Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8077417.5.5                    22 PI      91          2     1346                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012837540 Xl3.1-IMAGE:4033127.5.5 - 47 ESTs
                                                                       ....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:4033127.5.5               TCTTGTGAGTGTGACAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTCCCCTCTGTGTTCAAGAAGGACGGCATTGTGACTGCAGGAAACGCGTCGGGAATTTCTGACGGAGCCGGTGTTGTGATGTTGGCTAGTGAAGAAGCAACTTCCAAGCACAATCTCACCCCACTTGTGAGAATAGTGGCTTATCATGTGTCGGGATGTGACCCCAACATTATGGGCTTTGGGCCAGTCCCTGCCATCACTGAAGCCCTGAAGAAATCAGGATTAACTCTCCAAGACATGGACCTTGTAGAGGTGAATGAGGCTTTTGCTGCCCAGTACCTGGCTGTGGAGAAAGCCCTGGGCCTTAATCGTGAGAAGACCAATGTTAATGGAGGTGCCATTGCTCTTGGGCATCCCCTGGCGGCATCAGGATCTCGAATCATTTCCCATCTGACACATGAACTGAAGCGCCGTGGAGGCAAATACGCTGTGGGATCGGCCTGCATCGGAGGTGGACAAGGTATTGCCATCATCCTTGAGAATGTCTCCTAAGCCAATCAGGATGTGATTAAGACGCTGTAGGGAGGACCGAAGCTGATATCTTCATCCAATCATGATATCCGCTTGTAATGAAACTTGTACCATCTGCTTTTGGGACTTAAGAAATGTTAACATCAGGCCATATGTACTAAGCACTGCCACAAATTGTTCTGAAATCGCTAGAAGCTCATGTTCTGCAGCTAAACTAACCAATCACTTAATTCAACGGCTAAAGGATAAACACAGCGCTTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATGCACTAACAGAAGAAAGAATCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGAGTCATGGCTCCTGCTTTATTTTACTGGAACGTGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTGATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAACACACAAACTACCTAGCTGTTTAATTACTAATGAGTAGAACTGATGATTTCATTACACAGGCTGTGACGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAATGGACTATAAATCTAAACTCTGTTCTTGTGTTGGCTCTGTG
                                                  Xl3.1-CHK-1012721323                     GAGTGTGACAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTCCCCTCTGTGTTCAAGAAGGACGGCATTGTGACTGCAGGAAACGCGTCGGGAATTTCTGACGGAGCCGGTGTTGTGATGTTGGCTAGTGAAGAAGCAACTTCCAAGCACAATCTCACCCCACTTGTGAGAATAGTGGCTTATCATGTGTCGGGATGTGACCCCAACATTATGGGCTTTGGGCCAGTCCCTGCCATCACTGAAGCCCTGAAGAAATCAGGATTAACTCTCCAAGACATGGACCTTGTAGAGGTGAATGAGGCTTTTGCTGCCCAGTACCTGGCTGTGGAGAAAGCCCTGGGCCTTAATCGTGAGAAGACCAATGTTAATGGAGGTGCCATTGCTCTTGGGCATCCCCTGGCGGCATCAGGATCTCGAATCATTTCCCATCTGACACATGAACTGAAGCGCCGTGGAGGCAAATACGCTGTGGGATCGGCCTGCATCGGAGGTGGACAAGGTATTGCCATCATCCTTGAGAATGTCTCCTAAGCCAATCAGGATGTGATTAAGACGCTGTAGGGAGGACCGAAGCTGATATCTTCATCCAATCATGATATCCGCTTGTAATGAAACTTGTACCATCTGCTTTTGGGACTTAAGAAATGTTAACATCAGGCCATATGTACTAAGCACTGCCACAAATTGTTCTGAAATCGCTAGAAGCTCATGTTCTGCAGCTAAACTAACCAATCACTTAATTCAACGGCTAAAGGATAAACACAGCGCTTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATxCxxxxAxAxxAGAAAGAAxxxxxGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGAGTCATGGCTCCTGCTTTATTTTACTGGAACGTGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTGATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAACACACAAACTACCTAGCTGTTTAATTACTAATGAGTAGAACTGATGATTTCATTACACAGGCTGTGACGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAATGGACTATAAATxxAxxCTCTGTTCTTGTGTTGGCTCTGTGCTCCAC
                                                      consensus depths                    3     3     9     9    18    19    21    21    21    21    22    22    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    25    25    23    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    26    26    24    26    26    26    26    26    26    26    26    26    25    26    26    26    26    26    26    26    26    28    24    27    26    27    26    27    27    27    24    25    23    24    22    24    21    24    19    24    18    23    18    23    18    22    19    22    19    22    16    22    14    22    17    22    15    20    13    20    13    17    12    17    10    16     8    14     9    11     7    12     6    11     6    11     6    10     5    10     4    10     5    10     5    10     5    10     5    10     5    10     4     9     4     9     4     8     4     8     3     7     3     7     3     7     3     7     3     7     3     8     4     8     4     8     5     8     3     8     5     8     5     7     5     7     4     7     5     7     5     7     5     7     5     7     4     7     5     7     5     7     5     6     5     6     5     8     4     8     4     8     4     8     4     8     4     8     4     8     5     8     5     8     5     8     5     7     5     7     5     7     5     8     5     8     5     9     5     9     5    10     5    10     5    10     6    11     6    12     6    13     6    13     6    13     5    14     4    13     4    13     4    13     4    13     4    12     4    12     8    12     8    12     8    12    12    12    11    12    13    14    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    10    13     9    13    10    13    10    13    10    13     9    13     9    12     9    12     8    11     4     6     2     3     2     2
