Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 95%

 1012837505 Xl3.1-IMAGE:7203014.5.5 - 70 ESTs
                                                                       ..-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:7203014.5.5                       CCCCTTCCTACACGTCACTGTCCCTTTGCTTGTCCCTGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGCCTCCCAGCCTACAGCCACCGCTAACTTCGCCAATTTTGCTAATTTCAACAATCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCATCCTTAAACACAGGCACTAATGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCCAGTGCTGATTTTGGCGCATTCAATTCGACAACACACAGCACGGCACCTAGCAAACCTGCCTTGAAAAGAATAAGCCAGCCTGCAGCTGATAAATACGCAGCACTTGCGGATCTAGACAATATGTTTAGCGTTGTACAAGGTGGAAGTAGTGGTCAACCAAGCAGCTTTAAAAGCACGTCTGTTCCTGCATCAACTGGCCCAGCAGTACCAGCACCTACAGACAACAAAGTTTTCGGGATGGGTTCAGCAGCTCCCACAGCACACACGCACACAGTTGCATCAGCAGCAGGACCTTTTGCAGCTCCTGCCTCCACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCCGTTAATCCATTCCAGACTAATGGCCGTGCCCCTCCAGGGGTACGAGACGGTCACACAGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGGCTAGCGACAGCTGCAGGAGCATTGGATGCCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGCACACAGACACCGTACAGTCTTCCTACCAGCTTTAGCGGCAGTTTCCACCAACCTGCCTTCGCCCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATTCAAGGTGCAGGGTTTGCTGTTTTTGGGCAGACCAAGCCTGTCGTTACTCCATTTGGCCAGATGGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATAATAA
                                                  Xl3.1-CHK-1012722680                             CCTACACGTCACTGTCCCTTTGCTTGTCCCTGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGCCTCCCAGCCTACAGCCACCGCTAACTTCGCCAATTTTGCTAATTTCAACAATCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCATCCTTAAACACAGGCACTAATGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCCAGTGCTGATTTTGGCGCATTCAATTCGACAACACACAGCACGGCACCTAGCAAACCTGCCTTGAAAAGAATAAGCCAGCCTGCAGCTGATAAATACGCAGCACTTGCGGATCTAGACAATATGTTTAGCGTTGTACAAGGTGGAAGTAGTGGTCAACCAAGCAGCTTTAAAAGCACGTCTGTTCCTGCATCAACTGGCCCAGCAGTACCAGCACCTACAGACAACAAAGTTTTCGGGATGGGTTCAGCAGCTCCCACAGCACACACGCACACAGTTGCATCAGCAGCAGGACCTTTTGCAGCTCCTGCCTCCACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCCGTTAATCCATTCCAGACTAATGGCCGTGCCCCTCCAGGGGTACGAGACGGTCACACAGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGGCTAGCGACAGCTGCAGGAGCATTGGATGCCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGCACACAGACACCGTACAGTCTTCCTACCAGCTTTAGCGGCAGTTTCCACCAACCTGCCTTCGCCCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATTCAAGGTGCAGGGTTTGCTGTTTTTGGGCAGACCAAGCCTGTCGTTACTCCATTTGGCCAGATGGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAxGxGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAGTGTTTTGCTACAGTTTGCAGGTGAAAATAAATAATAAAACATT
                                                      consensus depths                            5     5     6     7     8    11    11    14    15    17    19    19    21    22    21    23    22    23    23    25    24    25    24    25    24    25    24    25    24    25    24    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    24    25    25    25    26    26    26    26    26    26    25    26    26    28    27    29    27    29    27    29    29    30    29    30    29    30    29    30    30    30    30    30    30    30    30    30    30    30    27    30    24    30    29    30    29    30    30    31    29    30    25    27    26    27    26    26    23    24    21    24    19    23    20    23    20    23    21    22    19    21    16    21    10    21    13    20    14    20    12    18    12    18    12    17    11    16    11    16    11    16    11    15    10    15     9    16     9    16     8    16     8    15     7    15     8    15     8    14     8    13     7    13     8    13     8    13     6    11     5    12     6    12     7    11     7    10     7    10     8    10     6    10     6    10     6    11     6    10     6    10     7    11     7    10     7    10     7     9     6    10     6    10     7    10     7    10     7    10     7    10     7    10     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     8     9    11     7    11     9    11     7    11     9    11     8    12     9    13     9    14     9    14     9    14     9    14     9    14    10    16    10    16    10    15    10    16    10    16    10    16    10    17    10    17    11    17    11    18    12    20    14    26    14    25    12    25    15    24    15    24    15    24    15    24    15    26    15    26    15    26    15    26    11    26    10    26    10    27    10    26    10    26    10    27    14    27    13    28    13    28    13    27    13    27    13    26    13    26    13    28    14    27    15    28    15    28    15    28    15    28    15    28    15    28    15    28    15    28    15    28    15    28    16    28    15    28    14    26    14    26    14    26    14    26    14    26    14    26    14    26    14    26    14    26    13    26    20    26    20    26    20    26    20    26    20    26    20    25    20    25    20    25    19    25    19    24    18    24    11    15    10    13     8    12     4     9
  5   1   2      en>5                            Xl3.1-IMAGE:7203014.5                              CTACACGTCACTGTCCCTTTGCTTGTCCCTGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGCCTCCCAGCCTACAGCCACCGCTAACTTCGCCAATTTTGCTAATTTCAACAATCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCATCCTTAAACACAGGCACTAATGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCCAGTGCTGATTTTGGCGCATTCAATTCGACAACACACAGCACGGCACCTAGCAAACCTGCCTTGAAAAGAATAAGCCAGCCTGCAGCTGATAAATACGCAGCACTTGCGGATCTAGACAATATGTTTAGCGTTGTACAAGGTGGAAGTAGTGGTCAACCAAGCAGCTTTAAAAGCACGTCTGTTCCTGCATCAACTGGCCCAGCAGTACCAGCACCTACAGACAACAAAGTTTTCGGGATGGGTTCAGCAGCTCCCACAGCACACACGCACACAGTTGCATCAGCAGCAGGACCTTTTGCAGCTCCTGCCTCCACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCCGTTAATCCATTCCAGACTAATGGCCGTGCCCCTCCAGGGGTACGAGACGGTCACACAGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGGCTAGCGACAGCTGCAGGAGCATTGGATGCCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGCACACAGACACCGTACAGTCTTCCTACCAGCTTTAGCGGCAGTTTCCACCAACCTGCCTTCGCCCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATTCAAGGTGCAGGGTTTGCTGTTTTTGGGCAGACCAAGCCTGTCGTTACTCCATTTGGCCAGATGGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTCTTCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTAACACCGTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTAAAAAAAAAACAGTTTTAACAATCTGGGGAGTGGGGATTGCAAAAGCAATGATGTCTTTATTACAAATTGTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAACAGAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATTAAAAAGCTAGTGTTTTGCTACAGTTTGCAGGTGAAAATAAATAATAAAACATTA
