Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 19 Jun 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL195i17.3                            9 END     1           1       11                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012837509 Xl3.1-AGL_32C02.5.5 - 61 ESTs
                                                                       .......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-AGL_32C02.5.5                                                AGTTCCCGGTGTCAGAAGCGGAGATTCCCCGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCGCGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTTTGTCGAGGCCAAGGATAAGATGCAGAATTCAGGGCCTCAACTATATCAAAATGGATCTGTAAGTACTATAGAGAGTCTGGATATGAATCAATACCCACCTCCTCCTCTTTTTGAAGAACCTTCATCTATTTCCCAACCATTTATTGATGACTCTCTGCCTCCACCACCTGCTGATGTTGGTGCTCAACCTTCATCACATCGTTCCAGCGTGGTTAGCCCTGCCTATCCTCCTCCAGCCCCACCTATTGGTTCTCCAATAGGAAGTCGACCCAGTTTTTCACCTCCACCAGCACCTCCCCCTCCTCCACCTGATGGATCAATTCCCGATGCCCCATACCTTCCTCCACCTTCTCCTCCACCAGTATTCCCTTCATTACCAGGCTTTCCTGCCCCTCCACCTCCACCTTCAGCACCAACTCATCTTGATTATCCACCAGCCTCACCTCATTCTCCCGCACCAGCCCCTATTGCAGGCCCCCCACCACCACCTCCACCACCACCACCTCCTGGCCCTCCTCCTCCTGGACCTCCTCCACCCCCTTCCTTCTCTCATTCTGAAGGTGAATCTCCAGCACAAAGTTTAAAACCGAAGACTACCCTGCCTCCTGTAAGCGATCCTCGAAGTGACTTGCTGTCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCACGAGAAGCGCGATGTTGGTGGGAATGATGTGGCCACCATTTTATCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCCGAATTTGATGAAGATGATTGGTCTGATTGAGCCAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCAAAAAAAAAATAAAATGGAAAAATTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACACAGCAGAATAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTTGAATCTGCCTTATGTTTAAATATAGCATCATATAAAATGTTCAAT
                                                  Xl3.1-CHK-1012722225                                                      CGGTGTCAGAAGCGGAGATTCCCCGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCGCGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTTTGTCGAGGCCAAGGATAAGATGCAGAATTCAGGGCCTCAACTATATCAAAATGGATCTGTAAGTACTATAGAGAGTCTGGATATGAATCAATACCCACCTCCTCCTCTTTTTGAAGAACCTTCATCTATTTCCCAACCATTTATTGATGACTCTCTGCCTCCACCACCTGCTGATGTTGGTGCTCAACCTTCATCACATCGTTCCAGCGTGGTTAGCCCTGCCTATCCTCCTCCAGCCCCACCTATTGGTTCTCCAATAGGAAGTCGACCCAGTTTTTCACCTCCACCAGCACCTCCCCCTCCTCCACCTGATGGATCAATTCCCGATGCCCCATACCTTCCTCCACCTTCTCCTCCACCAGTATTCCCTTCATTACCAGGCTTTCCTGCCCCTCCACCTCCACCTTCAGCACCAACTCATCTTGATTATCCACCAGCCTCACCTCATTCTCCCGCACCAGCCCCTATTGCAGGCCCCCCACCACCACCTCCACCACCACCACCTCCTGGCCCTCCTCCTCCTGGACCTCCTCCACCCCCTTCCTTCTCTCATTCTGAAGGTGAATCTCCAGCACAAAGTTTAAAACCGAAGACTACCCTGCCTCCTGTAAGCGATCCTCGAAGTGACTTGCTGTCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCACGAGAAGCGCGATGTTGGTGGGAATGATGTGGCCACCATTTTATCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCCGAATTTGATGAAGATGATTGGTCTGATTGAGCCAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCAAAAAAAAAATAAAATGGAAAAATTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACACAGCAGAATAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTTGAATCTGCCTTATGTTTAAATATAGCATCATATAAAATG
                                                      consensus depths                                                     2     4     5     8     8    11    11    14    11    15    10    15    11    15    10    15    11    15    12    16    12    16    12    16    12    16    12    16    13    16    14    16    15    16    15    16    15    16    14    16    15    16    13    16    13    16    13    15    13    15    13    15    13    15    13    15    14    14    14    14    14    14    14    14    14    14    14    14    13    14    13    14    13    14    13    15    14    15    14    16    14    17    15    17    16    17    14    16    13    15    13    15    13    15    13    15    14    16    14    16    12    15    11    13    11    13    11    13    11    13    10    13     8    12     8    12     8    12     7    12     7    12     5    11     5    11     6    11     5    11     5    10     5     9     5     9     5     9     5     9     5    10     6    10     5     9     5     9     5     9     5     9     5     9     5     9     5     8     4     8     3     6     3     4     3     4     4     5     4     5     3     4     3     5     3     5     3     5     3     5     2     5     2     5     3     4     3     4     2     5     3     5     4     5     5     6     4     5     3     5     4     5     4     6     5     7     5     7     6     8     6     8     6     8     6     8     6     8     6     8     7     9     7     9     6     9     6     9     7     9     7     9     7     9     7     9     7     9     7    11     7    11     8    12     8    11     8    12     9    13     8    13     9    13     9    13     8    13     9    13     9    13     9    13     8    13     9    13    11    15    11    15    10    15    11    15    11    15    11    14    11    14    11    14    11    14    11    14    11    14    11    15    11    15     9    14    11    14    11    14    11    14    11    14    11    15    11    15    12    17    12    17    12    17    12    17    13    17    12    18    13    18    13    18    11    16    11    16    10    16    10    16    10    15    11    14    12    15    14    17    14    17    14    17    16    19    17    19    19    20    22    22    22    22    21    22    22    22    22    22    22    22    22    22    22    22    20    21    20    21    20    21    20    21    20    21    21    22    20    22    20    22    21    23    20    22    23    25    23    25    23    25    23    25    23    25    23    25    23    24    22    23    22    23    22    23    22    23    21    22    21    22    20    22    21    22    22    22    21    21    20    21    19    20    19    20    19    20    20    21    21    21    21    21    20    20    20    20    17    19    17    19    16    19    16    19    12    19    10    18     7    16     4    11     3     7     2     3