  5   1   2      ests                            Xl3.1-IMAGE:4033127.5               TCTTGTGAGTGTGACAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTCCCCTCTGTGTTCAAGAAGGACGGCATTGTGACTGCAGGAAACGCGTCGGGAATTTCTGACGGAGCCGGTGTTGTGATGTTGGCTAGTGAAGAAGCAACTTCCAAGCACAATCTCACCCCACTTGTGAGAATAGTGGCTTATCATGTGTCGGGATGTGACCCCAACATTATGGGCTTTGGGCCAGTCCCTGCCATCACTGAAGCCCTGAAGAAATCAGGATTAACTCTCCAAGACATGGACCTTGTAGAGGTGAATGAGGCTTTTGCTGCCCAGTACCTGGCTGTGGAGAAAGCCCTGGGCCTTAATCGTGAGAAGACCAATG
  5   1   2      ests                            Xl3.1-IMAGE:6878582.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAAGACCAATGTTAATGGAGGTGCCATTGCTCTTGGGCATCCCCTGGCGGCATCAGGATCTCGAATCATTTCCCATCTGACACATGAACTGAAGCGCCGTGGAGGCAAATACGCTGTGGGATCGGCCTGCATCGGAGGTGGACAAGGTATTGCCATCATCCTTGAGAATGTCTCCTAAGCCAATCAGGATGTGATTAAGACGCTGTAGGGAGGACCGAAGCTGATATCTTCATCCAATCATGATATCCGCTTGTAATGAAACTTGTACCATCTGCTTTTGGGACTTAAGAAATGTTAACATCAGGCCATATGTACTAAGCACTGCCACAAATTGTTCTGAAATCGCTAGAAGCTCATGTTCTGCAGCTAAACTAACCAATCACTTAATTCAACGGCTAAAGGATAAACACAGCGCTTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATGCACTAACAGAAGAAAGAATCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGAGTCATGGCTCCTGCTTTATTTTACTGGAACGTGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTGATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAACACACAAACTACCTAGCTGTTTAATTACTAATGAGTAGAACTGATGATTTCATTACACAGGCTGTGACGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAATGGACTATAAATCTAATCTCTGTTCTTGTGTTGGCTCTGT
                                                                   SNP                                                                                                                           ----A-------
                                                                   SNP                                                                                                                                                                                       ----------T-
                                                                   SNP                                                                                                                                                                                                   -------T--G-
                                                                   SNP                                                                                                                                                                                                               ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                   ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                       -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                       -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                       -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------T-
                                               BLH ATG      29    1961               
                                               BLH MIN      29     231               
                                               BLH MPR      26     231               
                                               BLH OVR      29     112               
                                               EST CLI      15      49               
                                               ORF LNG      29       9               
  5   1   2      ests                            Xl3.1-IMAGE:4033127.5               TCTTGTGAGTGTGACAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTCCCCTCTGTGTTCAAGAAGGACGGCATTGTGACTGCAGGAAACGCGTCGGGAATTTCTGACGGAGCCGGTGTTGTGATGTTGGCTAGTGAAGAAGCAACTTCCAAGCACAATCTCACCCCACTTGTGAGAATAGTGGCTTATCATGTGTCGGGATGTGACCCCAACATTATGGGCTTTGGGCCAGTCCCTGCCATCACTGAAGCCCTGAAGAAATCAGGATTAACTCTCCAAGACATGGACCTTGTAGAGGTGAATGAGGCTTTTGCTGCCCAGTACCTGGCTGTGGAGAAAGCCCTGGGCCTTAATCGTGAGAAGACCAATG
                                                  Xl3.1-CHK-1012688077                     GAGTGTGACAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTCCCCTCTGTGTTCAAGAAGGACGGCATTGTGACTGCAGGAAACGCGTCGGGAATTTCTGACGGAGCCGGTGTTGTGATGTTGGCTAGTGAAGAAGCAACTTCCAAGCACAATCTCACCCCACTTGTGAGAATAGTGGCTTATCATGTGTCGGGATGTGACCCCAACATTATGGGCTTTGGGCCAGTCCCTGCCATCACTGAAGCCCTGAAGAAATCAGGATTAACTCTCCAAGACATGGACCTTGTAGAGGTGAATGAGGCTTTTGCTGCCCAGTACCTGGCTGTGGAGAAAGCCCTGGGCCTTAATCGTGAGAAGA
  5   1   2       chi Tad1      in                    IMAGE:6877484.5p GGGGAGTGACCTTCTCTTGTGAGTGTGACAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCCGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGAAAAATACTCCTTTCCAAAAACAACAAAAGGTGGAAAACCTGCCTCAGGAATCCCGGGAAATTTTTGCCTGCCGAAAATGGGCTCCCCACTggaaattaaaaatcaaggggaaagggccccttattccaaaatgggaaacctggggaaaaaacaccccccccaggccccccAAAACTTTAAATTTGGGGC