  5   1   2      en>5                            Xl3.1-IMAGE:6957757.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTTAGTGGGAGTTCCACCAACCTGCCTTCCCTCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATCCAAGGTGCAGGGTTTGCTGTGTTTGGGCAGATCAAGCCTGTTGTTACTCCATTTGGCCAGGTTTCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGACCTTCGGGGCACAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATTTTTTTTGTATTTAAACAAAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTGCCAGAGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTCTTCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTAACACCGTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACAGTTTTAACAATCTGGGGA
                                                                   SNP                                                                                               C---C-------
                                                                   SNP                                                                                                                       -----A-----A
                                                                   SNP                                                                                                                                                                       -----C------
                                                                   SNP                                                                                                                                                                                   -----C------
                                                                   SNP                                                                                                                                                                                               --T---------
                                                                   SNP                                                                                                                                                                                                                                                                       --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                   -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                       --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                   --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                       -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --G-----T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --T--C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----A--C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------A--G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               G--------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------G--T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----C-G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               T---------G-
                                               BLH ATG      74    1446                       
                                               BLH MIN      68     246                       
                                               BLH MPR      65     246                       
                                               EST CLI      13       9                       
  5   1   2      en>5                            Xl3.1-IMAGE:7203014.5                              CTACACGTCACTGTCCCTTTGCTTGTCCCTGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGCCTCCCAGCCTACAGCCACCGCTAACTTCGCCAATTTTGCTAATTTCAACAATCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCATCCTTAAACACAGGCACTAATGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCCAGTGCTGATTTTGGCGCATTCAATTCGACAACACACAGCACGGCACCTAGCAAACCTGCCTTGAAAAGAATAAGCCAGCCTGCAGCTGATAAATACGCAGCACTTGCGGATCTAGACAATATGTTTAGCGTTGTACAAGGTGGAAGTAGTGGTCAACCAAGCAGCTTTAAAAGCACGTCTGTTCCTGCATCAACTGGCCCAGCAGTACCAGCACCTACAGACAACAAAGTTTTCGGGATGGGTTCAGCAGCTCCCACAGCACACACGCACACAGTTGCATCAGCAGCAGGACCTTTTGCAGCTCCTGCCTCCACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCCGTTAATCCATTCCAGACTAATGGCCGTGCCCCTCCAGGGGTACGAGACGGTCACACAGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGGCTAGCGACAGCTGCAGGAGCATTGGATGCCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGCACACAGACACCGTACAGTCTTCCTACCAGCTTTAGCGGCAGTTTCCACCAACCTGCCTTCGCCCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATTCAAGGTGCAGGGTTTGCTGTTTTTGGGCAGACCAAGCCTGTCGTTACTCCATTTGGCCAGATGGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTCTTCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTAACACCGTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTAAAAAAAAAACAGTTTTAACAATCTGGGGAGTGGGGATTGCAAAAGCAATGATGTCTTTATTACAAATTGTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAACAGAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATTAAAAAGCTAGTGTTTTGCTACAGTTTGCAGGTGAAAATAAATAATAAAACATTA
                                                  Xl3.1-CHK-1012686522                                    GTCACTGTCCCTTTGCTTGTCCCTGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGCCTCCCAGCCTACAGCCACCGCTAACTTCGCCAATTTTGCTAATTTCAACAATCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCACCCTTAAACACAGGCACTAATGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCCAGTGCTGATTTTGGCGCATTCAATTCGACAACACACAGCACGGCACCTAGCAAACCTGCCTTGAAAAGAATAAGCCAGCCTGCAGCTGATAAATACGCAGCACTTGCGGATCTAGACAATATGTTTAGCGTTGTACAAGGTGGAAGTAGTGGTCAACCAAGCAGCTTTAAAAGCACGTCTGTTCCTGCATCAACTGGCCCAGCAGTACCAGCACCTACAGACAACAAAGTTTTCGGGATGGGTTCAGCAGCTCCCACAGCACACACGCACACAGTTGCATCAGCAGCAGGACCTTTTGCAGCTCCTGCCTCCACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCCGTTAATCCATTCCAGACTAATGGCCGTGCCCCTCCAGGGGTACGAGACGGTCACACAGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGGCTAGCGACAGCTGCAGGAGCATTGGATGCCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGCACACAGACACCGTACAGTCTTCCTACCAGCTTTAGCGGCAGTTTCCACCAACCTGCCTTCGCCCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATTCAAGGTGCAGGGTTTGCTGTTTTTGGGCAGACCAAGCCTGTCGTTACTCCATTTGGCCAGATGGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTCTTCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTAACACCGTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTAAAAAAAAAACAGTTTTAACAATCTGGGGAGTGGGGATTGCAAAAGCAATGATGTCTTTATTACAAATTGTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAACAGAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATTAAAAAGCTAGTGTTTTGCTACAGTTTGCAGGTGAAAATAAATAATAAA
  5   1   2       bld Ga12 5g3  in                         XL173k21.5p GCAGACGTCNCGCCGATCCCGCCCCCTTCCTACACGTCACTGTCCCTTTGCTTGTCCCTGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGA
  5   1   2      seed DMZ  5g3  in                         xl299a09.5p                       CCCCTTCCTACACGTCACTGTCCCTTTGCTTGTCCCTGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCC
  5   1   2       bld DMZ  5g3  in                         xl306h01.5p                       CCCCTTCCTACACGTCACTGTCCCTTTGCTTGTCCCTGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCA
  5   1   2       bld DMZ  5g3  in                         xl327i16.5p                       CCCCTTCCTACACGTCACTGTCCCTTTGCTTGTCCCTGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGT
  5   1   2       bld DMZ  5g3  in                         xl328p08.5p                       CCCCTTCCTACACGTCACTGTCCCTTTGCTTGTCCCTGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCC
  5   1   2       bld Tbd7 5g                              XL068d15.5p                              CGGGCTGCAGGNAATTCNGCACGAGGGCCCGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCTCCAGGATGGCGGCCAGCGCGAAGCGAAAGCAAGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCATAATCGCAAATGTTTTGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTGAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACTTTTACCCAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGAAGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTCCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCGATTTCTGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAGCACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATA
  5   1   2       bld Int2 5g                         IMAGE:8527560.5p                                  ACGTCACTGTCCCTTTGCTTGTCCCTGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATC
  5   1   2       bld Int2 5g                         IMAGE:8531317.5p                                     GTCACTGGCCCTTGGCTGTGCCCGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCTCCAGGATGGCGGCCAGCGCGAAGCGAAAGCAAGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCATAATCGCAAATGTTTTGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTGAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACTTTTACTCAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGAAGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTCCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCGATTTCTGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAGCACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCATGACAAGNAACAGTTTGACCTTCTGAGTGACCTTGGAGCAGATATCTTTGCTACCCCTGCCCTCCAGCCTCTGCAGAGCTACTTTCGCAATTTTGCAATTCACAGTCTACAGCACTATGCCATGCAATTTGCTCGTTGACATTCCNAGTCTCAGTGTGATTTGCCATCATCGAACCAAGCCGAC
  5   1   2       bld Tail 5g                         IMAGE:8545245.5p                                           CTCAATAGTTNNNNNGAGGACATACATAGNATTCGTCCCCCGGTGTGAGTTGCCCTCCAGGATGGCGGCCAGCGCGAAGCGAAAGCAAGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCATAATCGCAAATGTTTTGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTGAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACTTTTACCCAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGAAGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTCCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCGATTTCTGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAGCACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCATGACAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAGCAGATATCTTTGCTACCCCTGCCTCCCAGCCCTCTGCCAGAGCTAACTTCGCCAAT
  5   1   2       bld Lu1  5g                         IMAGE:4056793.5p                                            CCCTTTGCTTGTCCCTGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAACAATTCCANCAGTACACCCGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCGATGCAGTTGAATAAGGGA
  5   1   2       bld Kid  5g                         IMAGE:4031417.5p                                            CCCTTTGCTTGTCCCTGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGCCTCCCAGCCTACAGCCACCGCTAACTTTCGCCATTTTGCTANATTTCACAATCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCCAGTCAGAACACCCACCCCACCCTTAACACCGGGCAACAACCGCCAAATGCAAACTTTCCCTCACGTTGGACAAATTTTCCC
  5   1   2       bld Te2N 5g3  in                    IMAGE:7203014.5p                                                         CCTGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGCCTCCCAGCCTACAGCAACCGCTAACTTCGCCAATTTTGCTAATTTCAACAATCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGAACATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCACCCTTTAAAACCCAGGCCACAA
  5   1   2       bld Neu7 5g3  in                         XL016c15.5p                                                           GGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCTCCAGGATGGCGGCCAGCGCGAAGCGAAAGCAAGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCATAATCGCAAATGTTTTGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTGAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACTTTTACCCAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGAAGTATGCAAACAGATATGGTTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTCCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCGATTTCTGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCAGAGGTCAAACCACTGAAAGCACTTCTAGGCGATGGTGCACCAGCATTGCAGTT
  5   1   2       bld Oo1  5g                         IMAGE:6639515.5p                                                           CTGGACCGGTCCGGAATCCCGTGATGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGGAGGTGAACCCACTGAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGGCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGGCTCCCAGCCTACGCCCACCGCTAATTTCGCAATTTTGCTAATTTCACCATCATACAGCTCCCAATTCTGCCCATGCAAACTTTGCAAAACTTTGATGGCTTCGGAAAACCTAAggggggggAAAAAATTTTGGGAGCTTTTCCCCCCATCAGGTCAGAcccccccccccACCCCTAAAAACCGGGGCCCAAACCCCCAAGGGGAAATTTCGCCCACGTTTGGAAAAATTTTCTCCCAAATCCTTCCCggggggggggTATTTTGGGCAGAGTTTTTATATTTTTAGAGGGGCAACCAAgggggggggggCCCCTTTTAAAAAAATGTGGTT
  5   1   2       bld FaBN 5g3  in                    IMAGE:8074763.5p                                                            GCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGCCTCCCAGCCTACAGCCACCGCTAACTTCGCCAATTTTGCTAATTTCAACAATCATACAGCTCACAATTTCTGCCATGCAGACTTTT
  5   1   2       bld Tbd4 5g                         IMAGE:4059570.5p                                                               TGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCATGAGAAGATACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTTACCCTGCCTCCCAGCCTACAGCCACCGCTAACTTTCGCTATTGTGCTTATTCCAACAATCATTCAGCTCACTATTCTGCN
  5   1   2       bld Eye1      in                    IMAGE:6957757.5p                                                                    CCGCCCGGTGTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGCCTCCCAGCCTACAGCCACCGCTAACTTCGCCAATTTTGCTAATTTCAACAATCATACAGGCACAAACGCCAATGCAAACTTCGCTCAGTTTGACAATTTTCCCAAGTCATCCAGTGCTGATTTTGGCAGCTTCAATTCAACGGCACACAGCGCGGCACCTAGCAAAGCTGTAATGACTAAAATGG
  5   1   2       bld Int2 5g                         IMAGE:8528442.5p                                                                         CGGTGTTTCCCGGTGTGAGTTGCCCTCCAGGATGGCGGCCAGCGCGAAGCGAAAGCAAGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCATAATCGCAAATGTTTTGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTGAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACTTTTACCCAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGAAGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTCCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCGATTTCTGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAGCACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGAAATCAGGTGCCCCANGCGCATCATGACAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAGCAGATATCTTTGCTACCCCTGCCTCCCAGCCCTCTGCCAGAACTAACTTCTGCAATTTTGCAAATTTCACCA
