Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:5155727.5                     113 PI      93         17     1580                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:8463340.5.5                    19 PI      80        117     1384                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:3474399.5                       2 PI      85       1972     2304                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012837528 Xl3.1-xlk65o01ex.3.5 - 97 ESTs
                                                                       ........-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-xlk65o01ex.3.5                                                                     CTGGGCGGGTGACGCCGTGATTGGACGGGCCTGGTAAGCACGTATACTGTCGCCGCGCCGGCAAAGTCGTAGTAGGTCCAAGCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAAGTTATGGAGATGTTCCAGCCCAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATCAAAGGACATGCCAAGTGTGTGGAGTTCATAAAGACCTTTAACTTGCCAATGCTGATGCTAGGAGGTGGCGGTTACACTATCAGGAATGTGGCTCGTTGCTGGACATATGAAACGGCTGTGGCTCTGGACTCCGAGATCCCTAATGAGCTTCCATACAATGATTATTTTGAATATTTTGGACCGGACTTCAAACTTCACATCAGTCCATCCAACATGACCAATCAGAACACTAATGAATATCTGGAGAAAATCAAACAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCAGGAGTTCAGATGCAAGCCATCCCAGAGGACTCTGTACATGATGACAGTGGTGAAGAAGATGAAGAAGATCCTGACAAGCGCATTTCCATTCGGTCATCCGATAAAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTTAAAACAGAAGAGGAAAAGGAAGCAGACGACAAGAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATAAATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCGGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACATATACCAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012721773                                                                           GGGTGACGCCGTGATTGGACGGGCCTGGTAAGCACGTATACTGTCGCCGCGCCGGCAAAGTCGTAGTAGGTCCAAGCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAAGTTATGGAGATGTTCCAGCCCAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATCAAAGGACATGCCAAGTGTGTGGAGTTCATAAAGACCTTTAACTTGCCAATGCTGATGCTAGGAGGTGGCGGTTACACTATCAGGAATGTGGCTCGTTGCTGGACATATGAAACGGCTGTGGCTCTGGACTCCGAGATCCCTAATGAGCTTCCATACAATGATTATTTTGAATATTTTGGACCGGACTTCAAACTTCACATCAGTCCATCCAACATGACCAATCAGAACACTAATGAATATCTGGAGAAAATCAAACAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCAGGAGTTCAGATGCAAGCCATCCCAGAGGACTCTGTACATGATGACAGTGGTGAAGAAGATGAAGAAGATCCTGACAAGCGCATTTCCATTCGGTCATCCGATAAAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTTAAAACAGAAGAGGAAAAGGAAGCAGACGACAAGAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATAAATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCGGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACATATACCTAAAAAAAAAAAAAAAGA
                                                      consensus depths                                                                          3     4     4     6     5     6     5     6     5     7     5     7     5     8    18    22    26    28    30    33    33    34    33    34    35    35    35    35    36    37    37    37    35    37    37    37    35    37    35    36    35    36    35    36    34    35    34    35    33    34    33    34    33    34    33    35    34    35    34    36    35    36    35    36    35    36    35    36    35    36    35    36    35    37    36    37    35    37    35    37    35    36    35    36    35    37    36    37    35    36    34    35    34    35    34    35    32    33    32    33    32    34    31    34    31    34    30    34    31    33    29    33    28    32    30    33    27    32    28    31    24    27    21    26    20    25    23    25    19    24    14    22    15    22    13    21    10    19     7    16     8    14     6    13     7    13     6    13     6    12     6    12     5    12     6    11     5    11     5    11     5    11     6    10     6    10     6    10     6     9     6     9     5     8     6     8     5     7     6     7     6     8     7     8     6     8     5     8     5     8     6     8     6     7     6     7     5     6     5     6     5     6     5     6     5     6     5     7     5     7     7     8     8     9     9    10     9    10    10    11    10    12    10    14    10    14    10    13    11    14    10    15     9    15    11    16    11    17    11    17    11    17    12    17    14    20    14    20    15    20    15    21    14    23    15    23    16    24    16    25    10    22    10    22    10    23    11    22    10    22    12    24    12    26    12    27    22    30    23    30    23    32    24    33    24    33    24    33    26    35    25    35    27    36    27    36    27    37    27    37    27    37    26    36    27    37    27    38    26    38    27    39    27    40    24    37    24    37    31    37    30    37    32    38    31    38    32    37    32    37    32    38    32    37    34    37    33    37    33    37    34    37    34    36    35    37    35    37    33    36    35    36    35    36    35    36    35    36    35    36    35    36    35    36    33    36    31    33    31    33    29    32    24    30    13    24    11    16    10    14     8    12     3     4
  5   1   2       e>2                            Xl3.1-IMAGE:6640932.5                                                                     CTGGGCGGGTGACGCCGTGATTGGACGGGCCTGGTAAGCACGTATACTGTCGCCGCGCCGGCAAAGTCGTAGTAGGTCCAAGCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAAGTTATGGAGATGTTCCAGCCAAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATCAAAGGACTGCCAAGTGTGTGGAGTTCATAAAAGACCTTTAACTTGCCAATGCTGATGCTAGGAGGTGGCGGTTACACTATCAGGAATGTGGCTCGTTGCTGGACATATGAAACGGCTGTGGCTCTGGACTCCGAGATACCTAATGAGCTTCCATACAATGATTATTTTGAATATTTTGGACCGGACT
  5   1   2       e>2                               Xl3.1-xlk65o01ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAGATGTTCCAGCCCAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATCAAAGGACATGCCAAGTGTGTGGAGTTCATAAAGACCTTTAACTTGCCAATGCTGATGCTAGGAGGTGGCGGTTACACTATCAGGAATGTGGCTCGTTGCTGGACATATGAAACGGCTGTGGCTCTGGACTCCGAGATCCCTAATGAGCTTCCATACAATGATTATTTTGAATATTTTGGACCGGACTTCAAACTTCACATCAGTCCATCCAACATGACCAATCAGAACACTAATGAATATCTGGAGAAAATCAAACAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCAGGAGTTCAGATGCAAGCCATCCCAGAGGACTCTGTACATGATGACAGTGGTGAAGAAGATGAAGAAGATCCTGACAAGCGCATTTCCATTCGGTCATCCGATAAAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTTAAAACAGAAGAGGAAAAGGAAGCAGACGACAAGAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATAAATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCGGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACATATACCAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                     ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------C-----
