGTGAATNTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATCATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTAATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTATTCCAAAAAATCC
  3   1   2       bld DMZ  5g3  in                         xl278b01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CNGTAAAGGAACTCAAATCCCTGCAGAGGATCGGAGACAAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTNTGAAGTGTGAATNTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTAATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATTGCGTTATTCCAAAAAATCC
  5   1   2       bld Egg1                               PBX0046H02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCACGAGGAGAAGGCCAAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAatatatatatatTTTACTGATTATCCACCCATTACCCACAATGCTGCGGCAGCCTGAACTG
  3   1   2       bld DMZ  5g3  in                         xl320p05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGCTGATTATTGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTNGGCTCCTTATGGCAAAACTNTGAAGTGTGAATNTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAANGATTTCCATGCTGTGTGAGGCAGCANCATTTAACCNCTCGCTCTTGTGTAAATATATATATATTTTACTAATTATCCACCCNTTACCCNCAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCANCGCGGCAGAGATGTTCNGCNGGGGTTTTTNTCGTCTTAATACGTACATTGCGCTANTCCAAAAAAT
  3   1   2       bld Ga15      in                       XL417b13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAATGGGCTNTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTNTGCTAAACAAGTNTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATNTCCAGNTGAGACCCGTGACATCATCAGNCTGAGACCTGTGACATCATCAGGCTGCGACAANTATGGGCCCTGGTTATACANCCTCCAAGGGCCCGTTATTTTATTCCNCNCCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTTTGAAGTGTGAATTTGAGGCAAANTTTGGANGTTCCTGTGCCAATCGGCCNCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATCATGANCTGGTGTNTGTGTGTANCTTGAGTGAATGACTGCCCCAATGGGGNGAAGGTATGGCTGCAANGTGGTTTNTCAATGCCTGAGAANGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCNCTCGCTCTTGNGTAAATATATATATATTTTACTAATTATCCNCCCATTACCCNCAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCNCNCGGCAGAGANGTTCTGCTGGGGTTTTTATNGTCTTAATATTACATCGCGTTATTCCAAAAAATNC
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073697.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGTCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATCATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTGATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTATTCCAAAAAATCCATGTCTTTGTGAAATAAAACAGTTTGGTTTTTTTTTTAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tbd7                                 XL053e18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCAGCATCTCCAGCTGAGACCTGTGACATCAGCTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTNTGAAGTGTGAATNTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATCATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTGATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTATTCCAAAAAATCCA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5074322.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCTACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGTCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATCATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTGATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTATTCCAAAAAATCCATGTCTTTGTGAAATAAAACAGTTTGGTTTTTTTTTT
  5   1   2       bld Egg1                               PBX0117B08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGAGACCTGTGACATCATCAGACTGAGACCTGTGACATCATCAGGCTGCGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAatatatatatatTTTACTGATTATCCACCCATTACCCACAATGCTGCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTATT
  3   1   2       bld Emb4 5g3  in                    IMAGE:4203587.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGTCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATCATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACTGATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTATTCCAAAAAATCCATGTCTTTGTGAAATAAAACAGTTTGGTTTTTTTTTTAAAAAAAAAAAAAAA
  3   1   2       bld Emb1                            IMAGE:3401073.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGTTATTTTATTCCACACCAACAACTTGAAATCCCTCGGCTCCTTATGGCCAAACTCTGAAGTGTGAATCTGAGTCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCTTGAGTGAATGACTGCCCCAATGGGGTGAAGGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCCTTGTGTAAATATAAATATATTTTACTGATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCGCGTTATTCCAAAAAATCCATGTCTTTGTGAAATAAAACAGTTTGGTTTTTTTTTTTAAAAAAAAAAAAA
  5  -1   2      2-75                            Xl3.1-IMAGE:7296384.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACGTGAATGACAGAGACGACTGCTGAGAGCGCAGAGAGATCTGAATACTCACACGGCTCGTAAGAACTCAATCCTGCAGAGATCGAGACAGAAGGCCAAGCTGATATCGGCTGAGAGAGTCAATGGGCTCTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCAGGCTGAGACCTGTGACATCATCAGGCTGTGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCCTGAGTGAATGGCTGCCCCAATGGGGTGAATGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTAGAAGTTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACCAATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCACGTTATTCCAAAAAATCCATGTCTTTGTGAAATAAAACAGTTTGGTTTTTTTTTTTTAAAAAAAAAAAAAAAAACTCGAGGGGGGCCCGTACCCAATCGCCTTAGATCCCCGG
                                                  Xl3.1-CHK-1012718858                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGACAGAGACGACTGCTGAGAGCGCAGAGAGATCTGAATACTCACACGGCTCGTAAGAACTCAATCCTGCAGAGATCGAGACAGAAGGCCAAGCTGATATCGGCTGAGAGAGTCAATGGGCTCTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCAGGCTGAGACCTGTGACATCATCAGGCTGTGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCCTGAGTGAATGGCTGCCCCAATGGGGTGAATGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTAGAAGTTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAATATATATATATTTTACCAATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCACGTTATTCCAAAAAATCCATGTCTTTGTGAAATAAAACAGTTTGGTTTTTTTTTTTTAAAAAAAAAAAAAAAAACTCGAGGGGGGCCCGTACCCAATCGCCTTAGAT
  5  -1   2       bld Bla2                            IMAGE:7299598.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCCACGTGAATGACAGAGACGACTGCTGAGAGCGCAGAGAGATCTGAATACTCACACGGCTCGTAAGAACTCAATCCTGCAGAGATCGAGACAGAAGGCCAAGCTGATATCGGCTGAGAGAGTCAATGGGCTCTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCAGGCTGAGACCTGTGACATCATCAGGCTGTGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCCTGAGTGAATGGCTGCCCCAATGGGGTGAATGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTAGAAGTTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAatatatatatatTTTACCAATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCACGTTATTCCAAAAAATCCCATGTCTTTGTGAAATAAAACCAGTTTGGttttttttttt
  5  -1   2      seed Bla2      in                    IMAGE:7296384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCAAGCTGATTATCGGCTGGAGAGAAGTCAATGGGCTCTTTAAAAATGTGGAAGAGTTGGAATGTTTAGAAGGAATCTCTGCTAAACAAGTCTCCTCCTTTATAAAGGCAAATATCCTGAGCAGCATCTCCAGCTGAGACCTGTGACATCAGGCTGAGACCTGTGACATCATCAGGCTGTGACAAGTATGGGCCCTGGTTATACAGCCTCCAAGGGCCCGTTATTTTATTCCACAACTTGAAATCCCTCGGCTCCTTATGGCAAAACTCTGAAGTGTGAATCTGAGGCAAAGTTTGGATGTTCCTGTGCCAATCGGCCGCTGGAGTGAGTGCAACGCAGAGACTAAAGTTTTATTATTTTATTATGAGCTGGTGTCTGTGTGTAGCCTGAGTGAATGGCTGCCCCAATGGGGTGAATGTATGGCTGCAATGTGGTTTCTCAATGCCTGAGAATGATTAGAAGTTTCCATGCTGTGTGAGGCAGCAACATTTAACCACTCGCTCTTGTGTAAatatatatatatTTTACCAATTATCCACCCATTACCCACAATGCTTCGGCAGCCTGAACTGCAGGTGTTGGGTCACGCGGCAGAGATGTTCTGCTGGGGTTTTTATCGTCTTAATATTACATCACGTTATTCCAAAAAATCCATGTCTTTGTGAAATAAAACAGTTTGGttttttttttttaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCGCCTTAGATCCCCGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)