  5   1   2      ests                            Xl3.1-IMAGE:6948872.5                                                AGTTCCCGGTGTCAGAAGCGGAGATTCCCCGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCGCGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTTTGTCGAGGCCAAGGATAAGATGCAGAATTCAGGGCCTCAACTATATCAAAATGGATCTGTAAGTACTATAGAGAGTCTGGATATGAATCAATACCCACCTCCTCCTCTTTTTGAAGAACCTTCATCTATTTCCCAACCATTTATTGATGACTCTCTGCCTCCACCACCTGCTGATGTTGGTGCTCAACCTTCATCACATCGTTCCAGCGTGGTTAGCCCTGCCTATCCTCCTCCAGCCCCACCTATTGGTTCTCCAATAGGAAGTCGACCCAGTTTTTCACCTCCACCAGCACCTCCCCCTCCTCCACCTGATGGATCAATTCCCGATGCCCCATACCTTCCTCCACCTTCTCCTCCACCAGTATTCCCTTCATTACCAGGCTTTCCTGCCCCT
  5   1   2      ests                                Xl3.1-AGL_32C02.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCCCCCCACCACCACCTCCACCACCACCACCTCCTGGCCCTCCTCCTCCTGGACCTCCTCCACCCCCTTCCTTCTCTCATTCTGAAGGTGAATCTCCAGCACAAAGTTTAAAACCGAAGACTACCCTGCCTCCTGTAAGCGATCCTCGAAGTGACTTGCTGTCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCACGAGAAGCGCGATGTTGGTGGGAATGATGTGGCCACCATTTTATCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCCGAATTTGATGAAGATGATTGGTCTGATTGAGCCAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCAAAAAAAAAATAAAATGGAAAAATTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACACAGCAGAATAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTTGAATCTGCCTTATGTTTAAATATAGCATCATATAAAATG
                                               BLH ATG      39     957                                                
                                               BLH MIN      39     260                                                
                                               BLH MPR      27     260                                                
                                               BLH OVR      39      30                                                
                                               CDS MIN      39      16                                                
                                               EST CLI      10      16                                                
                                               ORF LNG      39       3                                                
                                                                                                                                                             PROTEIN === Ce ==== 4e-061     NP_493028.2 WAVE (actin cytoskeleton modulator) homolog family member (wve-1) [Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                             PROTEIN === Dm ==== 3e-069     NP_609477.1 CG4636-PA [Drosophila melanogaster] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                             PROTEIN === Ag ==== 4e-071     XP_316920.3 AGAP008518-PA [Anopheles gambiae str. PEST] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                             PREDICTED = Sp ==== 3e-081     XP_789498.2 PREDICTED: similar to ENSANGP00000006560 [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                             PREDICTED = Dr ==== 1e-115     XP_001335802.2 PREDICTED: novel protein similar to vertebrate WAS protein family, member 1 (WASF1) [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                             PREDICTED = Gg ==== 0          XP_424015.2 PREDICTED: similar to WASP-family protein [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                             PROTEIN === Mm ==== 0          NP_700472.1 WAS protein family, member 2 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                             PROTEIN === Bt ==== 0          NP_001074980.1 WAS protein family, member 2 [Bos taurus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                             PROTEIN === Hs ==== 0          NP_008921.1 WAS protein family, member 2 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                             PREDICTED = Cf ==== 0          XP_544469.1 PREDICTED: similar to WAS protein family, member 2 [Canis familiaris] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                             PREDICTED = Xt ==== 0          NP_001096496.1 hypothetical protein LOC100125121 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                 PROTEIN --- Xl ==== 0          AAH89121.1 Unknown (protein for IMAGE:6870338) [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xl3.1-AGL_32C02.5.5                                                                                       ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------TGA------------------------ATGTGA---------TAA---------------TAG------------------------------------------TAG------------------------ATG---------------TAG------------------------------------------TGA------------------------TGA------TGA------------------------------------------------------------TAG------------------------------------------------------TAATAA---------------TGA---------------------------------------------ATG---------------------------------------------------------------ATG---------------------------ATG------TAG---------TAA------------------------------TAATAA---------------TAA---------------------TAG---------------------------------------------------------------------------------TAG---------------------------TGA------------------TGA------------------------------------ATG------------------------------------------------------------------------------------------------------------TGA---TAA---------------------------TAA---------ATG------TAA---------TAA---TAG---ATG---------------TAA------------------------------------------------------------TAG---TAA------ATG---------------------ATG---------TAA------TAATAG------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2      ests                            Xl3.1-IMAGE:6948872.5                                                AGTTCCCGGTGTCAGAAGCGGAGATTCCCCGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCGCGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTTTGTCGAGGCCAAGGATAAGATGCAGAATTCAGGGCCTCAACTATATCAAAATGGATCTGTAAGTACTATAGAGAGTCTGGATATGAATCAATACCCACCTCCTCCTCTTTTTGAAGAACCTTCATCTATTTCCCAACCATTTATTGATGACTCTCTGCCTCCACCACCTGCTGATGTTGGTGCTCAACCTTCATCACATCGTTCCAGCGTGGTTAGCCCTGCCTATCCTCCTCCAGCCCCACCTATTGGTTCTCCAATAGGAAGTCGACCCAGTTTTTCACCTCCACCAGCACCTCCCCCTCCTCCACCTGATGGATCAATTCCCGATGCCCCATACCTTCCTCCACCTTCTCCTCCACCAGTATTCCCTTCATTACCAGGCTTTCCTGCCCCT
                                                  Xl3.1-CHK-1012689496                                                      CGGTGTCAGAAGCGGAGATTCCCCGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCGCGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTTTGTCGAGGCCAAGGATAAGATGCAGAATTCAGGGCCTCAACTATATCAAAATGGATCTGTAAGTACTATAGAGAGTCTGGATATGAATCAATACCCACCTCCTCCTCTTTTTGAAGAACCTTCATCTATTTCCCAACCATTTATTGATGACTCTCTGCCTCCACCACCTGCTGATGTTGGTGCTCAACCTTCATCACATCGTTCCAGCGTGGTTAGCCCTGCCTATCCTCCTCCAGCCCCACCTATTGGTTCTCCAATAGGAAGTCGACCCAGTTTTTCACCTCCACCAGCACCTCCCCCTCCTCCACCTGATGGATCAATTCCCGATGCCCCATACCTTCCTCCACCTTCTCCTCCACCAGTATTCCCTTCATTACCAGGCTTTCCTGCCCCTCCACCT
  5   1   2       bld Ga12 5g3  in                         XL200m01.5p CACGAGGGTTTAAGTGGGGTGGTGCCCGAGGTTGGTTGTGTGATAGTAGTTCCCGGTGTCAGAAGCGGAGATTCCCCGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGG
  5   1   2       chi Neu7      in                         XL039f22.5p                        CGAGGGAGCCGCGCTTCCTGTGCCGGCAGNAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTGAGTGGCACTGGGGAAAGAGAAGGGGGTGAGAGATTGAGGACTTTGTGCAGGAGGGAGTAAGAAGGTTATAGAGCTTGGGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTAGGAATGTGAATCCG
  5   1   2       bld Lu1  5g                         IMAGE:4057760.5p                                          CACGCGTCCGCCCACGCGTCCGAGCGGAGATTCCCCGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGGAAGGGGTGGAGAAAACTTCAAGTGGAAGTTGACCTCAACTGGATTCCCAAAGAGGAAGAGGGTTTTTTTCAGGGCATAAACACCCGAAAGG
  5   1   2       bld Oo1  5g                         IMAGE:3404352.5p                                              GTAGTTCCCGGTGTCAGAAGCGGAGATTCCCCGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCATGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCTCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATGCAGACCCTTCCTATTTCTTTGACTTGCGGAAGGAATAGATGCTC
  5   1   2       bld Eye1 5g3  in                    IMAGE:6948872.5p                                                 TCCGGAATTCCCGGGATCGGAGATTCCCCGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCGCGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTTTGTCGAGGCCAAGGATAAGATGCAGAATTCAGGGCCTCAACTATATCAAAATGGATCTGTAAGTACTATAGAGAGTCTGGATATGAATCAATACCCACCCTCCTCCTCTTTTTTGAAGAACCTTCATCTATTTTCCCAACCATTTAATTGATGACTCTCTGGCTTCCACCACCTGCTGAATGTGGGGGCTCAAACTTTCATCACATTCGTTTCCAGCCGTGGTTAGCCCCTGGCCTATCCTTCCTTCCAAGCCCCACCTAATGGGTTTCTCCCAAATAGGGAGAGTCGACCCCAGTTTT
  5   1   2       bld Emb4 5g                         IMAGE:5515184.5p                                                          CCCACGCGTCCGGCTTTTCCGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCGCGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTTTGTCGAGGCCAGGATAAGATGCAGAATTCANGGGCCTCACTATATCAAAATGGATCTGTAAGTACTATAGAGAGTCTGGATATGAATCANTACCCACCTCCTCCCTCTTTTGAAGAACT
  5   1   2       bld Oo1  5g                         IMAGE:6640482.5p                                                           TCAGAAGCGGAGATTCCCCGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGTATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCGCGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGGACTGGAGTTTGTCGAGGCCAAGGATAAGATGCAGAATTCAGGGCCTCAACTATATCAAAATGGATCTGTAAGTACTATAGAGAGTCTGGATATGAATCAATACCCACCTCCTCCTCTTTTTGAAGAACCTTCATCTATTTCCCAACCATTTATTGATGACTCTCTGCCTCCACCCACTGNCTGATGTTGGTGGCTCAACCTTCATCACATCGNTTCCAGCGTGGTTAGCCCTGCCTATCCTCCTCAGNCCCCACCTATTGGTTCTCCCATA
  5   1   2       bld Emb4 5g                         IMAGE:5514979.5p                                                            CAGAAGCGGAGATTCCCTGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCGCGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTTTGTC
  5   1   2       bld Emb4 5g                         IMAGE:5569839.5p                                                             AGAAGCGGAGATTCCCCGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCCAACCGTGGGAATGTGAATCCGCGCCAGATCCGCACAAGGGAAAGAAGAATGGGGAGCAAATGAAGATGGGACTGGGAGTTTGTCGAGGCCAAGGGATAAGATGCAGAATTCAGGGCCCTCAACTATATCCAAAAGGAATCCTGAAGTACTATAGAAAGTCTGGGATATGGAATCAATAACCACCTTCCTTCTCTTTTTTGAAGAAACCTTCATTCAATTTCCCCAACCATTTTATTGGAGGATTCTTCGGCCCTCCACCAACCTGGCTAAAGGTGGG
  5   1   2       bld Ga18 5g3  in                       xlk60p04ex.5p                                                                     GAGATTCCCCGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGNTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGNTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCGCGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTTTGTCGAGGCCAAGGATAAGATGCAGAATTCAGGGCCTCAACTATATCAAAATGGANCTGTAAGTNCTATAGAGAGNCTGGATNTGAATCAATACCCANCTCCTCCNCTTTTNA
  5   1   2       bld Ga18 5g3  in                      xlk109c20ex.5p                                                                      GATTCCCCGGGGACAGGATGCCTCTGGNCGCTCGATGTATTGAGCCGNGNTTCCTGTGCCGGCNGAAGNTTCCTCCTGTCCGCAGNGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGNTAGTATGTTTGCAGACCGCGTGGGGNCTCTCGGGGAAAGGGNGGAGAAANTTCAGGNGAAGGNGA
  5   1   2      seed Emb4 5g3  in                    IMAGE:4958914.5p                                                                         TCCCCGGGGACAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGG
  5   1   2       bld Egg3 5g                         IMAGE:6870338.5p                                                                                 TCCCGGGGCCTCTGGTCGCTCTCTGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGAATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCGCGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTTTGTCGAGGCCAAGGATAAGATGCAGAATTCAGGGCCTCAACTATATCAAAATGGATCTGTAAGTACTATAGAGAGTCTGGATATGAATCAATACCCACCTCCTCCTCTTTTTGAAGAACCTTCATCTATTTCCCAACCATTTATTGATGACTCTCTGCCTCCACCACCTGCTGATGNTGGTGCTCAACCTTCATCACATCGTTCCAGCGTGGGTAGCCCTGGCCTATCCNTCCTCCAAGCCCCANCCTATTGGGTTCCTCCAATAGGGAAGGTCCGACCCCAGttttttttCACCCTCCAACC
  5   1   2       bld Tbd7 5g                              XL078k14.5p                                                                                  GCAGGATGCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATC
  5   1   2       bld Emb4                            IMAGE:5572231.5p                                                                                        GCCTCTGGTCGCTCGATGTATTGAGCCGCGCTTCCTGTGCCGGCAGAAGCTTCCTCCTGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGCGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGNGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAAAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGGGAAACATATTCCTACATGGGACATGCCACCCCCCACTTTAACATCCTGTCCCCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCCTTCCTAATTTCTTTGACTTGGGGaaaaaaaaaaatgctttcaggacccccaaagacattcactaaaaaaaaaaGCGGACACCTAGGGAGAAAACAATAAAAGATCACCCCCCAACCCGTGGGAAATGTGGAATTCCGCCGCCACAATCCCGGCACAACGGAAAAGAAAGAAAGGGGGCAAAAAACCGCAACGATGGGGACCCGGAAAATCTGCCCCGAAGGGCCAACGGGTTAAGGAATGCCACAAATTCCCGCGCGGGCCTCGAACTTAACACCCCAAAAATCGGGATCCCGTTAAGCGCCACCCAAAATAGAGAGGACCCCCGGGAAATATTGAAAACAAGTTGACGCCCGCGCGCCCCGTTCTCCGCGTTTTCTTTGAAAAAAACCCCCGCTAGAACCGAAAATTCTCCCGCACGCCTGATTTTTTTGGCGATCGCAAGNTTTTCGGGCGCGCCTGTTCAACAGCGCCCGGTGTCGCAATGAATTTGGGAGACGCCTCAACCACTTGTGTGCACAAAACACCCTGAGTGATCCCGCCCCTGTAGGCCTACATATACACACGCCGCCCGACGAATCAGTCCCTGACTCGCGGACAACACGAGCCCCA
  5   1   2       bld Egg5      in                    IMAGE:3431033.5p                                                                                                                                                  TGTCCGCAGTGAACTGGAATGTATGACAAACCTGACTCTGTCCAATGTCATCCGCCAGCTTGGAAGCCTAAGTCACTATGCAGAAGATATATTTGGAGAGCTTTTTAGCGAGGCTAGTATGTTTGCAGACCGCGTGGGGTCTCTCGGGGAAAGGGTGGAGAAACTTCAGGTGAAGGTGACTCAACTGGATCCCAAAGAGGAAGAGGTCTCTCTTCAGGGCATAAACACCCGAAAGGCATTCCGAAGTAACACCTCACAGGACCAGCAACTGTTTATACGTGACTCTCTGTCCCTCCCAGTGCGTGAAACATATTCTACATGTGACATGCCACCCCCACTTAACATCCTGTCACCATATAGAGATGATGAAAGGGAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCGCGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTNTGTCGAGGCCAAGGATAAGATGCAGAATTCAGGGGCCTCACTATATCAAAATGGATCTGTA
  5   1   2       bld Emb1      out                   IMAGE:3402962.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGGGGAAGTCGCTATGCAGAAGATGAAAAGGAGGCCCTTAAGTTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGGTTCAGGACACCAAAGACATCATCAAAGAGAAGCGGAAACATAGGAAAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCACGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTTTGTAGAGCCCAAGGATAAGATGCAGAATACAGGGCCTCAACCATATCAGAATGGATCTTTGTATACCAAAGAGAGTCCGGAAATGAATCAGTACCCACCTCCTCCTCCCTTTGAAGAGCCTTCATCTATTTCCCAATCATTTATTGATGACTCTCTGCCTCCACCACCTGCTGATGTCAGTGGTCAACCTTTATCACATCGTTCCAGTTTGGTTAGCCCTACCTGTCCTCCTCCAGCCCCACCAATTGGTTCTCCAACAGGAAGTCGACCCAGTTTTTCACCTCCC