                                               BLH ATG      95    2226                                                                     
                                               BLH MIN      95     403                                                                     
                                               BLH MPR      83     403                                                                     
                                               BLH OVR      95     101                                                                     
                                               CDS MIN      95      45                                                                     
                                               EST CLI      79      45                                                                     
                                               ORF LNG      95      10                                                                     
  5   1   2       e>2                            Xl3.1-IMAGE:6640932.5                                                                     CTGGGCGGGTGACGCCGTGATTGGACGGGCCTGGTAAGCACGTATACTGTCGCCGCGCCGGCAAAGTCGTAGTAGGTCCAAGCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAAGTTATGGAGATGTTCCAGCCAAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATCAAAGGACTGCCAAGTGTGTGGAGTTCATAAAAGACCTTTAACTTGCCAATGCTGATGCTAGGAGGTGGCGGTTACACTATCAGGAATGTGGCTCGTTGCTGGACATATGAAACGGCTGTGGCTCTGGACTCCGAGATACCTAATGAGCTTCCATACAATGATTATTTTGAATATTTTGGACCGGACT
                                                  Xl3.1-CHK-1012687078                                                                           GGGTGACGCCGTGATTGGACGGGCCTGGTAAGCACGTATACTGTCGCCGCGCCGGCAAAGTCGTAGTAGGTCCAAGCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAAGTTATGGAGATGTTCCAGCCAAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATCAAAGGACxxxCxAGTGTGTGGAGTTxxxxAAAGACCTTTAACTTGCCAATGCTGATGCTAGGAGGTGGCGGTTACACTATCAGGAATGTGGCTCGTTGCTGGACATATGAAACGGCTGTGGCTCTGGACTCCGAGATACCTAATGAGCTTCCATACAATGATTATTTTGAATATTTTGGACCGGACTTCAACT
  5   1   2       bld Emb9 5g                         IMAGE:7977061.5p TGCGCCCTGTAGCAGGGCAGCCCTACGCAGCTCGGGTGAAAGGGAGAAGCGCTCTCTTTACGTCATCGCTGGGCGGGTGACGCCGTGATTGGACGGGCCTGGTAAGCACGTATACTGTCGCCGCGCCGGCAAAGTCGTAGTAGGTCCAAGCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAG
  5   1   2       chi Egg3                            IMAGE:6324009.5p         TCCCGGGGGGCAGCCCTACCAGCTCGGGTGAAAGGAGAAGCGCTCTCTTTACGTCATCGCTGGGCGGGTGACGCCGTGNATTGGACGGGCCTGGTAAGCACGTATACTGTCGCCGCGCCGGCAAAGTCGTAGTAGGTCCAAGCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAAACTATGGGACTTTTACCCGGAAGAAATGGAGATCTATAAGACCACACCAAAGCCAGTGGCAAAAGGAAAATGGACNAAAGTAATCCACAGGGGGATTGATTTATTAATCAAAATTTCCCTTGCGGCCTCCCTTAACGAAACCCCGGACCATTTTTTGGGCCCGGaaaaataaccacggtaaaacccccgaaattgccccaaaaaaaaattttaaaaaTGGGTTTTGGGGTTTGGAAAGGGAACCCTGGTCCCCCCggggggggggtttttttaaaaaaggggccccccaaaatttttgggggggattttttttggggcccccaaaattttttttttttttaataaaagggggggggggggggttctcccttggggggggggggncccccccaaaagaannggcgccccttcttttttttataaaaaacccttttttaaaaccccccaaaaccnnccccccccccccccaaaaaaagggggggggggggcaaattttttttttttttttGGG
  5   1   2       bld Oo1  5g                         IMAGE:3403303.5p                                                                CATCGATGGGCGGGTGACGCCGTGATTGGACGGGCCTGGTAAGCACGTATACTGTCGCCGCGCCGGCAAAGTCGTAGTAGGTCCAAGCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATATGAGTTATGCCAGCTCTCTACAGGAGGCTGTGTAGCAAGTGCTGTTTAACTAATCAAACAACAGACGGACATG
  5   1   2       bld Oo1  5g3  in                    IMAGE:3404659.5p                                                                  TCGCTGGGCGGGTGACGCCGTGATTGGACGGTCCTGGTAAGCACGTATACTGTCGCCGCGCCGGCAAAGTCGTAGTAGGTCCAAGCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAAGCTCTGTAGCAAGTGCTGTTAAACTAAACATACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAG
  3  -1   2       bld Ga11                            IMAGE:3475089.3p                                                                       AGCTGGAGCTAAGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGGCCGCCGAAGGAAAATGGCGCTGAGCCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTA
  5   1   2       bld Ga15 5g                            XL480j15ex.5p                                                                                 CGCCGTGATTGGACGGGCCTGGTAAGCACGTATACTGTCGCCGCGCCGGCAAAGTCGTAGTAGGTCCAAGCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGA
  5   1   2       bld Oo1  5g                IMAGE:6640932-IMAGp.IMAGp                                                                                                                    GGTTACCCCGGGGTCCCGGAAATTCCCGGGATAAGCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTACGGGATGGGATTGATGATGAGTCCTATGAAGCAAT
  5   1   2       bld Egg3 5g                         IMAGE:6325643.5p                                                                                                                                            GATTCCCGGGGCCGCCGAAGGAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGNATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTTTANACCAGTGATGACCAAANTTATGGAGATGTTCCAGCCAAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTNCATTTGACCATCAAAGGACATGCCAAGGTGTGTGGAGTTCATAAAGACCTTTAACTTGCCAATGCTTGATGCTTAGGGAGGTGGCGGTTACACTAA
  5   1   2       bld DMZ  5g3  in                         xl305n21.5p                                                                                                                                                GTCCAAGCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGAT
  5   1   2       bld DMZ  5g3  in                         xl327p23.5p                                                                                                                                                GTCCAAGCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTAC
  5   1   2       bld Egg3 5g                         IMAGE:6323297.5p                                                                                                                                                 TCCCGGGGCCGCCGAAGAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTNTCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAAGTTATGGAGATGTTCCAGCCCAGTGCAGTGGTCCTACAGTGTTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTTCANTTTGACCATCAAAGGGACATGCCCAAGTGTGGTGGAGTTCCATAAAAGACCCTTTTTAACTTGCCCAATGGCTGAATGCCAAGGGAGGGTGGGCGGGTTTACCACTTAATCC
