Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7980842.5                      20 PI      89        191      811                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:3198351.3                      17 PI      81       1030     1641                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:8077725.5                       7 PI      78        319      588                hypothetical protein LOC398948 [Xenopus laevis]

 This cluster: approximate FL confidence score = 91%

 1012837527 Xl3.1-IMAGE:5078696.5.5 - 45 ESTs
                                                                       ........-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:5078696.5.5                                                                                                                                                                                                       GCACTGACACATACACACCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCATACAATACACCCACCATACATACACCACTATACAATACTCCCACCATACATACACCACCATACAATACACCCACACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCCTGCTGCTGCCGCTGCTGCTGCACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCAACCCAGCAGGGATGGAAGTCTCGTCAGTTTTGTTAGAACTCTTGGGTTCCTTTATATTTTTTTTTTGAGGATTTCATTTTGCACTCTCCATGAACTGATGTGCCAACTAGTTTTAGTCGATCTAACCCATGGACCAGTCATCCAACATTAAGATGTTTTGGTCCACTCCTTTATTCTTCAATACATCGGACTGATTCAGCTACATCAAAGAAAAAGACTGCATAGGTTAAAATGAGCATGGCTGTTGCCGTACAAAATAATGTACCATTCATTGGTGGGCATGGGAGGGTTTGCATGTTTTCTAGCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCTTCAGTTTTCATGTCTTTAGTTTTGTCCTTTCATTTTCATTGGAGAGTTTTTGTTCTTGCCATGTGTAATGCAACCTTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCATTTTTTGTTGGTTTTTTTTGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGTTTGTCTGCTGTACTTTATGAACAATTGTGCAACTTTTGTGTTCCATTTTGCATTCTGCCTGATATTTCAGTATTATGAAAGATGTCTTGCCGGTACAGAGATGAATTTTCTCTTGCTGAATTTATGAGAATGTGATAATGGATTAAAAAATAT
                                                  Xl3.1-CHK-1012721772                                                                                                                                                                                                             ACACATACACACCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCATACAATACACCCACCATACATACACCACTATACAATACTCCCACCATACATACACCACCATACAATACACCCACACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCCTGCTGCTGCCGCTGCTGCTGCACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCAACCCAGCAGGGATGGAAGTCTCGTCAGTTTTGTTAGAACTCTTGGGTTCCTTTATAATTTTTTTTTGAGGATTTCATTTTGCACTCTCCATGAACTGATGTGCCAACTAGTTTTAGTCGATCTAACCCATGGACCAGTCATCCAACATTAAGATGTTTTGGTCCACTCCTTTATTCTTCAATACATCGGACTGATTCAGCTACATCAAAGAAAAAGACTGCATAGGTTAAAATGAGCATGGCTGTTGCCGTACAAAATAATGTACCATTCATTGGTGGGCATGGGAGGGTTTGCATGTTTTCTAGCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCTTCAGTTTTCATGTCTTTAGTTTTGTCCTTTCATTTTCATTGGAGAGTTTTTGTTCTTGCCATGTGTAATGCAACCTTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCATTTTTTGTTGGTTTTTTTTGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGTTTGTCTGCTGTACTTTATGAACAATTGTGCAACTTTTGTGTTCCATTTTGCATTCTGCCTGATATTTCAGTATTATGAAAGATGTCTTGCCGGTACAGAGATGAATTTTCTCTTGCTGAATTTATGAGAATGTGATAATGGATTAAAAxATATACAAAA
                                                      consensus depths                                                                                                                                                                                                            4    10     8    16    13    23    13    23    14    23    20    23    20    23    22    24    22    24    22    24    22    24    22    25    24    25    24    26    25    27    25    27    25    27    25    27    25    27    25    27    25    27    25    27    25    27    25    27    25    28    25    28    25    29    26    29    27    29    26    29    28    31    27    31    28    31    28    31    28    31    29    32    29    32    27    30    27    30    27    31    27    30    27    30    25    30    26    29    26    29    26    29    24    28    24    28    23    29    25    29    24    28    22    27    22    27    21    27    20    27    18    25    17    24    15    22    14    23    11    23    12    22    11    22    11    21    11    21    12    21    12    21    10    22     9    22     9    22     7    22     6    19     6    16     5    16     4    15     7    13     7    13     7    11     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7     9     7     8     7     8     9     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9    10    11    10    11    11    12    11    12    11    12    11    12    11    12    10    11    10    11    10    11    10    11    10    11     6    11     6    11     6    11     6    11     6    11     6    10     6    10     7    11     8    12     8    12     8    12     7    12     7    11    10    11     7    11     7    11     7    11     7    11     7    11     6    11     7    11     6    10     6    10     5    10     5    10     5    10     4    10     4     9     4     9     4     9     4     9     4     7