  5   1   2       bld DMZ  5g3  in                         xl293n22.5p                                                                             GTTTCCCGGTGTGAGTTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGCCTCCCAGCCTACAGCAACCGCTAACTT
  5   1   2       bld Eye1 5g                         IMAGE:6945036.5p                                                                                    GGTGTGAGTTGCCCTCCAGGATGGCGGCCAGCGCGAAGCGAAAGCAAGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCATAATCGCAAATGTTTTGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTGAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACTTTTACCCAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGAAGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTCCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCGATTTCTGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGATAGTCAAACCACTGAAAGCACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCATGACAAGAAACAGTTTTGACCTTTCTGAGTGACCTTGGGAGCCAGAAATCTTTGGCTACCCCCTGCCCTCCCAAGCCCTTCTGCCCAGAAGCTAAATTTCGCCCAATTTTTGGCAAAATTTTCAAACAGTCCTATAACGAGGCACCTAAATGGCCCAAATGGAAAATTTTTGGCCCACGCGTTTGTGAAAAATTTTTTCCCCAAAAGTTCTATCCCAAGGGGCCTGGAATTTTTTGGGCGGGCCATTTCTATTTTTCCGACCTAACCACAACAATGGGACGGGGCCATCCTTAAGTCAAAGAACCCGTGCCCCTTTGGCAAAAGGAAAAATACAAGCCCCCAGCCCCGCTCCAAATTTGGTAAAACACAAAAN
  5   1   2       bld Eye1                            IMAGE:6946032.5p                                                                                           CTGGACCGGTCCGGAATTCTCGGGATCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGCCTCCCAGCCTACAGCCACCGCTAACTTCGCCAATTTTTGCTAATTTCAACAATCATTACGGGCACAAACGCCCAATGCAAAACTTCGCTCAGTTTGAACAATTTTCCCCAGGCCATCCAGTGGCTGATTTTTGGCAGCTTTCAATTTCAACGGGCACACAGCGGCGGGCACCCTAACCAAAGCTTGTAAATGGACCTAAAAAGGAGGCCAGCCCCACAAGCTTGAATAAAATACCCCAACCCCTTTGTTGGATTTTAAAACAAATATTTTTTTGGGGAAGGGA
  5   1   2       bld Oo1  5g                         IMAGE:6643901.5p                                                                                            TTGTCCCTCAGGATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGCCTCCCAGCCTACAGCCACCGCTAACTTCGCCAATTTTGCTAATTTCAACAATCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGGTGAATAATTTTGGAGCTTTCCCCCCATCCAGTCAGACACCCACCCCACCCTTAAACACAGGCACAAACGCCAATGCAAACTTCGCTCAGTTTTGACATTTN
  5   1   2       bld Ga18      in                      xlk116e20ex.5p                                                                                                    TTNCCCTCCAGGATGCGGCCAGNNGNNNNNNAGAGGAGAAGNATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCATAATCGCAAATGTTTTGACTGCGANCNNNNGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTGAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACTTTTACCCAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGAAGTATGCAAACAGATATGGTTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTCCCTCCAGAGCAAGCGAAGGNTGTTGCGTCTGTTCATGCTTCGATTTCTGGGTCTTCTGCTAGCNGTGCCAGCAGTACACCAGANGNCAAACCACTGAAAGCACTTCTAGGCGATGGTGCNCCAGCATTGCAGTTGAATAAAGGGNNCCCTAGCCAGTCTCCTGTCGTCACTCGAAATCAGGNGCCCCAGGNGCATCATGACAAGNAANAGTTTGACCTTCTGAGTGANCNTGGAGCAGATATCTTTGCTACCCCTGCCTCCCAGCCNTCTGCCAGNGCTAANTTCGCCAATTTTGCAAATTTCA
  5   1   2       bld Emb4                            IMAGE:4957965.5p                                                                                                                        AGCGGAAGTTTGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTAggggggggggATCTTCTGCAATCCCAGATTTTAGAGACCCCCAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCCTCCGAAGCAGGCGAAGGTTGTTGCGTCTGGTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCCGCAGAACCCCGGAGGGGAACCCCCTGAAAACTTTTCTAGGGGGATGGTGCACCAAGCATTGCAGTTTAAAAAAGGGGCCCCTTCCCAGTCCTCTC
  5   1   2       bld Neu7      in                         XL009g24.5p                                                                                                                                 GNAGGAGTAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTACCGCATAATCGGAAATGTTTCGACTGCGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGTATCCTGCGCGGTCTCAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGT
  5   1   2       bld Kid                             IMAGE:4032944.5p                                                                                                                                                                                                                                                                                                                                                 AGAATTCCTACAGAAGCACGGCAATGACGTATGCAAACAGATATGGCTAGGATTATTTGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGCCTCCCAGCCTACAGCCACCGCTAACTTCGCCAATTTTGCTAATTTCAACAATCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCACCCTTAAACACAGGCACAAACGCCAATGCAAACTTCGCTCAGTTTGACAATTTTCCCAAGTCATCCAGTGCTGATTTTGGCAGCTTCAATTCAACGGCACACAGCGCGGCACCTAGCAAAGCTGTAATGACTAAAATGAGCCAGCCCACAGCTGATAAATACGCAGCACTTGCTGATCTAGACAATATATTTGGTAGTGTACAAGGTGTCCGTGGTGGGTCAGTCAAGCAGCTTTTAACAGCCACGTCTGGTTCTTGCATCATCTGGGCCC
  5   1   2       bld Tbd7      in                         XL103i15.5p                                                                                                                                                                                                                                                                                                                                                                                                        AGGTGATAGATCTTCTGCAATCCCAGNATTTTAGAGACCCACAGNAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTCCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCGATTTCTGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAGCACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCATGACAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAGCAGATATCTTTGCTACCCCTGCCTCCCAGCCCTCTGCCAGAGCTAACTTCGCCAATTTTGCAAATTTCAACAGTCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTTCCCCCGTCAAGTCAGGCACCCACCCCATCCTTAAACACAGGCACTAATGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCCAGTGCTGATTTTGGCGCATTCAATTCGACAACACACAGCACGGCACCTAGC