  5   1   2       bld Ga15 5g                            XL422j24ex.5p                                                                                                                                                   CAAGCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGANAGATATTGGTGCAGG
  5   1   2       bld Oo1  5g                         IMAGE:6643924.5p                                                                                                                                                    CAAGCCGCCGAAGGAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAATTTATGGAGATGTTCCAGCCAAAGTGCAGTGGTCCTACAGTGTGGGAGCAGATTCATTATCTGGGGGATAGACTTGGATGCTTCAATTT
  5   1   2       bld Emb4 5g                         IMAGE:4683530.5p                                                                                                                                                      GCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTACGGGAATGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAGTTTATGGAGATGGTTCAGCCCAGTGCAGTGGGTCCTACAGTGTGGAGCAGATTCATTAATCTGGGGGATAAGACCTGGAATGGCTTCCATTTC
  5   1   2      seed Oo1  5g                         IMAGE:6640932.5p                                                                                                                                                      GCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTACGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAGTTATGGAGATGTTCCAGCCCAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATCAAAGGACATGCCAAGTGTGTGGAGTTCATAAAGACTTTAAACTTGCCAATGCTGATGCTAAGGAGGTGGCGGTTACACTATCAGGGATGTGGCTCGTTGCTGGAAATATTGAAACGCT
  5   1   2       bld Oo1  5g                         IMAGE:6643078.5p                                                                                                                                                      GCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCANGAGAGTTGTGTATATTGACATAGACATTCACCACNNGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGNGGTTATGTCAGTGTCTTTCCANCAAGTATGGAGAGTATTTCCCTNGGAACTGGAGATCTGAGAGATNATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCGGGATGGGATTTGATGATGAGTCCTATGAAGCAATTTTTACACCAGTGATGACCAAGGNTTATGGAGATGTTCCAGCCCAAGTGCAGTGGTCCTAACAGTGGTGGAGCAGATTCATTTATCTGGGGGAATAGACTTGGGATGCTTCAATTTGACCATCAAGGACATGCCCAAAAAGGGTGTGGGAGTTCATAAA
  5   1   2       bld DMZ  5g3  in                         xl306j01.5p                                                                                                                                                      GCCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATC
  5   1   2       bld Ga15 5g                            XL433c09ex.5p                                                                                                                                                       CCGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGANAGATATTGGTGCANGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCNGGATGGGATTGATGATGANTCCTATGANNCNNTTTTTTAANCCNNNGATGACC
  5   1   2       bld Emb1 5g                         IMAGE:6863886.5p                                                                                                                                                        CGCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAAGGGAAAGGCCAAATCCTATGCCTGGGGAATTACCCCCCTACGGGGAAGGGGAATTGAATGAATGAACTCCTTATGAAAGCAAttttttttAAACCAGTTGGATGAACCCAAAGTTTATGGGAAGAATGTTTCCACCCCCAAATGGCCAGA
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3199899.5p                                                                                                                                                         GCCGAAGGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGNTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTNTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACNGTGATGGTGTTGAAGAGGCATTTTACACAACTGATANGGATATGTCAGTGTCTTTCCACAAGTTGGAGAGTATTTCCCTGGAA
  5   1   2       bld Ga18 5g3  in                      xlk165f10ex.5p                                                                                                                                                         CGCNGNNNNAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCNGGNTGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAAGTNATGGAGNNG
  5   1   2       bld Ga18 5g3  in                      xlk144l12ex.5p                                                                                                                                                         CGCNNNNGNAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCANGGAAAGNNAAATACTATGCTGTGAATNACCCCCTTCGGNNGGGNNTGANGATGAGTCCTATGAAGCAATTTTTAAANNAGTGATGACCAAAGT
  5   1   2       bld Ooc3 5g                         IMAGE:3437757.5p                                                                                                                                                               GGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGNAACTACTT
  5   1   2       bld Ga15 5g3  in                       XL445i04ex.5p                                                                                                                                                               GGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAAGTTATGGGAGATGTTCCAGCC
  5   1   2       bld DMZ  5g3  in                         xl283m03.5p                                                                                                                                                               GGAAAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGAT
  5   1   2       bld Emb4 5g                         IMAGE:5514309.5p                                                                                                                                                                  AAATGGCGCTGAGTCAATGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTACGGGA
  5   1   2       bld Em10 5g                         IMAGE:8319168.5p                                                                                                                                                                  AAATGGCGCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTACGGGATGGGAT
  5   1   2       bld Ga18 5g3  in                      xlk146n16ex.5p                                                                                                                                                                  AAATGGCNNTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGNGTTGAGGAGGCATTTTACACAACTGATAGGNNTATGTCAGTGTCTTTCCACAAGTATGGAGAGNATTTCCCTGGAACTGGAGATCTGAGAGANATTGGTGCAGGGAAAGNNAAATACTATGCTGTGAATTNNCCCCTACGGNNGGGNTTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGNNANGACCAAAGTNNNG
  5   1   2       bld Neu7                                 XL030m10.5p                                                                                                                                                                      GCGCTGAGTCAAGGNAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGNC
  5   1   2       bld Oo1       in                    IMAGE:5077936.5p                                                                                                                                                                      GGCGCTGAGTCAAAGAACAAAGAATAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACGGGGGCACCCAATGAAACCTCATACAATTCGCATGACACGCAACCTGCTGCTCTACTATGGACTTTACCGGAAAATGGAGATCTATATACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCAC
  5   1   2       bld Lu1                             IMAGE:4057872.5p                                                                                                                                                                         GCTGAGTCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCCAGAAATCTGAAGCATCTGGTTTT
  5   1   2       bld Oo1                             IMAGE:3404470.5p                                                                                                                                                                               TCAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATGCGTATGACACACAACCTGCTGCTCACCTATGGG
  5   1   2       bld Oo1                             IMAGE:3404986.5p                                                                                                                                                                                CAAGGAACAAAGAAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGAATGGTGTTTGAGGGAGGCATTT
  5   1   2       bld Tbd5      in                    IMAGE:3580217.5p                                                                                                                                                                                            AAGAAAGTGTGCTATTACTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGTACCCAATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACTGACATTCCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGNAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACAGTGATGGTGTTGAAGAGGCATTTTACACAACTGATAAGATTATGTCAATATCTATCCACAAGTATAGACACTATGTCCCTAGAACTAGAGATCTGAGATATATTAGTTCAAGTGAAGGCAAATACTATACTATGTATTACCCCCTACTATATATAAATAATGATCATTCCTATGTACGCATTTGTGTACCAGTGATGACC
  5   1   2       bld DMZ       in                         xl239d08.5p                                                                                                                                                                                                             CTATGATGGTGATGTTGGAAATTATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAAGTTATGGAGA
  5   1   2       bld Tbd7      in                         XL090g16.5p                                                                                                                                                                                                                                    ATTATTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCGGGATGGGATTGATGATGAGTCCTATGAAGCAATTT
  5   1   2       bld Tbd7      in                         XL089g16.5p                                                                                                                                                                                                                                        TTATGGACAGGGGCACCCAATGAAACCTCATAGAATTCGTATGACACACAACCTGCTGCTCAACTATGGACTTTACCGGAAAATGGAGATCTATAGACCACACAAAGCCAGTGCAGAGGAGATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGNTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTNCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATANACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTAT
  5   1   2       bld Neu7      in                         XL045o02.5p                                                                                                                                                                                                                                                                                                                                                                                              GCAAATTCCTGCGCTCCATACGACCGACAATATGTCTGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTACGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTT
  5   1   2       bld Ga18      in                       xlk65o01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                      CAGACAATATGTCTNNTACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTACANGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTACGGNTGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAAGTTATGGAGATGTTCCAGCCCAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGNTAGACTTGGATGCTTCAATTTGACCATCAAAGGACATGCCAAGTGTGTGGAGTTCATAAAGACCTTTAACTTGCCAATGCTGATGCTAGGAGGNGGNGGTTACNCTATCANGAATGTGGCTCGTTGCTGGACATATGAAANGGCTGNGGNTCTGGANTC
  5   1   2       bld Int2                            IMAGE:8530794.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCAGCTCTCTACAGGAGGCTCTGTAGCAAGTGCTGTTAAACTAAACAAACAACAGACGGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAATGATGACCAAAGTTATGGAGATGTTCCATCCAAGTGCACTGGTCCTACAATGTGGAGCTGATTCATTATCTGGGGATAGACTAGGATGCTTCTATTGACTATCAAATGACTTGCCTAGTGTATGGAGTTCATATAGACCTATTAAATTGATAATGTTGATGCTAAGAGGATGCGGCTTATATAATACTAGATAGTTTCCTGTTTGTATAGATATAAATATACGTTTATCATGTATTTaataatttttatgttcttgtattacttagttattataatattttatactgatttattatagatatatatttcaattagagaatcaatagtattG
  5   1   2       bld Spl                             IMAGE:8461289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCTGGTGGCCTTCTCATGCCAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTTAAGTATCACCAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTTCGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAAGTTATGGAGATGTTCCAGCCAAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATCAAAGGACATGCCAAGTGTGTGGAGTTCATAAAGACCTTTAACTTGCCAATGCTGATGCTAGGAGGTGGCGGTTACACTATCAGGAATGTGGCTCGTTGCTGGACATATGAAACGGCTGTGGCTCTGGACTCCGAGATACCTAATGAGCTTCCATACAATGATTATTTTGAATATTTTGGACCGGACTTCAACTTCACATCAGTCCACCAACATGACCATCAGACACTAATGATATCTGGAGAAATCAGCAGCGCTCTTGAGACTGCGCTGCCCCCATGCTCAGAGTCAGATCAGCATCCAAGACTCGTCTGATGACGTGTgagagagagagaCTGACACCATCATCGTCTCATAAGATGCTGCAAGATCCGTCGAGATAGGAGAGCCAACTGCGTCAACTACGGTACAAGAGACACAGAAGTAAGATATAA