  5   1   2      ests                            Xl3.1-IMAGE:5078696.5                                                                                                                                                                                                     TAGCACTGACACATACACACCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCATACAATACACCCACCATACATACACCACTATACAATACTCCCACCATACATACACCACCATACAATACACCCACACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCCTGCTGCTGCCGCTGCTGCTGCACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCAACCCAGCAGGGATGGAAGTCTCGTCAGTTTTGTTAGAACTCTTGGGTTCCTTTATAATTTTTTTTT
  5   1   2      ests                            Xl3.1-IMAGE:6950098.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACTCTTCGGTTCCTTTATAATTTTTTTTTTTTGAGGATTTCATTTTGCACTCTCCATGAACTGATGTGCCAACTAGTTTTAGTCGATCTAACCCATGGACCAGTCATCCAACATTAAGATGTTTTGGTCCACTCCTTTATTCTTCAATACATCGGACTGATTCAGCTACATCAAAGAAAAAGACTGCATAGGTTAAAATGAGCATGGCTGTTGCCGTACAAAATAATGTACCATTCATTGGTGGGCATGGGAGGGTTTGCATGTTTTCTAGCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCTTCAGTTTTCATGTCTTTAGTTTTGTCCTTTCATTTTCATTGGAGAGTTTTTGTTCTTGCCATGTGTAATGCAACCTTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCATTTTTTGTTGGTTTTTTTTGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGTTTGTCTGCTGTACTTTATGAACAATTGTGCAACTTTTGTGTTCCATTTTGCATTCTGCCTGATATTTCAGTATTATGAAAGATGTCTTGCCGGTACAGAGATGAATTTTCTCTTGCTGAATTTATGAGAATGTGATAATGGATTAAAAAATATA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -A----------
                                               BLH ATG     276     557                                                                                                                                                                                                       
                                               BLH MIN     276     104                                                                                                                                                                                                       
                                               BLH OVR     276      43                                                                                                                                                                                                       
                                               EST CLI       5      20                                                                                                                                                                                                       
                                               ORF LNG     276       1                                                                                                                                                                                                       
  5   1   2      ests                            Xl3.1-IMAGE:5078696.5                                                                                                                                                                                                     TAGCACTGACACATACACACCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCATACAATACACCCACCATACATACACCACTATACAATACTCCCACCATACATACACCACCATACAATACACCCACACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCCTGCTGCTGCCGCTGCTGCTGCACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCAACCCAGCAGGGATGGAAGTCTCGTCAGTTTTGTTAGAACTCTTGGGTTCCTTTATAATTTTTTTTT
                                                  Xl3.1-CHK-1012687738                                                                                                                                                                                                           TGACACATACACACCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCATACAATACACCCACCATACATACACCACTATACAATACTCCCACCATACATACACCACCATACAATACACCCACACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCCTGCTGCTGCCGCTGCTGCTGCACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCAACCCAGCAGGGATGGAAGTCTCGTCAGTTTTGTTAGAACTCTTGGGTTCCTTTATAATTTTTTTTTTGAGGA
  5   1   0       add Brn1      in                    IMAGE:6950839.5p CCGGAATTTCGGGATCGATGTTTGCTTTTGATTGTGCACTACTTGGTTGAATGGGTTCAGTGAAGACATTTTAGCTGCCTATAAAGTTTATATGTTGCTAAACATGTGTTCAAGTGTGCCACTATCACTAGTCTTAGTTGTAGGTGCTGACTCTTAAGGTGGCCATAGACGCACAGATAATATCGTACGAAACGAATTTTCGTCCGATATTCGTTGCGTGTATGGTGGAAAAAGAACCGACCGATATCGGCAGAAGACTTGGATATCGGTCGGCTCGTCGATCCTACACGTGTGTATTGAAACGAACGATCTTTCTTGGAAAGATCTTTTCCAAGAAAGATCGTAATTGTTACGTCTATGGCCACCTTTACCTGCACATATGACATCTTTCCTTCCCACTGAAAGACAGGTGAACTAAAATTGTGTGGTTCTAATAAAGGCGTCCTATCCCTTTGCCTTATGCTTTGAGCTCAAGGGAAATGTGCCATGGGGATGGGGTTGCAACATTTGACTGGTTCAGGAGCCCTTAGGTCAAAAACAGGTAACTGGtttattttttctttccttttctttGCCTGAGCTGGGGGTCAAACTGCAGTGAAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCCAGTTGGCTTTGTCACATTTTGATAATAGGGCACGGAGCCTGAAGCTGCCAAAGAAATGCCCTTTAAATGGGCCATCCCGTTTTGGACCCCAGAAAAACCCCACAGGACCCTTTAGCGGGCTTAGAAGGTTTTGCCCCAAGGGCCCAACCCCAAAAGGAATGGGGCTTAAGGAAACCAAACTCAAATGGGGCCtaaccacccacaaacaccccccccaaaaaacccttccccacaccccTGTGGAGCTTTGTGGGAAACCCACCACCCTTCC