  5   1   2       bld Te2                             IMAGE:7391951.5p                                                                                                                                                                                                                                                                                                                                                                                                          TGATGATAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTCCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCGATTTCTGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAGCACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCATGACAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAGCAGATATCTTTGCTACCCCTGCCTCCCAGCCCTCTGCCAGAGCTAACTTCGCCAATTTTGCAAATTTCAACAGTCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTTCCCCCGTCAAGTCAGGCACCCACCCCATCCTTAAACACAGGCACTAATGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCCAGTGCTGATTTTGGCGCATTCAATTCGACAACACACAGCACGGCACCTAGCAAACCTGCCTTGAAAAGAATAAGCCAGCCTGCAGCTGATAAATACGCAGCACTTGCGGATCTAGACAATATGTTTAGCGTTGTACAAGGTGGAAGTAGTGGTCAACCAGCAGC
  5   1   2       bld Egg1                               PBX0148H03.5p                                                                                                                                                                                                                                                                                                                                                                                                                   CACGAGGGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTTCTCCAGGAAAAATATGAAAAGAAGAGATGGTACGTTCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCTATATCAGGGTCTTCTGCTAGCAGTACCAGCAGTACACCGGAGGTGAAACCACTGAAAACACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGGAATCAGGTGGCCCAGGCGCATCAGGAGAAGAAACAGTTTGACCTGCTGAGTGACCTTGGAACAGATATCTTTGCTACCCCTGCCTCCCAGCCTACAGCCACCGCTAACTTCGCCAATTTTGCTAATTTCAACAATCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCACCCTTAAACACAGGCACAAACGCCAATGCAAACTTCGCTCAGTTTGACAATTTTCCCAAGTCATCCAGTGCTGATTTTGGCAGCTTCAATTCAACGGCACACAGCGCG
  5   1   2       bld Te2                             IMAGE:7393691.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTCCCTCCAGAGCAAGCGAAGGTTGTTGCGTCTGTTCATGCTTCGATTTCTGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAGCACTTCTAGGCGATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCATGACAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAGCAGATATCTTTGCTACCCCTGCCTCCCAGCCCTCTGCCAGAGCTAACTTCGCCAATTTTGCAAATTTCAACAGTCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTTCCCCCGTCAAGTCAGGCACCCACCCCATCCTTAAACACAGGCACTAATGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCCAGTGCTGATTTTGGCGCATTCAATTCGACAACACACAGCACGGCACCTAGCAAACCTGCCTTGAAAAGAATAAGCCAGCCTGCAGCTGATAAATACGCAGCACTTGCGGATCTAGACAATATGTTTAGCGTTGTACAAGGTGGAAGTAGTGGTCAACCAGCAGCTTTAAAGCACGTCTGTTCTGCATCACTGGCCAGCAGTACAGCACTACAGACACAAGTTTTCGGA
  5   1   2       bld Te2N      in                    IMAGE:7203220.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATGGTGCACCAGCATTGCAGTTGAATAAAGGGACCCCTAGCCAGTCTCCTGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCATGACAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAGCAGATATCTTTGCTACCCCTGCCTCCCAGCCCTCTGCCAGAGCTAACTTCGCCAATTTTGCAAATTTCAACAGTCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTTCCCCCGTCAAGTCAGGCACCCACCCCATCCTTAAACACAGGCACTAATGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCCAGTGCTGATTTTGGCGCATTCAATTCGACAACACACAGCACGGCACCTAGCAAACCTGCCTTGAAAAGAATAAGCCAGCCTGCAGCTGATAAATACGCAGCACTTGCGGATCTAGACAATATGTTTAGCGTTGTACAAGGTGGAAGTAGTGGTCAACCAAGCAGCTTTAAAAGCACGTCTGTTCCTGCATCAACTGGCCCAGCAGTACCAGCACCTACAGACAACAAAGTTTTCNGGGATGGGTTCAGCAGCTCCCACAGCACACACGCACACAGTTGCATCAGCAGCAGGACCTTTTGCAGCTCCTGCCTCCACAAATCCGTTTGT
  5   1   2       bld Int2                            IMAGE:8822707.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCGCCTCGATACATACGTACGCCACCCaaaaaaaaTCGTCCCCGCCAATTTTGCTAATTTCAACAATCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCACCCTTAAACACAGGCACAAACGCCAATGCGAACTTTGCTCAGTTTGACAATTTTCCCAAGTCATCCAGTGCTGATTTCGGCACCTTCAATTCAACGGCACACAGCGCGGCACCTAGCAAAGCTGTAATGACTAACATGAGCCAGCCCACAGCTGATAAATACGCAGCACTTGCTGATCTAGACAATATATTTGGTAGTGTACAAGGTGTCGGTGGTGGTCAGTCAAGCAGCTTTAACAGCACGTCTGTTCCTGCATCATCTGGCCCAGCAGTACCAGCCCCTGCAGACAACCATGTTTTCGGTTTGGGTTCAGCAGCGCACACGCACACTGTTGCATCGGCAGCAGGACCTTTTGCAGCTCCTGCCTCCACAAATCCGTTTGTTTCAGCCTCTGTGGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGTGCACCTCCAGGGTTACAAGATGGCCACAGAGCAGAAGCCCCATTTCATGCTTTCCACCAGACCCGGCTAGCGACAGCCGCAGAGCATTGGATGCCTGTGCAGGGTTTGCTGTGTTTGGCAGATCAGCCTGTTGTTACTCCATTTGGCCAGGTTCAGCCTCTGAGTCTCTAGCATCCTTTCTGGCCGGGCACCTTCGGGGCAGTTTCAACTGGAAGTCATCCCCCGAAACCTTTCCTATAGC
  5   1   2       add Tbd7                                 XL101j03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCGCCAATTTTGCTAATTTCAACAATCATACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCACCCTTAAACACAGGTAGTCATCCCTCTGTCGTACAAACAAGCATGGGAAAAGGCTTGTGCTGTGCTTCAAAACAAGCTGACAACACTTCTTCTCTCTGTGCTTGCGTTTGTGTCTTCTCTATACCTCTGTTTCCCTTGGGGCGGTCTTGTGTTCTTATTCTCTTCATGCTTCTATAGTAAAGCATTAATGACCTGCTtgtgtgtgtatttgtatgtgtgtttaatacatagatatatttgtaatatatatttatatattgtgttatGACTTAACATGCATCCATTTCCATTTCGTCTTAtttttttgtttttAATATTGATTTTATTGTGAAGTATAGCAGTTTTGTGTGTTGTGGGTAAAGCTCCAAAATTTAAGCGAGGTCCAAGCCAGACCATTACTCATGAAGATCAACAGGATTTAGATGCCCATTTATCAAAGGTCGAATTTCAAATTCATCCGAGTTTTTAAAAACTTCCATAAACTCGAAATTTGAC
  5   1   2       bld Bone                            IMAGE:8743374.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTAACTTCGCCAATTTTGCAAATTTCAACAGTCATACAGGCACTAATGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCCAGTGCTGATTTTGGCGCATTCAATTCGACAACACACAGCACGGCACCTAGCAAACCTGCCTTGAAAAGAATAAGCCAGCCTGCAGCTGATAAATACGCAGCACTTGCGGATCTAGACAATATGTTTAGCGTTGTACAAGGTGGAAGTAGTGGTCAACCAAGCAGCTTTAAAAGCACGTCTGTTCCTGCATCAACTGGCCCAGCAGTACCAGCACCTACAGACAACAAAGTTTTCGGGATGGGTTCAGCAGCTCCCACAGCACACACGCACACAGTTGCATCAGCAGCAGGACCTTTTGCAGCTCCTGCCTCCACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCCGTTAATCCATTCCAGACTAATGGCCGTGCCCCTCCAGGGGTACGAGACGGTCACACAGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGGCTAGCGACAGCTGCAGGAGCATTGGATGCCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGCACACAGACACCGTACAGTCTTCCTACCAGCTTTAGCGGCAGTTTCACAGCTGCTTCGCCCTCAGACGCTCCCCACGACTGCTTCTCACAGCAGCCATGGGAATATCAGGCAGTGCTGTTTGGCGACAGCCTGCTACTCATGCCAATGCAGCTCTGGATCTAGCATCTCATGAGACTCGCAATTCAACTGAAGTCATCGACATTCTTATGC
  5   1   2       bld Tad1                            IMAGE:6940257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACAATCATACAGGCACAAACGCCAATGCAAACTTCGCTCAGTTTGACAGTTTTCCCAAGTCATCCAGTGCTGATTTCGGCAGCTTCAATTCAACGGCACACAGCGCGGCACCTAGCAAAGCTGTAATGACTAAAATGAGCCAGCCCACAGCTGATAAATACGCAGCACTTGCTGATCTAGACAATATATTTGGTAGTGTACAAGGTGTCGGTGGTGGTCAGTCAAGCAGCTTTAACAGCACGTCTGTTCCTGCATCATCTGGCCCAGCAGTACCAGCCCCTGCAGACAACCATGTTTTCGGTTTGGGTTCAGCAGCGCACACGCACACTGTTGCATCGGCAGCAGGACCTTTTGCAGCTCCTGCATCCACAAATCCGTTTGTTTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGTGCACCTCCAGGGTTACAAGATGGCCACAGAACAGAAGCCCCATTTCATGCTTTCCACCAGACCCCGCTAGCGACAGCCGCAGGAAGCATGGATGCTTCTTCCTTTGGGACAGCATCTCACAGCATGCCCCCCTGGGCTTTGGAACACAGAACCCCGTACAGTCTTTCCCTACCAGCCTTTAGTGGGGGAGTTTTCTCCCCACACTTTGTCTTTCCCTTTCTTAAAAAAAGTCTTTTCCCCCCAAACCAAAACTGTGCtttttttttaacaagcacaccccccccATGGGGGAAAATAATTTCCCAAAGGCTGCGCCCACGGGCTCTTTGGCCTTGTCTCGCCACCCTCGGGGGGGCCACAGAAATTCCCCCCCACG