  5   1   2       bld Tad1 5g                         IMAGE:6940713.5p   GGGGTGACCTTCTCTTGTGAGTGTGACAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACAGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTTGTGGATAGTGTGATATTCGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCAGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCGAAATATGGCATCACCAGGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGATGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAANATGGCTCCTATTTGAACTAAAATCAAGGAAAAGCCCCTATCAAAAATGGGAACTGGGACCAAACACCCCCAAGCCCAC
  5   1   2       bld Tad1 5g                         IMAGE:6936844.5p     GGGGACCTTCTCTTGTGAGTGTGACAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACAGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTTGTGGATAGTGTGATATTCGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCAGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCGAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGATGGAAAGCTGCTCANGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAAGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCANGCCACAAACTACACTGGAACAGATGGGCAAGCTACCCTCTGTGTTCAA
  5   1   2       bld DMZ  5g                              xl237l09.5p                CTTGTGAGTGTGACAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACAGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTTGTGGATAGTGTGATATTCGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCANAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCGAAATATGGCATCACCANGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGATGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCA
  5   1   2       bld FaB  5g                         IMAGE:8072297.5p                   GTGAGTGTGACAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGAACAGCAGAGGTGGAAAGCTGCTCAGGATCTGGATTTTTGCTGCTGAGATGGCTCTATTGACTAAATCAAGGAAGCCTATCAAATGAACTGGACACACNNCAGCACAACTACCTGGACAGATGGCAGCCCCTCGTGTCAGAAGACGCATGTACTCAGAACCGTCGGATTCGACGACCGTTT
  5   1   2      seed DMZ  5g                              xl303p04.5p                   GTGAGTGTGACAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCCGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAA
  5   1   2       bld Kid  5g                         IMAGE:7010272.5p                    TGAGTGTGACAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCCGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAAACTAAATCAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCCACAACTACACTGGA
  5   1   2       bld Oo1  5g                         IMAGE:6859369.5p                       TCGGATCAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAATCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCCGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTCCCCTCTGTGTTCAAGAAGGACGGCATTGTGACTGCAGGAAACGCGTCGGGAATTTCTGACNGAGCCGGTGTTGTGATGTTGGCCAGTGAAAGAGCAACTTNCCCAGCACATCTCACCCCACTTGTGAGAATAGTGGCTTATCATGTGTCGGGATGTGACCCCAACATTATGGGCTTTGGGGCAAGTCCTGCCATCACTGAAAGCCTGAAGAAATCAGGA
  5   1   2       bld FaB  5g3  in                    IMAGE:8069660.5p                         GTGACAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAATCAAGGAAAGGCCCTATNCAAATGGAACTGGACGAGCACCCANGCCACAACTACACTGGACAGATGGCAAGCTCCCTCTGTGTTCAGAGGACGGCATGTGACTGCGGAAC
  5   1   2       bld FaBN 5g                         IMAGE:8078197.5p                             CAGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGTGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCANGCCACAACTACACTGGACAGATGGCCAGCTCTCTCTGTGTTCAGAAGACNGCATGTGACTGCAGAACCGTCNGGATTCTGAG
  5   1   2       bld Tbd5 5g                         IMAGE:3581105.5p                              AGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCCGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGAC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5047814.5p                              CAGGAACATGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACAGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTTGTGGATAGTGTGATATTCGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCAGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCGAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTTCAGACACAGCAGAGA
  5   1   2       bld Ov1  5g                         IMAGE:6315941.5p                              AGGAACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACAGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTTGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCAGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTTCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACAGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAAAACTAAATCAAGGAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTCCCCTCTGTGTTCAAGAAGGACGGCATTGTGACTGCANGAAAACGCGTCGGGAATTTCTGACGGAGNCCGTGTTTGTGATGGTGGGCCAAGTGAAGAAGCAAACTTCCAGGCACCAATCTCCACCCCACTTTGTGAGGAATAGGGGGGCTTTATTCATGGGGTCCCGGGATGGTGGACCCCCAAACATTTAC
  5   1   2       bld Emb4 5g                         IMAGE:5514968.5p                                GAACAACGCACCACGTTTCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCCGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCANGCCACTAACTACACTGGAACAGATGGCCAAGCTCCCCTCTGTGTTNCAGAANGACGGCATTGTGACTGCAGGGAACGCGTCGGGATTTCTGACNGAGCGGGTGTGT