  5   1   2       chi Brn1      in                    IMAGE:6950098.5p                                                                                                                                                       GTCCGGAATTCTTCCGGATCGCACAGATAATATCGCACGAAACGAATTTTCGTCCGATATTCGTTGCGTGTATGGTGGAAAAAGAACCGACCGATATCGGCAGAAGACTTGGATATCGGTCGGCTCGTCGATCCTACACGTGTGTATTGAAACGAACGATCTTTCTTGGAAAGATCTTTTCCAAGAAAGATCATAATTGTTACGTCTATGGCCACCTTTACCTGCACATATGACATCTTTCCTTCCCACTGAAAGACAGGTGAACTAAAATTGTGTGGTTCTAATAAAGGCGTCCTATCCCTTTGCCTTATGCTTTGAGCTCAAGGGAAATGTGCCATGGGGATGGGGTTGCAACATTTGACTGGTTCAGGAGCCCTTAGGTCAAAAACAGGTAACTGGtttattttttctttccttttctttGCCTGAGCTGGGGGTCAAACTGCAGTGAAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAAGCTTGGGCCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCCACATGCTGCTTTCACATACCctgctgctgccgctgctgctgcACTTCATGCCCAAATGCGTTGGTATCCTCCCTCTGGAGCAACCCACAGGGATG
  5   1   2       bld Int2 5x3                        IMAGE:8821764.5p                                                                                                                                                        TTAGGAATTAAAAAAAGGTTCGTTAATTTATAATATTCGTCCCCTTAGCACTGACACATACACACCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCATAcaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaATACACCCACACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCAACACTTTATTGCACGAGATCCATATGACTTAAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGAACTTGCTCAGCCATTCCCACATGCTGCTTTCACATACctgctgctgccgctgctgctgcACTTTCATGCCCAGATGCGTGTATCCTCAATCTGAAGCCACCCAGCAGGATGGAAGTCTCGTCCAGTTTTGGTAGCACTCTTCGGTTCGTAAACttttttttttttGAAGATTTCATTTGTGACACTCTG
  5   1   2       bld Oo1  5g                         IMAGE:6859125.5p                                                                                                                                                               CGCTTTCAGCCCCCTGTTTCTTTTGCACTTTCCCACCTTAGCACTGACACATACACACCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCATACAATACACccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaatacacccaCACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAGAGAATGCCTTANATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGNGCTGCGCTAATCTCGGCTTCACCAGAAGCTTGGGCNNTCCTACCACTGTATACTGCGGAAACTTGCTCCAAGCATCCCACAtgctgctttcacataccctgctgctgccgctgctgctgcACTTCATGCCCAGATGCNTTGGTATCCTCCATTCTGAAGCAACCCANCAGGGGATGGGAAT
  5   1   2       bld Brn1 5g                         IMAGE:6955186.5p                                                                                                                                                                       GGCTGGACCGGTCCGGAATTCTCCGGATCTTAGCACTGACACATACACATCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGtcccatacaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaatacacccacacaGTGGGAAGTAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAAGCTTGGGCTCCCTACCCACTGTATACTGCGGAAATTGCTCCAGCCATCCCACATGCTGCTTTCACATACCctgctgctgccgctgctgctgcACTTCATGCCCAAATGCGTTTGGTATCCTCCCATCTGAAGCAACCCAACCAGGGATGGA
  5   1   2       bld Oo1  5x3                        IMAGE:6642412.5p                                                                                                                                                                         GCTGGACCGGTCCGGAATCCCGGGATCACCTTAGACTGACACTACCACCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGtcccatacaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaatacacccacacaGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCctgctgctgccgctgctgctgcACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCAACCCAGCCAGGGATGGAAGTCTCGGTCAGTTTTGGTTAGAACTCTTCGG
  5   1   2       chi Oo1                             IMAGE:5079627.5p                                                                                                                                                                               CTGGTAAACCGGTCCGGAATTCCCGAGGATCAGCATACACACCTCTATACTCCCCTCGAACTACTCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTcccatacaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaatacacccacacaGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGGCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCCCTGTATACTGCGGAACTTGCTCCCGCCATCCCACATGCTGGCTTTCAAAATACCCTGGCTTGCTGCCCGCTGGCTGCTGGAACCTTCTTGGCCCAAAATGGCGTTGGGGCAATCCCTTCCAATCTGGAAAGGCAAACCCCAAGTCAGGGGTATGGGGAAAGATCCCCTCGCTA
  5   1   2       bld Oo1  5x3                        IMAGE:5078696.5p                                                                                                                                                                                 TGGACCGGTCCGGAATTCTCGGGATCTGACACatacacacctctatacaccactcgaactactctcagcacccacacacctctctacacaACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTcccatacaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaatacacccacacaGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCctgctgctgccgctgctgctgcACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCAACCCAGCAGGGATGGAAGTCTCGTCAGTTTTTGTAGAACTCTTCGGTTCCCTTTATAA