  5   1   2       bld Tbd7      in                         XL083l17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGGAGGCCCTTAAATTTTATACAGNACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCGCGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTTTGTCGAGGCCAAGGATAAGATGCAGAATTCAGGGCCTCAACTATATCAAAATGGATCTGTAAGTACTATAGAGAGTCTGGATATGAATCAATACCCACCTCCTCCTCTTTTTGAAGAACCTTCATCTATTTCCCAACCATTTATTGATGACTCTCTGCCTCCACCACCTGCTGATGTTGGTGCTCAACCTTCATCACATCGTTCCAGCGTGGTTAGCCCTGCCTATCCTCCTCCAGCCCCACCTATTGGTTCTCCAATAGGAAGTCGACCCAGTTTTTCACCTCCACCAGCACCTCCCCCTCCTCCACCTGATGGATCAATTCCCGATGCCCCATACCTTCCTCCACCTTCTCCTCC
  5   1   2       bld DMZ       in                         xl268j12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGCCCTTAAATTTTATACAGACCCTTCATATTTCTTTGACTTGTGGAAAGAAAAAATGCTTCAGGACACCAAAGACATCATAAAAGAGAAGCGGAAACATAGGAGAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCGCGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTTTGTCGAGGCCAAGGATAAGATGCAGAATTCAGGGCCTCAACTATATCAAAATGGATCTGTAAGTACTATAGAGAGTCTGGATATGAATCAATACCCACCTCCTCCTCTTTTTGAAGAACCTTCATCTATTTCCCAACCATTTATTGATGACTCTCTGCCTCCACCACCTGCTGATGTTGGTGCTCAACCTTCATCACATCGTTCCAGCGTGGTTAGCCCTGCCTATCCTCCTCCAGCCCCACCTATTGGTTCTCCAATAGGAAGTCGACCCAGTTTTTCACCTCCACCAGCACCTCCCCCTCCTCCACCTGATGGATCAATTCCCGATGCCCCATACCTTCCTCCACCTTCTCCTCCACCAGTATTCCCTTCATTACCAGGCTTTCCTGCCCCTCCACCTTCAGCACCAACTCATCTTGATTATCCACCAGCCTCACCTCATTCTCCCGCACCAGCCCCTATTGCAGGCCCCccaccaccacctccaccaccaccaccacca
  3   1   2       bld Tbd4                            IMAGE:4059960.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAAGAGAAGAAAGATAACCCCAACCGTGGGAATGTGAATCCACGCAAGATCCGCACAAGGAAAGAAGAATGGGAGAAAATGAAGATGGGACTGGAGTTTGTAGAGCCCAAGGATAAGATGCAGAATACAGGGCCTCAACCATATCAGAATGGATCTTTGTATACCAAAGAGAGTCTGGAAATGAATCAGTACCCACCTCCTCCTCCCTTTGAAGAGCCTTCATCTATTTCCCAATCATTTATTGATGACTCTCTGCCTCCACCACCTGCTGATGTCAGTGGTCAACCTTTATCACATCGTTCCAGTTTGGTTAGCCCTACCTGTCCTCCTCCAGCCCCACCAATTGGTTCTCCAACAGGAAGTCGAGCCTCTAGAACTATAGTGA
  5   1   2       bld Thy       in                    IMAGE:8549168.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCACCTGCTGATGTTGGTGCTCAACCTTCATCATTTCGTTCCAGCGTGGTTAGCCCTGCCTATCCTCCTCCAGCCCCACCTATTGGTTCTCCAATAGGAAGTCGACCCAGTTTTTCACCTCCACCAGCACCTCCCCCTCCTCCACCTGATGGATCAATTCCCGATGCCCCATACCTTCCTCCACCTTCTCCTCCACCAGTATTCCCTTCATTACCAGGCTTTCCTGCCCCTCCACCTCCACCTTCAGCACCAACTCATCTTGATTATCCACCAGCCTCACCTCATTCTCCCGCACCAGCCCCTATTGCAGGCCCCccaccaccacctccaccaccaccaccaccaccTCCTGGCCCTCCTCCTCCTGGACCTNNTNNNNNNCCTTCCTTCTCTCNTTCTAAAGGTAAATCTCCCCCACAAAGTTTAAAACCTAAAACTACCCTGCCTCCTGTAANCAATCCTCNAANTGACTTGCTGTCTGCAATCCGTGAAGGGTTCCAGCTACNAAAGGTAGAAGAAAAAATGGAGCACGAGAAGCGCGATGTTGGTGGGAATGATGTGGCCACCATTTTATCTCGTACAATTGCAATGGAATAGAGTGACTCTGAGGATGATTCTTCCGAATTGATGAANATGATGGTCGATTGGCCAATATGAATAACGAGGGAATTGATAGCATTAGAAAAATCTCTGAAAATTGTTTGTTAAGAGACTANAGCTTGATGTAGGATGCCAAAAATAAAGGAAAATTTTCTGGAAGTGTAGTTGTTGGGACACATATTTTTCCATTCCGGGAAAAACCATAAAGCTTTAAGGGTACCAAAACTACATGGT
  5   1   2      ests                                Xl3.1-AGL_32C02.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCCCCCCACCACCACCTCCACCACCACCACCTCCTGGCCCTCCTCCTCCTGGACCTCCTCCACCCCCTTCCTTCTCTCATTCTGAAGGTGAATCTCCAGCACAAAGTTTAAAACCGAAGACTACCCTGCCTCCTGTAAGCGATCCTCGAAGTGACTTGCTGTCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCACGAGAAGCGCGATGTTGGTGGGAATGATGTGGCCACCATTTTATCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCCGAATTTGATGAAGATGATTGGTCTGATTGAGCCAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCAAAAAAAAAATAAAATGGAAAAATTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACACAGCAGAATAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTTGAATCTGCCTTATGTTTAAATATAGCATCATATAAAATG
                                                  Xl3.1-CHK-1012687211                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACCACCACCTCCACCACCACCACCTCCTGGCCCTCCTCCTCCTGGACCTCCTCCACCCCCTTCCTTCTCTCATTCTGAAGGTGAATCTCCAGCACAAAGTTTAAAACCGAAGACTACCCTGCCTCCTGTAAGCGATCCTCGAAGTGACTTGCTGTCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCACGAGAAGCGCGATGTTGGTGGGAATGATGTGGCCACCATTTTATCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCCGAATTTGATGAAGATGATTGGTCTGATTGAGCCAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCAAAAAAAAAATAAAATGGAAAAATTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACACAGCAGAATAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTTGAATCTGCCTTATGTTTAAATATAGCATCATATAAAATGTTCAAT
  5   1   2       bld Egg1                               PBX0077A11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCACGAGGCCGATGCCCCATACCTTCCTCCACCTTCTCCTCCACCAGTATTCCCTTCATTACCAGGCTTTCCTGCCCCTCCACCTCCACCTTCAGCACCAACTCATCTTGATTATCCACCAGCCTCACCTCATTCTCCCGCACCAGCCCCTATTGCAGGCCCCccaccaccacctccaccaccaccacctcctggccctcctcctcctggacctcctccacccccttccttctctcATTCTGAAGGTGAATCTCCAGCACAAAGTTTAAAACCGAAGACTACCCTGCCTCCTGTAAGAGATCCTCGAAGTGACTTGCTGTCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCACGAGAAGCGCGATGTTGGTGGGAATGATGTGGCCACCATTTTATCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCCGAATTTGATGAAGATGATTG
  3   1   2       bld Ga18 5g3  in                       xlk60p04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACCAGTATTNCNNNTNNANTACCANGNTTTCCNNNCCCCTNCNNCCNCNNNCCTTCAGNNCCAACTCATCTTGNTTNNCCNCCAGCCTCACNTCATTCTCCCNNACCAGCCCNNATTGNAGGCCCCCCACnACCACCTCCACnnCCACCACCTCCTGGCCCTCCTCCTCCTGGnCCTCCTCCACCCCCTTCCTTCTCTCATTCTGAAGGTGAATCTCCAGCACAAAGTTTAAANCCGAAGACTACCCTGCCTCCTGTAAGCGATCCTCGAAGTGACTTGCTGTCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCACGAGAAGCGCGATGTTGGTGGGAATGATGTGGCCACCATTTTATCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCCGAATTTGATGAAGATGATTGGTCTGATTGAGCCAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCAAAAAAAAATAAAATGGAAAAATTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGNNNNNGNAACAATATGNNNTC
  5   1   2       bld Bone                            IMAGE:8743427.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGAGCGGCCGCCCCTATTGCAGGCCCCccaccaccacctccaccaccaccaccaccacctcctggccctcctcctcctggacctcctccacccccttccttctctcATTCTGAAGGTGAATCTCCAGCACAAAGTTTAAAACCGAAGACTACCCTGCCTCCTGTAAGCGATCCTCGAAGTGACTTGCTGTCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCACGAGAAGCGCGATGTTGGTGGGAATGATGTGGCCACCATTTTATCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCCGAATTTGATGAAGATGATTGGTCTGATTGAGCCAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCaaaaaaaaaataaaatggaaaaaTTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACACAGCAGACTAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTACAATACTAACAGGTAGACTTTTGCTGAGAGATCATTACCTGCAGGTATCCCTATGATGACCACCAGCATGCACTAGAGGAGGTCATGGCATATGTACGTTCTTTCCAGATAACGATGGGGATCTGCATGTGGGGTATAAAATATCCCGTGGCCGTGGAAAGTTATGGCA
  3   1   2       bld Egg5      in                    IMAGE:3431033.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGGCACCACCACCACCACCACTTCCTGGCCTTCATCNTCCTGGACCTCCTCCACCCCCTTCNTTCTCTCATTCTGAAGGTGAATCTCCAGCACAAAGTTTAAAACCGAAGACTACCCTGCCTCCTGTAAGCGATCCTCGAAGTGACTTGCTGTCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCACGAGAAGCGCGATGTTGGTGGGAATGATGTGGCCACCATTTTATCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCCGAATTTGATGAAGATGATTGGTCTGATTGAGCCAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGTAGTGTAGGGCAATGGTCAAA
  3   1   2       bld Ga18 5g3  in                      xlk109c20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCCCTNNTNTCTCNTTCTGANNGNGNATCTCCAGCNCAAAGTTNAAAACCNGAAGACTNCCTNCCTCCTGTAAGCGATNCTCGNANTGNCTTGCTGTCTGNAATCCGTGNAAGGGTTCCAGCTACGAAAGGTANNAGAAAAAATGGANNNCGAGAAGCGCGATGTTGGTGGGAATGATGTGGCCACCATTTTATCTCGTAGAATTGCAGTGGAATATAGTGNCTCTGAGGATGATTCTTCCGAATTTGATGAAGATGATTGGTCTGATTGAGCCAATAATGAAAGANCCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCAAAAAAAAAATAAAATGGAAAAATTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTNCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACACAGCAGAATAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTNNCCCTGNCCTGAAATGTNGCATA
  5   1   2       bld Tail                            IMAGE:8543525.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCATTCTGAAGGTGAATCTCCAGCACAAAGTTTAAAACCGAAGACTACCCTGCCTCCTGTAAGCGATCCTCGAAGTGACTTGCTGTCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCACGAGAAGCGCGATGTTGGTGGGAATGATGTGGCCACCATTTTATCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCCGAATTTGATGAAGATGATTGGTCTGATTGAGCCAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCaaaaaaaaaataaaatggaaaaaTTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACACAGCAGAATAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCAGATAAAGGAAT
  5   1   2       bld Ga15      in                       XL489i08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCAGCACAAAGTTTAAAACCGAAGACTACCCTGCCTCCTGTAAGCGATCCTCGAAGTGACTTGCTGTCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCACGAGAAGCGCGATGTTGGTGGGAATGATGTGGCCACCATTTTATCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCCGAATTTGATGAAGATGATTGGTCTGATTGAGCCAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCaaaaaaaaaataaaatggaaaaaTTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCNCCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACNCAGCAGAATAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGNGCTGCTTTAAAATAATAACAGGTANACTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACNCCCAGCATGCAGCTANAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAG
  5   1   2       bld Ga15      in                       XL429g20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   gaaaggattgacagattgatagctctttctcgattctgtgggtggtggtgcatggccgttcttagttggtggagcgatttgtctggttaattccgataacgaacgagactcctccatgctaactagttacgcgacccccgGCTGATGAAGATGATTGGTCTGATTGAGCCAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCaaaaaaaaaaataaaatggaaaaaTTTTATTCCTAGGGANAAAGNGNGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCNCCAATTTCNCCCTGATGGGTATGACAAAATGCCCCNCTTATANAGNGCCANCNTTTCAATAGAGNGATATATTACNC
  5   1   2       bld Tbd7      in                         XL109f05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTGGAATATAGTGACTCTGNGGATGATTCTTCCGAATTTGATGAAGATGATTGGTCTGATTGAGCCAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCaaaaaaaaataaaatggaaaaaTTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACACAGCAGAATAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTT
  5   1   2       bld Tbd7      in                         XL108f05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGGAATATAGTGACTCTGAGGATGATTCTTCCGAATTTGATGAAGATGATTGGTCTGATTGAGCCAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCaaaaaaaaataaaatggaaaaaTTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACACAGCAGAATAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTC
  3   1   2       bld Ga15      in                       XL489i08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCCGAATTTGAGGAAGANGATTGGTTTGATTGAGCCNATAATGAAAGAACCNAGGGAATGTGNTTATGCAGTTAAGAGAAGNATCATCTGNAGATATTNCTTTTGNTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCNATGGNCAAAAAAAAAATAAAATGGAAAAATTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACACAGCAGAATAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCAT
  5   1   2       bld Emb1                            IMAGE:6632799.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACGCGTCCGCAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCaaaaaaaaaaataaaatggaaaaaTTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACACAGCAGAATAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGGAAATGGAATCACTGTTTGAAATATATTTGTTAACAAACTGTGGCATAAACCAAAGGGATGGGGGGAGGTCCCCAGAAATCCTGGTGGCATATGGTACAAGCAAAACCAATTCCTAATTCCTAAAATAATTAATTCCTGGGCCCTGGNAAAgggggttggggggCCCCAATTAAAAACCTCTCCT
  5   1   2      seed Unk4                                AGL_32C02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAATAATGAAAGAACCAAGGGAATGTGATTATGCAGTTAAGAGAAGAATCATCTGTAGATATTACTTTTGTTTAAGGATTACATAGAAAGCTATGAAGTGTAGGGCAATGGTCaaaaaaaaaataaaatggaaaaaTTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACACAGCAGAATAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAACCTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTGATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTTGAATCTGCCTTATGTTTAAATATAGCATCATATAAAATGTTCAATTGC
  5   1   2       bld Ga15      in                       XL518e13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGGCAATGGTCaaaaaaaaaataaaatggaaaaaTTTTATTCCTAGGGAGAAAGNGNGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGNGCCAACATTTCAATAGAGNGATATATTACNCAGCAGAATANATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGNGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGANAGATCAATTACCCTGCAGGTATCCCTATTGATGACACNCCCAGCATGCAGCTAGAGGAGTTCAGNGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGNGATCTGCATGNGGGTAATANATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATANAACCTGCAACATCATCATAAAAGTTCCATAGNGCTGCAGTTCTGGTTTAATCTGNGCTGTTCTGCATGTTTACTGGTAACGTACCACAGAAAGATCAAAGTGAAGCA
  3   1   2       chi Ga18                             rxlk131g06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ANGTCAAAANAATNAAATNNAAANNTTNNNNNNGGAGNAANNNTGATANNNNNNTTTNGGGGCAAGCANNNTATGNTTTCTNTTTCNNNNATTTCTNCCTGATGGGTATGACAAAATNNCCNCTTATAGAGNGCCAACATTTCAATAGAGTGATNTNTTACACAGCANNATAGATAAACGTCTATTNNACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCAATTACCCTGCAGNTATNCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTNCCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGNNNNNNCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTANNNNCAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTTGANTCNCCTTANNTTTAAATANA
  5   1   2       bld Tbd5                            IMAGE:3579786.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAAAATGGAAAAATTTTATTCCTAGGGAGAAAGTGTGATATGTTTAGTTTTGGGGCAAGCAACAATATGATTTTCTATTTCACCAATTTCTCCCTGATGGGTATGACAAAATGCCCCACTTATAGAGTGCCAACATTTCAATAGAGTGATATATTACACAGCAGAATAGATAAACGTCTATTGCACACATTCCTGTAGGTTTTTCGTTGGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAA
  3   1   2       bld Ga18                              rxlk72g15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTNNTTNGGGGCANGCANNATATGNTTTCTNTTNCACCNATTTCTCCCTGATGGGTANGANAAAANNCCNNCTTATAGAGNNCCAACATTTCAANNGAGTGATATNTACNCAGCAGAATAGATAAACGTNTATTNNNNNNNTTCCTGTAGGTTTTTCGTNGTGCTGCTTTAAAATAATAACAGGTAGACTTTTGCTGAGAGATCANTTACCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGNNCTNCCCGCCATAGANCCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTANNNNCAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTTGANTCTNNCTTANGTTTAAATA
  3   1   2       bld Eye1 5g3  in                    IMAGE:6948872.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGAGGTTTTTTTTCGTGGGGGGGGGCGCGGCTTTTAAAAAAATAAAAAACACCCGGGGTGGGATTTTTGTGGGGGGAGAAAGATTCAAATTACCCCCCGGCCAGGGTATCCCCCTTATTGGATGACCACCACCCCGGCCTGTCAGGCTAAGAAGGAGGTTCAAGTGGGCAATTTTGTTCCCTTTTCTTTTCCCAGGATAAAGGGAATTGTGAATCTGCATGGGGGTTAATAGATTTATCCCCTGGGCTTGAAATGTTTGGCATAGAATGTTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATATTTAATAACGATGGCTTCCATTTTAACCCTTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTTGAATCTT
  5   1   2       bld Ga12      in                         XL156o22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGCTGCTTTAAAATATAACAGGTAGACTTTTGCTGAGAGATAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTAT
  5   1   2       bld Egg1                               PBX0047B08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGAGGCTTTTGCTGAGAGATCAATTACCCTGCAGGTATCCCTATTGATGACACACCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACT
  3   1   2       bld Ga15      in                       XL518e13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAGAGATCAATTACCCCTGCCAGGTATCCCTATTGGATGACACACCCCAGCATGCAGCTAGAGGAGTTCAGTGGCATATTGTACCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTGAATCTGCCT
  3   1   2       bld Ga15      in                       XL429g20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCTAGAGGAGNTTCAGGTGGCATATTGTACCCTTTCTTTTCCAGATAAAGGAATTGTGATCTGCATGTGGGTAATAGATTATCCCTGGCCTGAAATGTTTTGCATAGATTGTTTTCTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTTGAATCTGCCTTATGTTAAA
  5   1   2       bld Emb1                            IMAGE:6630715.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTAAATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTNGGAAATCTGTTATTTTGAATCTGCCTTATGTTTNAATATAGCATCATATAAAATGTTCAATTGCCTTCNNNAAAGAGAANATTNNNNANAANANAnnnnannnnnnnnnnnnaaaaannnaaaaaaaggnaccccttnnaaaaaaaannaaaaaaanaaaaGGGGGGCCGCTTTTAAAGATTCCCTTCGAGGGGCC