  5   1   2       bld Em10                            IMAGE:8319559.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAGAGTTGTGTATATTGACATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACTGATAGGGTTATGTCAGTGTCTTTCCACAAGTATGGAGAGTATTTCCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTGAATTACCCCCTACGGGATGGGATTGATGATGAGTCCTATGAAGCAATTTTTAAACCAGTGATGACCAAAGTTATGGAGATGTTCCAGCCCAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATCAAAGGACATGCCAAGTGTGTGGAGTTCATAAAGACCTTTAACTTGCCAATGCTGATGCTAGGAGGTGGCGGTTACACTATCAGGAATGTGGCTCGTTGCTGGACATATGAAACGGCTGTGGCTCTGGACTCCGAGATCCCTAATGAGCTTCCATACAATGATTATTTTGAATATTTTGGACCGGACTTCAAACTTCACATCAGTCCATCCAACATGACCAATCAGAACACTAATGAATATCTGGAGAAAATCAAACAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCAGGAGTTCAGATGCAAGCCATCCCAGAGGACTCTGTACATGATGACAGTGGTGAAGAAGATGAAGAAGAATCTGACNAGCGCATTTCCATTCNGTCATCCGATAAANGGATGCGTGCG
  5   1   2       e>2                               Xl3.1-xlk65o01ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAGATGTTCCAGCCCAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATCAAAGGACATGCCAAGTGTGTGGAGTTCATAAAGACCTTTAACTTGCCAATGCTGATGCTAGGAGGTGGCGGTTACACTATCAGGAATGTGGCTCGTTGCTGGACATATGAAACGGCTGTGGCTCTGGACTCCGAGATCCCTAATGAGCTTCCATACAATGATTATTTTGAATATTTTGGACCGGACTTCAAACTTCACATCAGTCCATCCAACATGACCAATCAGAACACTAATGAATATCTGGAGAAAATCAAACAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCAGGAGTTCAGATGCAAGCCATCCCAGAGGACTCTGTACATGATGACAGTGGTGAAGAAGATGAAGAAGATCCTGACAAGCGCATTTCCATTCGGTCATCCGATAAAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTTAAAACAGAAGAGGAAAAGGAAGCAGACGACAAGAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATAAATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCGGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACATATACCAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012686500                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTTCCAGCCCAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATCAAAGGACATGCCAAGTGTGTGGAGTTCATAAAGACCTTTAACTTGCCAATGCTGATGCTAGGAGGTGGCGGTTACACTATCAGGAATGTGGCTCGTTGCTGGACATATGAAACGGCTGTGGCTCTGGACTCCGAGATCCCTAATGAGCTTCCATACAATGATTATTTTGAATATTTTGGACCGGACTTCAAACTTCACATCAGTCCATCCAACATGACCAATCAGAACACTAATGAATATCTGGAGAAAATCAAACAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCAGGAGTTCAGATGCAAGCCATCCCAGAGGACTCTGTACATGATGACAGTGGTGAAGAAGATGAAGAAGATCCTGACAAGCGCATTTCCATTCGGTCATCCGATAAAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTTAAAACAGAAGAGGAAAAGGAAGCAGACGACAAGAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATAAATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCGGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACATATACCTAAAAAAAAAAAAAAAGA
  3   1   2       bld Tbd5      in                    IMAGE:3580217.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTTTCCACAAGTATGAGGAGTATTTCCTGGGAACTGGAGATCTGAGAGATATTGGTGTAGGGAAAGCCAAATACTATGCTGTGAATTACCCCATACGGGATGGGATTGATGATGAGTCCTATGAAGCAATGTTTAAACCAGTGATGACCATAGTTATGGAGATGTTCCAGCCCAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATCAAAGGACATGCCAAGTGTGTGGAGTTCATAAAGACCTTTAACTTGCCAATGCTGATGCTAGGAGGTGGCGGTTACACTATCAGGAATGTGGCTCGTTGCTGGACATATGAAACGGCTGTGGCTCTGGACTCCGAGATCCCTAATGAGCTTCCATACAATGATTATTTTGAATATTTTGGACCGGACTTCAAACTTCACATCAGTCCATCCAACATGACCAATCAGAACACTAATGAATATCTGGAGAAAATCAAACAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCAGGAGTTCAGATGCAAGCCATCCCAGAGGACTCTGTACATGATGACAGTGGTGAAGAAGATGAAGAAGATCCTGACAAGCGCATTTCCATTCGGTCATCCGATAAAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTTAAAA
  5   1   2       bld Ga15                               XL516m17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAGATGTTCCAGCCCAGTGCAGTGGTCCTACAGTGTGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATCAAAGGACATGCCAAGTGTGTGGAGTTCATAAAGACCTTTAACTTGCCAATGCTGATGCTAGGAGGTGGCGGTTACACTATCAGGAATGTGGCTCGTTGCTGGACATATGAAACGGCTGTGGCTCTGGACTCCGAGATCCCTAATGAGCTTCCATACAATGATTATTTTGAATATTTTGGACCGGACTTCAAACTTCACATCAGTCCATCCAACATGACCAATCAGAACACTAATGAATATCTGGAGAAAATCAAACAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCAGGAGTTCAGATGCAAGCCATCCCAGAGGACTCTGTACATGATGACAGTGGTGAAGAAGATGAAGAAGATCCTGACAAGCGCATTTCCATTCGGTCATCCGATAAAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTTAAAACAGAAGAGGAAAAGGAAGCAGACGACAAGAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAAATTCTTATAGTTTCATATATGCCCTGTAC
  5   1   2       bld Ga15                               XL455d07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCCGCATCAAAGGACATGCCAAGTGTGTGGAGTTCATAAAGACCTTTAACTTGCCAATGCTGATGCTAGGAGGTGGCGGTTACACTATCAGGAATGTGGCTCGTTGCTGGACATATGAAACGGCTGTGGCTCTGGACTCCGAGATACCTAATGAGCTTCCATACAATGATTATTTTGAATATTTTGGACCGGACTTCAAACTTCACATCAGTCCATCCAACATGACCAATCAGAACACTAATGAATATCTGGAGAAAATCAAGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCAGGAGTTCAGATGCAAGCCATCCCAGAGGACTCTGTACATGATGACAGTGGTGAAGAAGATGAAGAAGATCCTGACAAGCGCATTTCCATTCGGTCATCCGATAAAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTTAAAACAGAAGAGGAAAAGGAAGCAGACGACAAGAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCCAAGACCAAACAAATTCTCATAGTTTCATAAATGCCCTGTACA
  5   1   2       bld Gas5                            IMAGE:3748409.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAAACGGCTGTGGCTCTGGACTCCCAGATCCCTACTGAGCTTCCATACAATGATTATTTTGAATATTGTGGACCGGACTTCACACTTCACATCAATCCATCCACCGTGACCAATCATAACACTAATGAATATTTGGAGAACATCAAACAT
  5   1   2       bld Ga10                            IMAGE:3558052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTAAGAGCTTCCTACAtttttttttgaatttttGGACCGGCCTTCAAACTTCACATCAGTCCCATCCAACATGACCAATCAGAACACTAATGAATATCTGGAGAAAATCAAGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCAGGAGTTCAGATGCAAGCCATCCCAGAGGACTCTGTACATGATGACAGTGGTGATGAAGATGAAGAAGATCCTGACAAGCGCATTTCCATTCGGTCATCCGATAAAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTtaaaacagaagaggaaaaggaagcagacgacaagaaagatgttaaagaagaggagaaaCTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCC
  5   1   2       bld Tbd7      in                         XL082j14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGNAGCATGCAAGCCATCCCAGNNGNACTCTGTACATGATGACAGTGGTGAAGAAGATGAAGAAGATCCTGACAAGCGCATTTCCATTCGGTCATCCGATAAAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGNAAACATGGCCAGTTTCAAGAAACTAAAACGGGttaaaacagaagaggaaaaggaagcagacgacaagaaagatgttaaagaagaggagaaaCTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATATATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCAGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCCTTCCATATACACCTCTCCTGTCAGACA