  5   1   2       bld Kid  5g                         IMAGE:7010695.5p                                                                                                                                                                                 CCCACGCGTCCGCCCACGCGTCCGCACTGACACATACACACNCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTcccatacaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaatacacccacacaGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAAATCTCGCTTTCACAGAGGGCTGGGCTCCCTACCCACN
  5   1   2       bld Brn1 5x                         IMAGE:6952886.5p                                                                                                                                                                                                  TCCGGTCCGGATCTCCGGGATAGACCTCTATACACAGCTCGTACTACTCTCAGCACCCACACACCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCATACAATACACCCaccatacatacaccactatacaatactcccaccatacatacaccaccatacaatacacccacaCAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGATTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGGAACTTTACTTGCGTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAAGGCATAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCCAAAAAGCTCCAGCCTGCACTTGTGAACAAACTTCATTTGCCCGAAATCCCTATTGACTTAAACTGGGGGCTTGCGCGTAATCCTCAGGCTTCCACCATAAGGCTTGTGGGCTCCCTCACCCACATGTTATCATGGGGGAAAATTGATTTCAGGGCCTTCCCCAGATGGGTGGCATTGTTAGATTAACCATGGCGTGCCGGCCGCGGTGCATGGTGGAAATTTGTTGGCCACCAAAAATGCGTGTTGGTTTATGCCCCACCATCGTGAAGGCGAGACGCCAGGCGGTGGTATTCGGCAAGTGTCCACG
  5   1   2       bld Tbd7 5g3  in                         XL074c02.5p                                                                                                                                                                                                          GCTGacacatacacacctnctatacaccactcgaactactctcagcacccacacacctctacacAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGtcccatacaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaatacacccacacaGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGC
  5   1   2       bld Em10 5g                         IMAGE:8319716.5p                                                                                                                                                                                                          CTGacacatacacacctctatacaccactcgaactactctcagcacccacacacctctctacacAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGtcccatacaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaatacacccacacaGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTANATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCCTGGGGCTCCTACCACTGTATACTGCGGAACTTTGCTCAGCC
  5   1   2       bld Em10 5g                         IMAGE:8321179.5p                                                                                                                                                                                                          CTGacacatacacacctctatacaccactcgaactactctcagcacccacacacctctctacacAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGtcccatacaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaatacacccacacaGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCC
  5   1   2       bld Ov1  5g                         IMAGE:8331166.5p                                                                                                                                                                                                          CTGACACATACACACCTCTATACACCACTCGAACTACGCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCatacaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaatacacccacacaGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTATATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAGGCCAACACATAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAAATCCATATGACTTAACTGGGGCTGCGCTAAT
  5   1   2       chi Oo1                             IMAGE:5079577.5p                                                                                                                                                                                                               CATACACACCTCTATACACCACTCGAACTACTCTCAGCACCCANCACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTcccatacaatacacccaccatacatacaccacgatacaatactcccaccatacatacaccaCCGTACAATACACCGACACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATAGAGAGGAGGAGGTACGAACTCTATTTGTTAGTGCGCTCGCTATTGACAGCAAACCCAGGTAACTTTACTTGCTTTTTCGACCATTTAAGCCAGTTGGCTTTGTCACATTTGGATAATAGGGGAGGAGCTGAACCTGCAAAGAAATGGCTTTAAATGGGCATCCGGGTTTGACCCAGAAGAACCCCCAGAACCTTACGGGTTAGAATTTTGGCCAGGGGCCAACAACaaaaaaagggttaaaaaaaaaaacttaatggggttaaccccaaaaacccccccaaaaccttccccccccTGGGAACTTTGGGAAAAAACACCTTTTCATTTGTGGCCCGAGAAATCCCCTTATGGACCTTAAAATgggggggcgtgggggctaaaaattcccggggttttccccaaaaaagggtttggggggttccccctaaccccatgggtggtaaagtgggggggAAAATTGTGGTTTCCAAGAGCATATCCCACAAAAggggggggggTTTTTACAAAAAAACCCTCGTGTGTTGGTTTGACCGCCCTGTGCTTGGTTTTGGAATCTTTTTAGGTGGCCCACAAAAGAGGCggggggggggaaaaccccccccACCCTCGTGAGAAAAC