  5   1   2       bld Emb4                            IMAGE:4958027.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCTAAACATATTGTCTAGATCCGCAGCACTTGCGGATCTAAACATATTGTCTAGATCCGCAAGTGCTGCGTATTTAGACAATATGTTTAGCGTTGTACAAGGTGGAAGTAGTGGTCAACCAAGCAGCTTTAAAAGCACGTCTGTTCCTGCATCAACTGGCCCAGCAGTACCAGCACCTACAGACAACAAAGTTTTCGGGATGGGTTCAGCAGCTCCCACAGCACACACGCACACAGTTGCATCAGCAGCAGGACCTTTTGCAGCTCCTGCCTCCACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCCGTTAATCCATTCCAGACTAATGGCCGTGCCCCTCCAGGGGTACGAGACGGTCACACAGCAGAAGCCCCATTCCATG
  5   1   2       bld Int2                            IMAGE:8530800.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAACCTGCCTTGAAAAGAATAAGCCAGCCTGCAGCTGATAAATACGCAGCACTTGCGGATCTAGACAATATGTTTAGCGTTGTACAAGGTGGAAGTAGTGGTCAACCAAGCAGCTTTAAAAGCACGTCTGTTCCTGCATCAACTGGCCCAGCAGTACCAGCACCTACAGACAACAAAGTTTTCGGGATGGGTTCAGCAGCTCCCACAGCACACACGCACACAGTTGCATCAGCAGCAGGACCTTTTGCAGCTCCTGCCTCCACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCCGTTAATCCATTCCAGACTAATGGCCGTGCCCCTCCAGGGGTACGAGACGGTCACACAGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGGCTAGCGACAGCTGCAGGAGCATTGGATGCCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGCACACAGACACCGTACAGTCTTCCTACCAGCTTTAGCGGCAGTTTCCACCAACCTGCCTTCGCCCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATTCAAGGTGCAGGGTTTGCTGTTTTTGGGCAGACCAAGCCTGTCGTTACTCCATTTGGCCAGATGGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCACTGGAAGTT
  5   1   2       bld Thy                             IMAGE:8549769.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGGTCACCAAGCAGCTTTAAAAGCACGTCTGTTCCTGCATCAACTGGCCCAGCAGTACCAGCACCTACAGACAACAAAGTTTTCGGGATGGGTTCAGCAGCTCCCACAGCACACACGCACACAGTTGCATCAGCAGCAGGACCTTTTGCAGCTCCTGCCTCCACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCCGTTAATCCATTCCAGACTAATGGCCGTGCCCCTCCAGGGGTACGAGACGGTCACACAGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGGCTAGCGACAGCTGCAGGAGCATTGGATGCCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGCACACAGACACCGTACAGTCTTCCTACCAGCTTTAGCGGCAGTTTCCACCAACCTGCCTTCGCCCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATTCAAGGTGCAGGGTTTGCTGTTTTTGGGCAGACCAAGCCTGTCGTTACTCCATTTGGCCAGATGGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAAACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTAANCAGCGTAAAGCTTAACACAGGGNAGTCTTCAGAGCTGCAatatatatatatTTTTTGTATTAAACAAAAGGGAGACACANGTATAGTGCATTGAA
  5   1   2       bld Brn3                            IMAGE:8541239.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGTTCCTGCATCATCTGGCCCAGCAGTACCAGCACCTACAGACAACAAAGTTTTCGGGATGGGTTCAGCAGTTCCCACAGCACACACGCACACAGTTGCATCAGCAGCAGGACCGTTTGCAGCTCCTGCCTCCACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCCGTTAATCCATTCCAGACTAATGGCCGTGCCCCTCCAGGGGTACGAGACGGTCACACAGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGGCTAGCGACAGCTGCAGGAGCATTGGATGCCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCACTGGCTTTGGCACACAGACACCGTACAGTCTTCCTACCAGCTTTAGCGGCAGTTTCCACCAACCTGCCTTCGCCCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATTCAAGGTGCAGGGTTTGCTGTTTTTGGGCAGACCAAGCCTGTCGTTACTCCATTTGGCCAGATGGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTTGTTGTCTTTGTTAACAGCGTAAGCTTTAACACAGGNAGTTCTTCAGAAGCTGCATATAATATATTTTTGTATTAACAAAAANGAGANNACAGTATAGTGCATTGAAGCTTTACATCAACTTCGCTCTGAGTTTATGC
  5   1   2       chi Tad1                            IMAGE:6936667.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGAATGGGTTCAGCAGCTCCCACAGCACACACGCACACAGTTGCATCAGCAGCAGGACCTTTTGCAGCTCCTGCCTCCACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCCGTTAATCCATTCCAGACTAATGGCCGTGCCCCTCCAGGGGTACGAGACGGTCACACAGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGGCTAGCGACAGCTGCAGGAGCATTGGATGCCTCTTCCTTTGACACAGCATCTCTAAGCATGCCCGCTGGCTTTGGCACACAGACACCGTACAGTCTTCCTACCAGCTTTAGCGGCAGTTTCCACCAACCTGCCTTCGCCCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATTCAAGGTGCAGGGTTTGCTGTTTTTGGGCAGACCAAGCCTGTCGTTACTCCATTTGGCCAGATGGCAACTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCCTTCGGGGGCAGTTTCCCACGGGAAATTCATCCCCGAACCCTTTCCTTATAGCCCTAGACTAACACCAGGAAATTACCGGGCATTCACCGTACATGTACTGGCCTCTTTGCACCTGGTTGGCCTTTGGTTAAACCAGCGTTAAGCCTTTTAAACCCCGGGGGAGTTTCTTTCCAGAAGCCCGGCCAAATaaaaaaaaaatttttttttGGAATTTTAAACCAAAAAAAGGAGGGACCAACCAAGGGTAAAAATTGTGGCCAATTTGGAAAAAGCC
  5   1   2       bld Te2       in                    IMAGE:7390593.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGAAGCCCCATTCCATGCTTTCCACCAGACCCGGCTAGCGACAGCTGCAGGAGCATTGGATGCCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGCACACAGACACCGTACAGTCTTCCTACCAGCTTTAGCGGCAGTTTCCACCAACCTGCCTTCGCCCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATTCAAGGTGCAGGGTTTGCTGTTTTTGGGCAGACCAAGCCTGTCGTTACTCCATTTGGCCAGATGGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTCTTCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCATACTGTACATATATTTTTTCTANGGACTAGTAATT
  5   1   2       bld Kid                             IMAGE:7007710.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGGCTAGCGACAGCTGTAGGAGCATTGGATGCCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGCACACAGACACCGTACAGTCTTCCTACCAGCTTTAGCGGCAGTTTCCACCAACCTGCCTTCGCCCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATTCAAGGTGCAGGGTTTGCTGTTTTTGGGCAGACCAAGCCTGTCGTTACTCCATTTGGCCAGATGGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTCTTCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGNTAANTAT
  3   1   2       bld Ga18      in                      xlk116e20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCTCTAAGCANNNCGCTGGCTTTGGNANACAGACACCGTACAGTCTTCCTACCAGCTTTAGNNGCANTTNNCACNANCCNNNTTCGCCCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGNATATTCAAGGTGCAGGGTTTGCTGTTTTTGGGCAGNCCAAGCCTGTCGTTACTCCATTTGNCCAGATGGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGNNCGGGGCACTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTNCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTCTTCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTAACACCGTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTAAAAAAAAAAACAGTTTTAACAATCTGGGGAGTGGGGATTGCAAAAGCAATGATGTCTTTATTACAAATTGTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAACAGAGCTGCCCATTTCTATGCGCCTANTCTCCATACTAAAGACTCNTCTCTGCATTAAAAAGCTANTNNNNNNCTAC
  5   1   2       bld Egg2                   IMAGE:3302285-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCTTTGGCACACAGACACCGTACAGTCTTCCTACCAGCTTTAGCGGCAGTTTCCACCAACCTGCCTTCGCCCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATTCAAGGTGCAGGGTTTGCTGTTTTTGGGCAGACCAAGCCTGTCGTTACTCCATTTGGCCAGATGGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTCTTCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTAACACCCTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTaaaaaaaaaaCAGTTTTAACAATCTGGGGAGTGGGGATTGCAAAAGCAATGATGTCTTTATTACAAATTGTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAACAGAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATTAAAAAGCTAGTGTTTTGCTACAGTTTGCAGGTGAAAATAAATAATAAAACATTA