  5   1   2       bld Ga18      in                       xlk67p07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ANNNNNTGTACATGATGACAGTGGTGAAGAAGATGAAGAAGATCCTGACAAGCGCATTTCCATTCGGTCATCCGATAAAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTTAAAACAGAAGAGGAAAAGGAAGCAGACGACAAGAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATAAATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCggggggggTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGNGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGANAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTggggaggggggggTCCAGCCGTCTTCCAAANTGGNTGAGAGGTTNGNTNTTTCCTCNAGGGATGGGGAGAANNTG
  5   1   2       bld Neu7                                 XL019i20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACATGATGACAGTGGTGAAGAAGATGAAGAAGATCCTGACAAGCGCATTTCCATTCGGTCATCCGATAAAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTTAAAACAGAAGAGGAAAAGGAAGCAGACGACAAGAAAGATGTTNAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTNAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCC
  5   1   2       chi Skin                            IMAGE:8643734.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGATGAAGAAGATCCTGACAAGCGCATTTCCATTCGGTCATCCGATAAAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTTAAAACAGAAGAGGAAAAGGAAGCAGACGACAAGAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATAAATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCggggggggTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTggggagggggggTCNNGCCTCTTCCNATTGTTTTGAAGGTTTGGTGTTTCTCTGGGATGGGAGATCTTNGGCCCCCCTCAGTAAATATTCGGATTCCCGTTCCCTATGCTGCAACCCCTCANATTTGCATATCAATTTTATTCTGCAATTTCCATTACTATATTGATGTGGTTACTTGTTTTT
  5   1   2       bld Ga15      in                       XL489m08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGACAAGCGCATTTCCATTCGGTCATCCGATAAAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTTAaaacagaagaggaaaaggaagcagacgacaagaaagatgttaaagaagaggagaaacttaaagaTGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATATATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCggggggggTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTggggaggggggggTCCNNCCNTCTTCCNNNTTGNTTTGANAGGGTTGNTTG
  3   1   2       bld Ga18      in                       xlk65o01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CNTNCGATAAAAGGATTNCGTGCGNNGAGGANNTNTCAGATNNNGAGGATGAAGGGGNGGGAGNTCGNAGAAACATGGCNANTTNCAAGAAACTAAAACGGGTTAAAACAGAAGAGGAAAAGGAAGCAGNCGACAAGAAAGATGTTAAAGAAGAGGAGAANCTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAANTCCCAAGNCCAAACAANTTCTCATAGTTTCATATATGCCCTGTACAGANCCACTTCTATATCCTATCCCAGNACAGGCTAAATTATTCGTGTCGGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATNTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTNTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAANTTTCTTTTTTTTTTATGGTTTGAGT
  3   1   2       bld Ga18      in                       xlk67p07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TNCNATAAAAGGNTTGCGNNNNNNGANNAGTTCTNAGNTNNTGANNNNTGAAGGGNAGGGAGNTCGNAGAAACATGGCNAGTTTCAAGAANCTNANCGGGTTAAANCAGAAGAGGAAAAGGAANNAGNCGACAAGAAAGATGTTAAAGAAGAGGAGNACTTAAAGATGNCAAGACAGACAGCAANCGGGTAAAAGAAGAGNCCAAATCANCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGNNCAAACAAATTCTCATAGTTTCATAAATGCCCTGTACAGANNCNCTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCGGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAANTTTCTTTTTTTTTTATGGTTTGAGTTGTNGAAAA
  3   1   2       bld Ga18 5g3  in                      xlk144l12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CNANAAANNNNTNCGTGNGACGNGNNGTNCTCAGNTTCNGAGGATGAAGGGGANGGNNGGTCGNANAACATGNCCANTTTCANGAAACTAAANCGGNTTAAAACAGAAGAGNNAAAGGAAGCAGNCGACAAGAAAGATNTNAAGAAGAGGAGAANCTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGNCCAAATCAGCCTGNTCCTACAAGTACGGGGAGAAANTCCCAAGNCCAAACAAATTCTCATAGTTTCATAAATGCCCTGTACAGANCCACTTCTATATCCTATCCCAGCACAGGCTAANNTATTCGTGTCGGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACNCCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTATGGTTTGAGTTGNNGAAAA
  5   1   2       bld Ga15                               XL454i01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGGATTGCGTGCGACGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTTAaaacagaagaggaaaaggaagcagacgacaagaaagatgttaaagaagaggagaaacttaaagaTGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATATATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCggggggggTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTggggaggggggggTCCNNCCNTCTTCCNNATTGGTTTGANAGGGTTGGNTGNTTCCTCNNNGGATNGNNANANCTGNNNGNCCTCTCTT
  5   1   2       bld Ooc1      in                      xlnoc002b10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAGGATGAAGGGGAGGGAGGTCGCAGAAACATGGCCAGTTTCAAGAAACTAAAACGGGTTAAAacagaagaggaaaaggaagcagacgacaagaaagatgttaaagaagaggagaaacttaaagaTGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATGCTCATAGTTTCATATATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCAGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTGTACCTTTCCTTTGTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCC
  3   1   2       bld Ga18 5g3  in                      xlk146n16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGNTCGCAGAAACATGNCCAGTTTCAAGAANCTAANNGGGTNNAAACAGNAGAGGAAAAGNAAGCAGACGACAAGAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGNCCAAATCANNCTGATCCTACAAGTACGGGGAGAAAATCCCAAGNCCAAACAAATTCTTATAGTTTCATATATGCCCTGTACAGANCCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCAGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTATnGTTnGAnnnnnnnnnAGA
  5   1   2       bld Egg1                               PBX0035F07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTCAAGAAACTAAAACGGGTTAAAACAGAAGAGGAAAAGGAAGCAGACGACAAGAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTTATAGTTTCATATATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCAGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATATTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAAGATTANGCGGTggggaggggggggTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCAT
  5   1   2       bld Tbd7      in                         XL083g24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGAAACTAAAACGGGTTAAAACAGAAGAGGAAAAGGAAGCAGACGACAAGAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCC
  3   1   2       bld Ga18 5g3  in                      xlk165f10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ANNAAACGGNNNANCANAGAGNAAAAGNANCAGNCGACAAGAAAGATGTNAAGAAGAGGAGAAACNNNNGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAANTCCCAAGNCCAAACAAATTCTCATANTTTCATATATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCAGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATNTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCCTTCCATATACACCTCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAANTTTCTTTTNTTTTATGGNNGAG