  5   1   2       bld Egg4 5g3  in                    IMAGE:3744368.5p                                                                                                                                                                                                                 GGAATTCCCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTcccatacaatacacccaccatacatacaccactatacaatacacccaccatacatacaccaccatacaatacacccacacaGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACANACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGAC
  3  -1   2       chi Bla2      in                    IMAGE:7295877.3p                                                                                                                                                                                                                    CACACCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCATACAATACACCCACCATACATACACCACTATACAATACTCCCACCATACATACACCACCATACAATACACCCACACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCATATGACTTACTGGGGCTGCGCTATCTCGGCTTCACAGAGCTGGGCTCCTACCACTGATACTGCGACTGCTCAGCATCCAATGCTGCTCAATACTGCTGTGCGCTGCTGCTGATCTGCCAATGCTGTTCTCTCGACACCACAGATGATCCGC
  5   1   2       bld Oo1  5x3                        IMAGE:6638184.5p                                                                                                                                                                                                                     ACACCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCatacaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaatacacccacacaGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCctgctgctgccgctgctgctgcACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCACCCAGCAGGGATGGAAGTCTCGTCAGTTTTGGTAGAACTCTTCGGNTCCTTTTATAATT
  5   1   2      seed Ga12 5g3  in                         XL201o17.5p                                                                                                                                                                                                                      CGAGGCTCTATACACCACTCGAACTACTCTCAGCACCCACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCAtacaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacAATACACCCACACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTT
  5   1   2       bld Ooc2 5g3  in                    IMAGE:3746832.5p                                                                                                                                                                                                                        CCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCATAcaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaATACACCCACACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTANATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTNTGCCAAGGCCAACACANAGATGGCTAAGAACANACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTGGNAGCACACTTCATTGCACGAGATCCATAT
  5   1   2       bld Ga12 5g                              XL143j22.5p                                                                                                                                                                                                                         CTGACACATACACACCTCTATACACCACTCGAACTACTCTCAGCACCCACACCTCTCTACACAACTGCCGCCAAGGAGCCGACTCCCGtcccatacaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaatacacccacacaGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCA
  5   1   2       bld Emb4 5g                         IMAGE:5572761.5p                                                                                                                                                                                                                         ACCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCATACaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaataCACCCACACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCNTCCTACCCACTGTATACTGCGNGAACCTGCTCCAGCCATCCCACATGCTGCTTTCACATACCCGGCTGCTGCCGCTGCTGCTGCACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGGCACCCCAGCAG
  5   1   2       bld Gas5 5g3  in                    IMAGE:3750767.5p                                                                                                                                                                                                                          CCTCTATACACCACTCGAACTACTCTCAGCACCCACACACCTCTACACAACTGCCGCCAAGACTTGCTGCCAAGGAGCCGACTCCCGTCCCATACAatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacaatacACCCACACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATNCGGTTTGACCCAG
  5   1   2       bld Tad1 5g                         IMAGE:6940314.5p                                                                                                                                                                                                                                                                                      GGCTTGCTGCCAAGGAGCCGACTCCCGTCCCAtacaatacacccaccatacatacaccactatacaatactcccaccatacatacaccaccatacAATACACCCACACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACCAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGGACGAAAATCCATATTGACTTAACTGGGGGCTTGCCCCTAATCCTCGGGCTCTCACCAGAAGGCCTTTGGGCCTCCCCTACCCCACTGTGAATACTGGCAGAAAACTTGGTTCCCAACCAATCCCCAAAAGGCCTGGCCTTTCAACAAAACCCCTGCCTGGCTGGCCCCCAGCCTTGCTGCCAACTTTCCATGGCCCCAAGATGGCCTTTTGGGTAATTCCTCCCATCCTTAAAAGCCAACCCCATACCATGGGGAATAGGGAAAGTTCTCCTCCTCCCGAATTTTTTTGGTTTAACAAACCTCCTCTGGGGGGTTTCCCCTTTTTaaaaaaaaTTCTCTTTTTTATTCCCCCCGGGAAAAGGGCAAATTTCCCCCTTTT