  5   1   2       bld Skin                            IMAGE:8644945.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATTCAAGGTGCAGGGTTTGCTGTTTTTGGGCAGACCAAGCCTGTCGTTACTCCATTTGGCCAGATGGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAAACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTCTTCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTAACACCCTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTaaaaaaaaaaCAGTTTTAACATCTGGGGAGTGGGGATTGCAAAGCATGATGTCTTTATACAAATGTATTTGTGACAAAGACAACTTTATTTGCCNACAGACTGCCATTCTAGCGCTATCTCATATAGGATCATCTTGCTT
  3   1   2       bld Te2N      in                    IMAGE:7203220.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGCCAGATGCAGCTCCTGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTCTTCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAATTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTAACACCGTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTAAAAAAAAAAAACAGTTTTAACAATCTGGGGAGTGGGGATTGCAAAAGCAATGATGTCTTTATTACAAATTGTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAACAGAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAAAAAGCTAGTGTTTTGCTACAGTTGCAGTGAAAATAATATAACAAAGAAAN
  3   1   2       bld Te2       in                    IMAGE:7390593.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACTTTCGGGGCAGTTTCCAACTGAAGTTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTCTTCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTAACACCGTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTAAAAAAAAAAACAGTTTTAACAATCTGGGGAGTGGGGATTGCAAAAGCAATGATGTCTTTATTACAAATTGTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAACAGAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCGAT
  3   1   2       bld Ga12                                 XL192l11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TNTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTNTTATAGCCTTAGNCTAACACAGGAGATTNCCGGGCATCNCCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACNCAGGGAGTTNTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTNTTCGCTGCCTGGAGGTTTTACTGGCAGTTTNGTAGCAGAGCGGAGTGTCAGTAGCTCCTNGACAGCGAAGGCTTTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTNTTAGGGACTAGTTAATTATTCATATCAGTATTTNTAACTNTTTAACNCCGTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTAAAAAAAAAACAGTTTTAACAATCTGGGGAGTGGGGATTGCAAAAGCAATGATGTCTTTATTACAAATTGTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAACAGAGCTGCCCATTTCTATGCGTCTAATCTCCATACTAAAGACTCATCTCTGCATAAAAAG
  5   1   2       bld Brn3                            IMAGE:8539206.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTTCCACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCTTTCCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTAACACCGTACCCGATGCTGGACAGCTGAAACGTTGCAGGTTCCGGATCCGTCACGTaaaaaaaaaaaCAGTTTTAACAATCTGGGGAGTGGGGATTGCAAAAGCAATTATGTCTTTATTACAAATTGTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAACAGAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATTAAAAGCTAGTGTTTTGCTACAGTTTGCAGGTGAAAATAATAATAAACATTAGAAAATGAAAAA
  3   1   2       bld Neu7                                 XL022i21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTCTTCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTAACACCCTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTAAAAAAAAACCAGTTTTAACAATCTGGGGAGTGGGGATTGCAAAAGCAATGATGTCTTTATTACAAATTGTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAACAGAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATTAAAAAGCTAGTGTTTTGCTACAGTTTGCAGGTAAAATAAATAATA
  3   1   2       bld Tbd7      in                         XL103i15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCTGCAATTATANATANATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTNTTCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTNTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTAACACCGTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTAAAAAAAAAACAGTTTTAACAATCTGGGGAGTGGGGATTGCAAAAGCAATGATGTCTTTATTACAAATTGTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAACAGAGCTGCCCATTTCTATGCGTCTAATCTCCATACTAAAGACTCANCNCTGCATTAAAAAGTCTAGTGTTTTG
  3   1   2       bld Neu7 5g3  in                         XL016c15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACTCTTCGCTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTAACACCCTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTAAAAAAAAACCAGTTTTAACAATCTGGGGAGTGGGGATTGCAAAAGCAATGATGTCTTTATTACAAATTGTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAACAGAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATTAAAAAGCTAGTGTTTTGCTACAGTTTGCAGGNAAAATAAATAATAAAAC
  3   1   2       bld Egg1                            IMAGE:3302285.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCCTGGAGGTTTTACTGGCAGTTTCGTAGCAGAGCGGAGTGTCAGTAGCTCCTCGACAGCGAAGGCTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAATACTGTACATATATTTTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTAACACCCTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTAAAAAAAAAACAGTTTTAACAATCTGGGGAGTGGGGATTGCAAAAGCAATGATGTCTTTATTACAAATTGTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAACAGAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATTAAAAAGCTAGTGTTTTGCTACAGTTTGCAGGTGAAAATAAATAATAAAACATTAGAAAAATGAAA
  5  -1   2       bld Brn2                             Brn2-za35f06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTATTCATATCAGTATTTCTAACTCTTTAACACCGTACCCGATGCTGGACAGCTGAAATGTTGCAGGTTCCGGATCCGTCACGTaaaaaaaaaaaCAGTTTTAACAATCTGGGGAGTGGGGATTGCAAAAGCAATGATGTCTTTATTACAAATTGTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAACAGAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATTAAAAAGCTAGTGTTTTGCTACAGTTTGCAGGTGAAAATAAATAATAAAACATTAG
  5   1   2      en>5                            Xl3.1-IMAGE:6957757.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTTAGTGGGAGTTCCACCAACCTGCCTTCCCTCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATCCAAGGTGCAGGGTTTGCTGTGTTTGGGCAGATCAAGCCTGTTGTTACTCCATTTGGCCAGGTTTCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGACCTTCGGGGCACAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATTTTTTTTGTATTTAAACAAAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAA
                                                  Xl3.1-CHK-1012691329                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGGAGTTxCxxCAACCTGCCTTCCCTCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATCCAAGGTGCAGGGTTTGCTGTGTTTGGGCAGATCAAGCCTGTTGTTACTCCATTTGGCCAGGTTTCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGxxxGGxACCTTCxxGGxxCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATATTTTTTGTATTTAAACAAAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAA
  5   1   2       bld Tad2                            IMAGE:6935306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCACCAGACCCGGCTAGCGACAGCCGCAGGAGCATTGGATGCCTCTTCCTTTGGCACCGCATCTCACAGCATGCCCGCTGGCTTTGGAACACAGACACCGTACAGTCTTCCTACCAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCCCTCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATCCAAGGTGCAGGGTTTGCTGTGTTTGGGCAGATCAAGCCTGTTGTTACTCCATTTGGCCAGGTTTCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTGCCTGTGCTGTACACGACTACCGATCTACTGATTAATTGTACN
  5   1   2       bld Te2                             IMAGE:7208925.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGCTAGCGACAGCCGCAGGAGCATTGGATGCCTCTTCCTTTGGCACAGCATCTCACAGCATGCCCGCTGGCTTTGGAACACAGACACCGTACAGTCTTCCTACCAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCCCTCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATCCAAGGTGCAGGGTTTGCTGTGTTTGGGCAGATCAAGCCTGTTGTTACTCCATTTGGCCAGGTTTCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATATTTTTTTGTATTTAAACAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTNAATATCATATCAGT
  5   1   2       bld Brn1      in                    IMAGE:6950648.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCGGTCCGGAATTTCCGGGATCCAGCTTTAGTGGGAGTTTCCCCAACCTGCCTTCCCTCCTCAGACAGCCTTCCCCCAACAGACTGCTTTCTCACAGCAGCCCAATGGGAATATCCAAGGTGCAGGGTTTGCTGTGTTTGGGCAGATCAAGCCTGTTGTTACTCCATTTGGCCAGGTTTCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATATTTTTTTGTATTTAAACaaaaaaaaGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCAGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTANGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCCTCGCCTTAAAGGAATGTTTTAACAATCTGAATTTCCAAAAGGAGTGAGGATTTGCAAAACCCATGACCTTCTTTTATAACAAATTTTTATTTTGTTTGACCAAAAAAA
  3   1   2       chi Eye1      in                    IMAGE:6957757.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCCCCCTTTCCATGCTTCCAACCAGACCCGGGCTAGCGACAGCGCCAGAGCATTTGGATGCCTGTGCAGGGTTTGCTGTGTTTGGGCAGATCAAGCCTGTTGTTACTCCATTTGGCCAGGTTTCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCAACTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATATTTTTTTGTATTTAAACAAAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCAACAGTTGTCAG
  3   1   2       bld Brn1      in                    IMAGE:6950648.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCGGCCCAGGGGAATTTTCCAGGGGCAGGGTTTTGCTGGTTTTGGGCAGATCAACCCTGTTGTTACTCCATTTCCCAGGTTTCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGCCGGGGGCACCTTCGGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATATTTTTTTGTATTTAAACAAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCAGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTGATATCTGCATAATA
  3   1   2       bld Te2N 5g3  in                    IMAGE:7203014.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGTGCAGTTGCTGTGTTGGCAGATCAGCNTGTGTACTCCATTGCCAGGTTCAGCTCCTGAGTCTCTAGCAATCCTTCATGGCCGGGCACCTTCGGGGCAGTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATATTTTTTTGTATTTAAACAAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTGCTACAGTTGCAGTGAAATATTAAT
  3   1   2       bld FaBN 5g3  in                    IMAGE:8074763.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTACTCCATTTGGCCAGGTTTCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCAACTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATATTTTTTTGTATTTAAACAAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTGCTACAGTTCAGGTCCAACTTATGTTT
  3   1   2      seed DMZ  5g3  in                         xl306h01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATATTTTTTTTGTATTTAAACAAAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAA
  3   1   2       bld DMZ  5g3  in                         xl328p08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATATTTTTTTTGTATTTAAACAAAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAA
  3   1   2       bld DMZ  5g3  in                         xl299a09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATATTTTTTTTGTATTTAAACAAAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAA
  3   1   2       bld DMZ  5g3  in                         xl293n22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTAGCAATCCTTTCATGGCCGGGGCAACTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATATTTTTTTGTATTTAAACAAAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCAGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGATGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCT
  3   1   2       bld DMZ  5g3  in                         xl327i16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAAGACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATATTTTTTTTGTATTTAAACAAAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTCAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAA
  3   1   2       bld Neu7      in                         XL009g24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTTAGACTAAAACAGGAGATTTCCGGGCATCACCATACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATATTTTTTTGTATTTAAACAAAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCAGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTAAAATAAATATTAAA
  3   1   2       bld Ga12 5g3  in                         XL173k21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATTTATATATTTTTTTGTATTTAAACAAAAAAAAAGGGAGGACAAACAAGGTAATACGTGCAATTGGAAAGCCTTTTAGCATCAAAACCATTCACTGCCTGAAGGTTTTACTGGCAATTGCGTAGCAGAGTGTCAGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGATGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTATCTCCATACTAAAGACTCATCTCTGCAAATAA
  5   1   2       bld Emb1                   IMAGE:6634911-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCACCGCGTCCGGTTTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGaaaataaatattaaaataaaaaaaaaaaaaaaaaaaataaaaaaaaaaaaaaa
  5   1   2       bld Emb1                            IMAGE:6634911.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTACTGGCAATTGCGTAGCAGAGTGTCCGTAGCTCCTCGACAGCAAACGGTCTAACCTGAGGCATATCATGTATATTAAATTTGGTAAGTTAATGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTTAGGGACTATTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAACTGAAACATAGCAGGTTCCGGATCCATCGCATTAAAGGAATGTTTTAACAATCTGATTTCAAAAGGAGTGAGGATTGCAAAAGCAATGACGTCTTTATAACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATCAAGCTGCCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTTACCTACCAGCACCCCGaaaaaaaaCATAAGACATTCAGATAAGGGCGGGGCGCTCCTAAAGTATCCCTTCAAGGGGCCCCCAAGCTTACGCGGAACCCCAGACTTTTCTTGGTACAAGGGCGGGTCCCCTAATAGGTGGAGGCCGGAATTTAATAAAACCTTAAGGCCAACTTGAGCCCGTCTCACGTTTTTTAACAAAACGGTTCGGCGGGAACTTGGGGGAAAAAAACCTTGGCCTCAAACCTTTGGGGCAATCCCTTTTGCAGGAAAGGGAACCCCCTTTAGCTTTTCCTTGTGGGCTGGGGGCGACACCATAAATTTGGGGAACCGAAATGCTTACACCTTACACAGAAAGAAATTTTTTAAAGAGGCTCTTCCTAAGGGGGACACATTAATTAACCAAttttttttttAAAGCGTGGCGATTAAAACGTGGGGTCGTTAACAACTCCTAACCCTGGGGAGCTATAGGGCATTCGTGCCTTCCCTTTAGAACAAACATCCTTCTTGGCCCTTCACCGCCGCACGTCTATTCGACTCTTTTCCGTTGAAAAACACAATTTTTATAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)