  5   1   2       bld Egg1                               PBX0009F08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATAAATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCggggggggTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTC
  5   1   2       bld Egg1                               PBX0010C07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATAAATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCggggggggTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTC
  5   1   2       bld Egg1                               PBX0012A05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAAGATGTTAAAGAAGAGGAGAAACTTAAAGATGACAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATAAATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCggggggggTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTC
  3   1   2       bld DMZ  5g3  in                         xl327p23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GNCAAGACAGACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATATATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCAGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCCTTCCATATACACCTCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCANAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTT
  3   1   2       bld DMZ       in                         xl239d08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCAAACGGGTNAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGGACCAAACAAATTCTCATAGTTTCATATATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCAGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCCTTCCATATACACCTCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTATGGTTGAGTGTGAAAA
  3   1   2       bld DMZ  5g3  in                         xl305n21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAGCAAACGGGTAAAAGAAGAGACCAAATCAGCCTGATCCTACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATATATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCAGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCCTTCCATATACACCTCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTATGGTTGAGTGTGAAAA
  5  -1   2       bld Bla2                            IMAGE:7297857.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGACAAATCAGCTGATCNTACAGTACGGGAGAAATCCCANGACCAAACAATTCTCATAGTTCATAAATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCggggggggTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTggggagggggggTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCttttttttttATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACNCTGGTACATATACCTaaaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGGTCCCAATCGCCTTAGATTGGG
  3   1   2      seed DMZ  5g3  in                         xl283m03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACAAGTACGGGGAGAAAATCCCAAGACCAAACAAATTCTCATAGTTTCATATATGCCCTGTACAGAACCACTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCAGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCCTTCCATATACACCTCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTATGGTTTGAGTTGGGAAAAGATTG
  3   1   2       bld Ga15      in                       XL489m08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTNTCATAGTTTCATATATGGCCNTGGTACAGAACCACTTNTATATCCTATCCCAGCACNGGNTAAATTATTCGTGTGGGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCNCATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGNGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTT
  5   1   2       chi Emb4      in                    IMAGE:4203252.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGCGTCCGAAAGACCAGTAAACGCCACTTGTTCTGGAATCCAGTACTATTCCATCTGTTGATCTGGACTTTCAGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTggggaggggggggTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCC
  5   1   2       bld Ga15                               XL515m23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTCTATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCTGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCCTTCCATATACACCTCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTggggagggggggTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCtttttttttATGGTTTGAGTTGTGGAAAANATTTGTAATAAAACCTGGTACATATACCTaaaaaaaaaa
  3   1   2       bld Tbd7      in                         XL090g16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATATCCTATCCCAGCACAGGCTAAATTATTCGTGTCGGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTNTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGNAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGAATGGGAAATTTTCTTTTTTTTNAGGTTTGCAGTTGTGGA
  3   1   2       bld DMZ  5g3  in                         xl306j01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATCCCAGCACAGGCTAAATTATTCGTGTCGGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGNGGANATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTNTGCTACAGTACATTGAGAATATGTACNCCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGGTCCAGCCGTNTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTNTNTTCCNCTAAACTATTCAGGGATTCCCTGTTCTNTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTNTTAGATGTGGGGAAACCTGTTCCNCAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCNTTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTTTATGGTTGA
  5  -1   2       bld Egg1                               PBX0087F05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCCAGCACAGGCTAAATTATTCGTGTCAGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATATTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTggggaggggggggTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCtttttttttATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAA
  5   1   2       bld Gas6                            IMAGE:3438406.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGGCTAAATTATTCGTGTCAGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGT
  3   1   2       bld Tbd7      in                         XL089g16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCGTGTCGGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGANAGGGTTGGTTGTTTCCTCAAGGNATGGGGAGAAACTGAAGGTCCTCTCTTCCANTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCANACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGNAAATGGAGAATTTTTATGTCCNATTTNTGTGATGGGAAATTTCTTTTTTTTTA