  5   1   2       bld Ov1  5g                         IMAGE:8328449.5p                                                                                                                                                                                                                                                                                                                                           CCCACGCGTCCGAATACTCCCACCATACATACACCACCATACAATACACCCACACAGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCctgctgctgccgctgctgctgcACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCAACCAGCAGGGATGGAAGTCTCGTCAGTT
  5   1   2       bld He1  5g3  in                    IMAGE:4408967.5p                                                                                                                                                                                                                                                                                                                                              ccactatacaatactcccaccatacatacaccaccatacaatacacccacacaGTGGGAAGGAGCACGTGTCCTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCAA
  3   1   2       bld Ga12 5g3  in                         XL201o17.3p                                                                                                                                                                                                                                                                                                                                                                         ACACCACCATACAATACACCCACACAGTGGGAAGGAGCACGTGTCNTCAGCACCCAGGGACCCATACACCACCGCCACCGTGGAGCCCACCGAGGAGTCTGGCTTGTACACCATGAGTGGCCTGAAGCCAGAGACTGAGCACAATAATAATAATATAGAGGAGGAGGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCCTGCTGCTGCCGCTGCTGCTGCACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCAACCCAGCAGGGATGGAAGTCTCGTCAGTTTTGTTAGAACT
  5   1   2       bld Int2      in                    IMAGE:8820680.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAATAACACCATTTAGGAGTGGTCCTCTCTAATTCGTCCCGTACGAACTCTATTTGTTAGTGGGCTCCCTATTGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCctgctgctgccgctgctgctgcACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCAACCCAGCAGGGATGGAAGTCTCGTCAGTTTTGTTAGAACTCTTGGGTTCCTTTATAAttttttttttGAGGATTTCATTTTGCACTCTCCATGAACTGATGTGCCAACTAGTTTTAGTCGATCTAACCCATGGACCAGTCATCCAACATTAAGATGTTTTGGTCCACTCCTTTATTCTTCAATACATCGGACTGATTCAGCTACATCAAAGAAAAGACTGCATAGTAAATGAGCATGGCTGTTGCCATACAAAATAATGTACCATCATGTGGGCATGGGAGTTTGCATGTTTTCTAGCATGATAATGTTCTACTGATGTAATGTACTTAGGTAGAGTAATCATTCAGATAGCTTGCTCGTAAGCTGGATTCCAAGCTCCTTTCACTAACCGTTAATGC
  5   1   2       bld Egg6      in                    IMAGE:4435602.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAATAATATATAGGAGGAGGTACGAACTCTATTTGTTAATGAGCTCCCTATTGACATCAAACCCAGGGAACTTTACTCGATTTTTCGACCATTTAAGGGTAATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCA
  5   1   2       bld Ooc1                             Ooc1-db23e06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGTCGACCCACGCGTCCGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCctgctgctgccgctgctgctgcACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCAACCCAGCAGGGATGGAAGTCTCGTCAGTTTTGTTAGAACTCTTGGGTTCCTTT
  3   1   2       bld Tbd7 5g3  in                         XL074c02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGACATCAAACCCAGGGAACTTTACTTGCTTTTTCGACCATTTAAGGGTTATGAAGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCACTACCCACTGTATACTGCAGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCCTGCTGCTGCCGCTGCTGCTGCACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCAACCCAGCAGGGATGGAAGTCTCGTCAGTTTTGTTAGAACTCTTGGGTTCCTTTATAATTTTTTTTTTCTTGAGGATTTCATTTTGCACTCTCCATGAATTGATGTGCCAACTAGTTTTAGTCGATCTAACCCATGGACCAGTCATCCAACATTAAGATGTTTTGGTCCACTCATTCTTC
  5   1   2       bld He1                             IMAGE:4408493.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGATCATTAATCAAGCTTACCTCAAAACAGCCAGTTGGCTTTGTCACATTTGATAATAGGGCAGGAGCTGAAGCTGCAAAGAATGCCTTAAATGGCATCCGGTTTGACCCAGAGAACCCACAGACCTTACGGCTAGAGTTTGCCAAGGCCAACACAAAGATGGCTAAGAACAAACTAATGGCTACACCAAACCCCACAAACCTCCACCCTGCACTTGGAGCACACTTCATTGCACGAGATCCATATGACTTAACTGGGGCTGCGCTAATCTCGGCTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCctgctgctgctgccgctgctgctgcACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCAACCCAGCAGGGATGGAAGTCTCGTCAGTTTTGT
  5  -1   2       bld Bla2      in                    IMAGE:7295877.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACAAAGATGGCTAGAACAAAATAAAGGTTACACCAAACCCCACAAACCTCCCCCCTGCACTTGAAGCACAATTCATTGCACGAGATCCATATGACTTAACGGGGGCTGCGCTAATTTCGACTTCACCAGAGGCTTGGGCTCCCTACCCACTGTATACTGCGGAACTTGCTCCAGCCATCCCACATGCTGCTTTCACATACCctgctgctgccgctgctgctgcACTTCATGCCCAGATGCGTTGGTATCCTCCATCTGAAGCAACCCAGCAGGGATGGAAGTCTCGTCAGTTTTGTTAGAACTCTTGGGTTCCTTTATAAtttttttttGAGGATTTCATTTTGCACTCTCCATGAACTGATGTGCCAACTAGTTTTAGTCGATCTAACCCATGGACCAGTCATCCAACATTAAGATGTTTTGGTCCACTCCTTTATTCTTCAATACATCGGACTGATTCAGCTACATCAAAGAAAAAGACTGCATAGGTTAAAATGAGCATGGCTGTTGCCATACAAAATAATGTACCATTCATTGGTGGGCATGGGAGGGTTTGCATGTTTTCTAGCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCcttcagttttcatgtctttagttttgtcctttcattttcattggagagtttttgttcttgccaaaaaaaaaaaaaaaaaaaa