  3   1   2       bld Tbd7      in                         XL108f05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATCAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAANATTTTTACCGGAAATCTGTTATTTGAATCTGCCTTATGTTTAAATATAGCATCATATAAAAT
  3   1   2       bld Tbd7      in                         XL109f05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAAGTAATTTTTTTGCAAACTATACTTAATAACGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATNATTTTTACCGGAAATCTGTTATTT
  3   1   2       bld DMZ       in                         xl268j12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTTGAATCTGCCT
  3   1   2       bld Neu7      in                         XL039f22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATNATTTTTACCNGAAATCTGTTATTTNAATCGCCTTATGTTTAAATATAGCATCATATA
  3   1   2       bld Ga12      in                         XL156o22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGCTTCCATTTTAACCCTTTTGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTANGGC
  3   1   2       bld Ga12 5g3  in                         XL200m01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCCATTTTAACCCTTTNGTTGCTGCCCGCCATAGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTGAATCTGCCTTAGNNTAAATATAGCA
  5   1   0       chi Egg1                               PBX0163B02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACGAGGTTACACATGAGCTGTTTTACTCCGTATCTTTTAATAGAGACCTACATTGTTTGGGGGTATAGTTTTCCTTTAAAAGTTCCATAGTGCTGACCGTGTTAGTCCTGCAGTTTTGGTTTGTGCTGTTCAAAGAGAAGCCAGAATGAGAATATGAAATATAATGGTTATAGAACTGTGTAATAAACAAAGGAAGGGTTTGGTCCCAGAAATCTATGCATATGTACAGCAAAAATATATTCTAAAAATCATTACGTTTGTAGTGGTTGCGCCCATATATGTGTGGGAGAAATCTTAAGTGAAACTAATATTGGGTACAGTATCAGTCTCACTTTATTGTGACTTGGTATAATGTAATCCTAAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTTAAGTATGTGTTTATGCAGGTATAATTCTACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTACTAGACACA
  3   1   2       bld Tbd7                                 XL063o22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGCTGCCCGCCATAGAACNTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATNATTTTTACCGGAAATCTGTTATTTTGAATCTGCCTTATGTTTAAATATAGCATCATATAAAAT
  5   1   2       bld Egg3      in                    IMAGE:3377951.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGGAACCTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACGCACACACATATCTATAAG
  3   1   2       bld Tbd7                                 XL097e09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGCAACATCATCATAAAAGTTCCATAGTGCTGCAGTTCTGGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTNCAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTANCAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTNGTATAAGTTTTGTTAATGATTTTTACCTGGNAATCTGTTATTTGACATCTGCCTTATGTTTNAATATAGCATCATAT
  5   1   2       bld Egg3                            IMAGE:3378784.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGCATAAAAGTTCCATAGTGCTTTAGTTCTTGTTTAATCTGTGCTGTTCTGCATGTTTACTGGTAACGTAGCACAGAAAGATCAAAGTGAAGCAAGAATGAGAAAATGAAATCACTGTTTGAAATATATTTGTTACAAAACTGTGCAATAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATT
  3   1   2       bld Ga15      out                      XL463d21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGTTAGTCCTGCAGTTTTGGTTTGTGCNGTTCAAAGAGAAGCCNGAATGAGNATATGAAATATAATGGTTATAAAACTGTGTAATANACAAAGGAAGGGTTTGGTCCCAGAAATCTATGCATATGTACAGCAAAAATATATTCTAAAAATCATTACGTTTGTAGTGGTTGCGCCCATATATGTGTGGGAGAAATCTTAAGTGAAACTAATATTGGGTACAGTATCAGTCTCACTTTATTGTGACTTGGTATAATGTAATCCTAAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTTAAGTANGTGTTTATGCAGGTATAATTCTACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTACTAGACACACACAATTACGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGCACAGCTCTGCTCTGCCTGTTTGTATATGTTATNTGNTAANGATTTTTTNCCCTGGAAATGTTATTTTGTATCTGCCTTA
  3   1   2       bld Thy       in                    IMAGE:8549168.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAACAAAGGATGGGGGAGGTCCCAGAATCCTGTGCATATGTACAGCAAACAATTTATTTTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTTTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTTGGTAAAAAATC
  3   1   2       bld Egg3      in                    IMAGE:3377951.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAATCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACCCGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGA
  3   1   2       bld Emb4 5g3  in                    IMAGE:4958914.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTATTCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTTGAATCTGCCTTATGTTTAAATATAGCATCATATAAAATGTTCAATTGCA
  3   1   2       bld Egg6                            IMAGE:4432943.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTAAATATTATTCTGTCTGTAGTGGTTGTGCCAATAAAACTACATTTGGGAGAAGTGTTAAGTGAAACTAATATTGGATTACTATATTAGTTTCACTTTAAAGTGACTTAATGGTGGCATAATGTAATCTTTAATACTAGCCTATGCAACAATCCTCTATTTAACAATTCTTGCTAAGTGTGTGTTTATGCAGGTATTTTTCTACACACACACATATCTATAAGTAGCTTTAACTAAGTATGATTTTATTATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTTGAATCTGCCTTA
  3   1   2       bld Tbd7      in                         XL083l17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTAGACACGATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTTTGGAACAAGTGCTGTATGGCACAGCTCTACTCTGCCTGCTTTGTATAAGTTTTGTTAATGATTTTTACCTGGAAATCTGTTATTTTGAATCTGCCTTATGTTTAAATATAGGCATCATAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)