  3   1   2       bld DMZ       out                        xl289h09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTCGGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCNCATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCNCATATTCCTGNGCCTCTGTAATCATCAGTGGNGCAATGCATTGNGGATATATTTCTCTGTTCCTTCCANATACACATCTCCTGTCAGACAACAAGACATGTTTGCTACAGTACATTGAGAATATGTACNCCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTNTNTTCCNCTAAACTATTCAGGGATTCCCTGTTCTNTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTNTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCNTTAATCATAGCGGGTTGGAGAGTTTGGGGATTCANGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAAT
  3   1   2       bld Neu7      in                         XL045o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTCGGGGGGGTGAAATGGTAATTTTAGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTNCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTNCTTTTTTTTAGGTTTGNAGTTG
  3   1   2       bld Tbd2 5g3  in                    IMAGE:3199899.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTGGATTAGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACA
  5   1   2       chi Emb4                            IMAGE:5571678.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACATCTGGTAACAGATGTGAAATTTAACTAATCCACTAAAATTACCATTTCCTTTTTTATATAAAAATATTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTggggaggggggggTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAACGAAATGGAGAATTTCTCTGTCCAATTTTTGTGATGGGAAAATTCtttttttttATGGCCAAAAGTCGCCCAAAAGAACCCCCAACAGGTTTTGTTAACTACGGaaaaaaaaaagagggggggggctttccttcagtttcccccccgcgccgccccccccATAACCTCACCCAGCTTCCCGTATTTAAAATGGGCGCAGCGTAGTACGAACAGCGGGCCGCGAGAATGGGGAGGCGCGCCGAAGAACATAACCATAGTTccccttttatcccccccatatgcccccactttccccccctcttttagcgggagcgcccgcccccccAATTCGGAGCCGCCGCCCAGAGTATTATTATACGTGGTATAAGAGCGACGAGAGGGCGCGCCGCAGGAGTAGCGCAGCATGTCCCATATGCAGCTCCTCTACCTAAGCTCCCCCACCCGCC
  3   1   2       bld Tbd7      in                         XL082j14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTTAAATTTCACATCTGTTACCAGATGTTTCCAGCTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCCTTCCATATACACCTCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTAGGTTTGAGTTGGGAAAAGATTNTAATAAAACC
  5   1   2       bld Ga15      in                       XL402f07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCTGTTCCTTCCATATACACCTCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTggggagggggggTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCtttttttttATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACATATACCT
  3   1   2       bld Ga15      in                       XL402f07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCTTTACCTTTCCTTTTTTATATAAAAATGTTCCACATATTCCTGTGCCTCNGTAATCATCAGTGGTGCAATACATTGTGGATATATTTCTCNGTTCCTTCCATATACACCTCTCCTGTCAGACAACAAGACATGTCTGGTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGGAAATGG
  3   1   2       bld Tbd7      in                         XL083g24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTCCACATATTCCTGTGCCTCTGTAATCATCAGTGGTGCAATGCATTGTGGATATATTTCTCTGTTCCTTCCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTA
  3   1   2       bld Ga15 5g3  in                       XL445i04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTCTGTAATCATCAGTGGTGCAATGCATTGNGGATATATTTCTCNGTTCCTTCCATATACACATNTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACCCCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACNGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGG
  3   1   2       bld Oo1       out                   IMAGE:3403315.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCATATACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATATGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACATATACCTAA
  3   1   2       bld Oo1  5g3  in                    IMAGE:3404659.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACATATACCTATAA
  3   1   2       bld Ov1                             IMAGE:4055435.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACACATCTCCTGTCAGACAACAAGACATGTCTGCTACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTTTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACATAT
  3   1   2       bld Oo1       in                    IMAGE:5077936.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TACAGTACATTGAGAATATGTACACCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTAGTGATGGGAAATTTCTTTTTTTTTATGGTTGGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACATATACCTAAAAAAAA
  3   1   2       bld Emb4      in                    IMAGE:4203252.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGTACATTGAGAATATGTACCCCTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGGTCCACCCGTCTTCCAAATTGGTTTGAAAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCCCAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAAAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTTTATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTCCATATAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ooc1      in                      xlnoc002b10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTATGCTCAGGATTAGGCGGTGGGGAGGGGGGGTCCAGCCGTCTTCCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCCCAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACATATACCTAAAAAAAAAAAAAAAA
  5   1   2       bld Egg1                               PBX0050B12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAAATTGGTTTGAGAGGGTTGGTTGTTTCCTCAAGGGATGGGGAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCtttttttttATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACATATaaaaaaaaaaaaaaaaaaaGATTC
  5   1   2       bld Ga15      in                       XL476h05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCtttttttttATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACATATaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL476h05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGAAACTGAAGGTCCTCTCTTCCACTAAACTATTCAGGGATTCCCTGTTCTCTTAATGCTGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTTTTA
  5   1   2       bld Ga15                               XL441n02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCTAACCCTCCTCCAGATTAGTGCATGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGAATTTTTATGTCCAATTTTTGTGATGGGAAATTTCtttttttttATGGTTTGAGTTGTGGAAAAGATTTGTAATAAAACCTGGTACATATACCTaaaaaaaaaa
  3   1   2       bld Neu4                            IMAGE:4084766.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAAGCAGATTCTTAGATGTGGGGAAACCTGTTCCACAGTTACCTCATACTGGGGATTGTGGGTATTGCAATTGGGGTTTCTACCATTAATCATAGCGGGTTGGAGAGTTTGGGGATTCATGGAGTGAAGGAAATGGAGGGGTTTAATGTCCAATTTTTGTGATGGGAAATTTCTTTTTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)