  5   1   2      ests                            Xl3.1-IMAGE:6950098.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACTCTTCGGTTCCTTTATAATTTTTTTTTTTTGAGGATTTCATTTTGCACTCTCCATGAACTGATGTGCCAACTAGTTTTAGTCGATCTAACCCATGGACCAGTCATCCAACATTAAGATGTTTTGGTCCACTCCTTTATTCTTCAATACATCGGACTGATTCAGCTACATCAAAGAAAAAGACTGCATAGGTTAAAATGAGCATGGCTGTTGCCGTACAAAATAATGTACCATTCATTGGTGGGCATGGGAGGGTTTGCATGTTTTCTAGCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCTTCAGTTTTCATGTCTTTAGTTTTGTCCTTTCATTTTCATTGGAGAGTTTTTGTTCTTGCCATGTGTAATGCAACCTTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCATTTTTTGTTGGTTTTTTTTGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGTTTGTCTGCTGTACTTTATGAACAATTGTGCAACTTTTGTGTTCCATTTTGCATTCTGCCTGATATTTCAGTATTATGAAAGATGTCTTGCCGGTACAGAGATGAATTTTCTCTTGCTGAATTTATGAGAATGTGATAATGGATTAAAAAATATA
                                                  Xl3.1-CHK-1012693720                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCGGTTCCTTTAxxAxTTTTTTTTTTTGAGGATTTCATTTTGCACTCTCCATGAACTGATGTGCCAACTAGTTTTAGTCGATCTAACCCATGGACCAGTCATCCAACATTAAGATGTTTTGGTCCACTCCTTTATTCTTCAATACATCGGACTGATTCAGCTACATCAAAGAAAAAGACTGCATAGGTTAAAATGAGCATGGCTGTTGCCGTACAAAATAATGTACCATTCATTGGTGGGCATGGGAGGGTTTGCATGTTTTCTAGCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCTTCAGTTTTCATGTCTTTAGTTTTGTCCTTTCATTTTCATTGGAGAGTTTTTGTTCTTGCCATGTGTAATGCAACCTTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCATTTTTTGTTGGTTTTTTTTGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGTTTGTCTGCTGTACTTTATGAACAATTGTGCAACTTTTGTGTTCCATTTTGCATTCTGCCTGATATTTCAGTATTATGAAAGATGTCTTGCCGGTACAGAGATGAATTTTCTCTTGCTGAATTTATGAGAATGTGATAATGGATTAAAAxATATACAAAAA
  3   1   2       bld Int2      in                    IMAGE:8820680.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGCGCTAATTTCGCTCACTAGAGCTTGGCTCCTTACCACTGTATACTGCGACTGTCCAGCATCCACATGCTGCTTTCACATACTGCTGCTGCGCTGCTGCTGCAGTCATGCCCAGATGCGTGGTATCTCCATCTGAAGCAACCCAGCAGGGATGAAGTCTCGTCAGTTTGTTAGAACTCTTGGGTTCCTTTATAATTTTTTTTTTGAGGATTTCATTTTGCACTCTCCATGAACTGATGTGCCAACTAGTTTTAGTCGATCTAACCCATGGACCAGTCATCCAACATTAAGATGTTTTGGTCCACTCCTTTATTCTTCAATACATCGGACTGATTCAGCTACATCAAAGAAAAAGACTGCATAGGTTAAAATGAGCATGGCTGTTGCCATACAAAATAATGTACCATTCATTGGTGGGCATGGGAGGGTTTGCATGTTTTCTAGCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCCTTCAGTTTTCATGTCTTTAGTTTTGTCCTTTCATTTTCATTGGAGAGTTTTTGTTCTTGCCATGTGTAATGCAACCTTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCATTTTTTGTTTTTTTTTGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGTTTGTCTGCTGTACTTTATGAACAATTGTGCAACTTTTGTGTTCCATTTTGCATTCTGCCTGATATTTCAGTATTATGAAAGATGTCTTGCCGGTACAGAGACGACAAGCTCCAGAACAATAACTCATAGATTCACATTTTCTA
  3   1   2       bld Brn1      in                    IMAGE:6950098.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGCTGCACTTTCATGCCCAGATGCGTTGGTATCCTCCCATTTGAAGCAACCCAGCAGGGATGGAAGTCTCGTCAGTTTTGTTAGAACTCTTGGGTTCCTTTATAATTTTTTTTTTTGAGGATTTCATTTTGCACTCTCCATGAACTGATGTGCCAACTAGTTTTAGTCGATCTAACCCATGGACCAGTCATCCAACATTAAGATGTTTTGGTCCACTCCTTTATTCTTCAATACATCGGACTGATTCAGCTACATCAAAGAAAAAGACTGCATAGGTTAAAATGAGCATGGCTGTTGCCGTACAAAATAATGTACCATTCATTGGTGGGCATGGGAGGGTTTGCATGTTTTCTAGCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCTTCAGTTTTCATGTCTTTAGTTTTGTCCTTTCATTTTCATTGGAGAGTTTTTGTTCTTGCCATGTGTAATGCAACCTTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCATTTTTTGTTGGTTTTTTTTGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGTTTGTCTGCTGTACTTTATGAACAATTGTGCAACTTTTGTGTTCCATTTTGCATTCTGCCTGATATTTCAGTATTATGAACAGCTGTCTTGCCGGTACAGAGACGACTACTCCATACCATGACTCATGATTAAATATCTCAATACC
  3   1   2       bld Brn1      in                    IMAGE:6950839.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTTCCCCATTTGGAAAGCAAACCCCCAGCCAGGGGAGTGGGAAATTCCTGGTTCAAGTTTTGTTAGGAACTGTTGGGGTTTCCTTTAAAATTTTTTTTTTTGGGGATTTTCATTTTGCACTTTCCAGGAACGGATGTGCCAACTAGTTTTAGTCGATCTAACCCATGGACCAGTCATCCAACATTAAGATGTTTTGGTCCACTCCTTTATTCTTCAATACATCGGACTGATTCAGCTACATCAAAGAAAAAGACTGCATAGGTTAAAATGAGCAGGGCTGTTGCCATACAAAATAATGTACCATTCATTGGTGGGCATGGGAGGGTTTGCATGTTTTCTAGCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCCTTCAGTTTTCATGTCTTTAGTTTTGTCCTTTCATTTTCATTGGAGAGTTTTTGTTCTTGCCATGTGTAATGCAACCTTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCATTTTTTGTTTTTTTTTGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGTTTGTCTGCTGTACTTTATGAACAATTGTGCAACTTTTGTGTTCCATTTTGCATTCTGCCTGATATTTCAGTATTATGAAAGATGTCTTGCCGGTACAGAGATG
  5   1   2      seed Ov1                    IMAGE:6317904-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTAGTTCTAGAACTCTTCGGTTCCTTTATAAttttttttttttGAGGATTTCATTTTGCACTCTCCATGAACTGATGTGCCAACTAGTTTTAGTCGATCTAACCCATGGACCAGTCATCCAACATTAAGATGTTTTGGTCCACTCCTTTATTCTTCAATACATCGGACTGATTCAGCTACATCAAAGAAAAAGACTGCATAGGTTAAAATGAGCATGGCTGTTGCCGTACAAAATAATGTACCATTCATTGGTGGGCATGGGAGGGTTTGCATGTTTTCTAGCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCTTCAGTTTTCATGTCTTTAGTTTTGTCCTTTCATTTTCATTGGAGAGTTTTTGTTCTTGCCATGTGTAATGCAACCTTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCAttttttgttggttttttttGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGTTTGTCTGCTGTACTTTATGAACAATTGTGCA
  5   1   2       bld Ov1                             IMAGE:6317904.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTAGTTCTAGAACTCTTCGGTTCCTTTATAAttttttttttttGAGGATTTCATTTTGCACTCTCCATGAACTGATGTGCCAACTAGTTTTAGTCGATCTAACCCATGGACCAGTCATCCAACATTAAGATGTTTTGGTCCACTCCTTTATTCTTCAATACATCGGACTGATTCAGCTACATCAAAGAAAAAGACTGCATAGGTTAAAATGAGCATGGCTGTTGCCGTACAAAATAATGTACCATTCATTGGTGGGCATGGGAGGGTTTGCATGTTTTCTAGCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTANACCGTTAAATTGCACTGTTCCCCACCCCACCATCTTCAGNTTTTCATGGCCTTTAGTTTTTGCCCCTTTCATTTTTCATTGGAGAAGTTTTTTTGTTCCTTGGCCATGGGGTAAAGGCCACCCTTTAATTGGGGAAAACCGAACCAAAAAGTACCCCGTATTTTTTTGGTAACATTGGTTAAATAAGGGAAAAAATTTTTATGGCGttttttttttggggggggttttttttttggggggggaaaattttaaaagagaattttttttaaaatccttttaaaagttaaaagggttatatgaaaaaattttGGCCCCAAATTCTTGGAAAGGGGGTTTTGGCCCCGCCCCGGAAACCTTTATAAGaaaaaaaaaaTTGTGGGGGCGCAAACTTTTTGTGGGCGTCCCCCACCttttttggaatattttggggcccggggaaattttttcccgcctttttttttaaaaaaaaaatggtttttttttggtcgcgggaaaaaaaaaaaaaaaaaaaaTATTTTTTTC
  3   1   2       bld Gas5 5g3  in                    IMAGE:3750767.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCCTTTATAATTTTTTTTTTTGAGGATTTCATTTTGCACTCTCCATGAACTGATGTGCCAACTAGTTTTAGTCGATCTAACCCATGGACCAGTCATCCAACATTAAGATGTTTTGGTCCACTCCTTTATTCTTCAATACATCGGACTGATTCAGCTACATCAAAGAAAAAGACTGCATAGGTTAAAATGAGCATGGCTGTTGCCGTACAAAATAATGTACCATTCATTGGTGGGCATGGGAGGGTTTGCATGTTTTCTAGCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCTTCAGTTTTCATGTCTTTAGTTTTGTCCTTTCATTTTCATTGGAGAGTTTTTGTTCTTGCCATGTGTAATGCAACCTTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATAAGATTTAAGAAAACAA
  3   1   2       bld Ov1                             IMAGE:8329514.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAAAGACTGCATAGGTTAAAATGAGCATGGCTGTTGCCGTACAAAATAATGTACCATTCATTGGTGGGCATGGGAGGGTTTGCATGTTTTCTAGCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCTTCAGTTTTCATGTCTTTAGTTTTGTCCTTTCATTTTCATTGGAGAGTTTTTGTTCTTGCCATGTGTAATGCAACCTTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCATTTTTTGTTTTTTTTTTGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGTTTGTCTGCTGTACTTTATGAACAATTGTGCAACTTTTGTGTTCCATTTTGCATTCTGCCTGATATTTCAGTATTATGAAAGATGTCTTGCCGGTACAGAGATGAATTTTCTCTTGCTGAATTTATGAGAATGTGATAATGGATTAAAAAATATATACAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Egg4 5g3  in                    IMAGE:3744368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCTTCAGTTTTCATGTCTTTAGTTTTGTCCTTTCATTTTCATTGGAGAGTTTTTGTTCTTGCCATGTGTAATGCAACCTTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCATTTTTTGTTGGTTTTTTTTGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGTTTGTCTGCTGTACTTTATGAACAATTGTGCAACTTTTGTGTTCCATTTTGCATTCTGCCTGATATTTCAGTATTATGAAAGATGTCTTGCCGGTACAGAGATGAATTTTCTCTTGCTGAATTTATGAGAATGTGATAATGGATTAAAAAATAAAAAA
  3   1   2       bld Egg6      in                    IMAGE:4435602.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCATGAATTAAATGTCTACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCTTCAGTTTTCATGTCTTTAGTTTTGTCCTTTCATTTTCATTGGAGAGTTTTTGTTCTTGCCATGTGTAATGCAACCTTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCATTAATTATAGAATTTTTTTTGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGTTTGTCTGCTGTACTTTATGAACAATTGTGCAACTTTTGTGTTCCATTTTGCATTCTGCCTGATATTTCAGTATTATGAAAGATGTCTTGCCGGTACAGAGATGAATTTTCTCTTGCTGAATTTATGAGAATGTGATAATGGATTAAAAAATATATCAAAAA
  3   1   2       bld He1  5g3  in                    IMAGE:4408967.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTTGATGTAAATGTTACATAAGGTTAGAGGTAAAAATCATTTTCAGGATTAGCTTTTTGCTTCTGTAGAAGCTTGGTATTTCCCAAGCTTCCTTCTACTAAACCGTTAAATTGCACTGTTCCCCACCCACCATCTTCAGTTTTCATGTCTTTAGTTTTGTCCTTTCATTTTCATTGGAGAGTTTTTGTTCTTGCCATGTGTAATGCAACCTTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCATTTTTTGTTGGTTTTTTTTGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGTTTGTCTGCTGTACTTTATGAACAATTGTGCAACTTTTGTGTTCCATTTTGCATTCTGCCTGATATTTCAGTATTATGAAAGATGTCTTGCCGGTACAGAGATGAATTTTCTCTTGCTGAATTTATGAGAATGTGATAATGGATTAAAAAATATATACA
  3   1   2       bld He1                             IMAGE:4406979.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTAATGGGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCATTTTTTGTTGGTTTTTTTTGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGTTTGTCTGCTGTACTTTATGAACAATTGTGCAACTTTTGTGTTCCATTTTGCATTCTGCCTGATATTTCAGTATTATGAAAGATGTCTTGCCGGTACAGAGATGAATTTTCTCTTGCTGAATTTATGAGAATGTGATAATGGATTAAAAAATATATAC
  3   1   2       bld Ooc2 5g3  in                    IMAGE:3746832.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAAACAGAGCAAAAGTACCAGTATTTTTGTAACATGTTAATAAGGAGATATTTATGCATTTTTTGTTGGTTTTTTTTGTGTGATAATTAAAGAATATATTAAATCTATAAGTTAATGTTATGAAGCTTGCCGATTCTGTATGGNNTGTCTGCTGTACTTTATGAACAATTGTGCAACTTTTGTGGTTCCATNTTTGCATTCTGCCTGATATTTCAGTATTATGAAAGATGTCTTGCCGGTACAGAGATGAATTTTCTCCTGCTGAATTTATGAGAATGTGATAATGGATTAAAAAATATATACAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)