  5   1   2       bld Ooc3 5g                         IMAGE:3437212.5p                                 AACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGGTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCCGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCATGATTCTTGATATTTTGCTGCTGAGATGGCTCTTATTGAACTAATATCAATGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTTCCC
  5   1   2       bld Kid  5g                         IMAGE:4033127.5p                                 AACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACAGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTTGTGGATAGTGTGATATTCGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCAGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCGAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGATGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTACCCTCTGTGTTCAAGAAAGACGGCATTGTGACTGCNAGGAAACGCGTCGGGAATTTCTGACGGAACCGGTGTTGTGAATGTTTGCTAGTGAAAGAAGCACTTCCAAAGCACAATCTCACCCCACTTGTTGAA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048157.5p                                  ACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACAGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTTGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCAGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTTCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACAGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTA
  5   1   2       bld Tbd7 5g3  in                         XL097f12.5p                                  ACAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACAGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTTGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCAGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTTCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACAGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAAT
  5   1   2       bld Emb4 5g                         IMAGE:5571615.5p                                   CAACGCACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAATCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCCGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGGAACAGATGGCCAAGCTCCCCCTCTGTGTTCAAGAAGGACGGCATTGTGACTGCAGGAAACGCCGTCGGAAATTCTGACGGGACCCCGTGTTGTGGATGTTGGGCCATGGAAAAACCAACTTTCCCAAGCACACCCTCACCCCACTTGGGAAAAATAGTGGGTTAATCACGGGGCCCGGGAGGGGACCCCCAA
  5   1   2       bld Gas5 5g3  in                    IMAGE:3748079.5p                                        CACCATGGCCCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTTGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAATCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTTCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTNTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATC
  5   1   2       bld Ooc2                            IMAGE:3746995.5p                                                 CCTGCTTAGAGGAATTTTTATTGTTGGTGCCAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTTCCATGCCTTCTACCTGGCCAGACATGTGGGTCTGCGGGCAGGTGTACCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCATGAAATTGGCCTCAGGGAATCCGATATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTATGGTACCAAGCTGGGAGCAGACATTAATATGGAAAACACTTTGTGGGCATGGCTAACCGAC
  5   1   2       bld Sp1       in                    IMAGE:4969072.5p                                                                  GACCCACGCGTCCGAAAAGAACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCCGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACG
  5   1   2       bld Li1       in                    IMAGE:3398195.5p                                                                                     AACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCCGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTTGTACCAAGCTGGCAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCTCATGGCAGTCACTGCTGAGAATCTAGGTGCTTAATATTGCATCACCTAGGAAGACTGTGACCAATACTTCTTTCCGACACCACATAGGTGGGAAGGTGATCAGGATTCT
  5   1   2       bld Emb4      in                    IMAGE:4203390.5p                                                                                     AACCCCCTTCGGTACATATGGGGGACTGTTAAAAGACCACACGGCGACTGATCTGGGTGAAATTGCAGCAAAGGCCGCGCTTGCAGCTGGGAAGGTGTCCCCTGAGCTCGTGGATAGCGTCATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCCGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAATCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCCGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACC
  5   1   2       bld Brn3                            IMAGE:8541251.5p                                                                                                                                                                                     GTCCCCTGAGCTTGTGGATAGCGTGATATTTGGCAACGTTGCTCAGACTTCTTCCGATGCCATCTACCTGGCCAGGCATGTGGGTCTGCGGGCAGGTGTCCCGATCCCTGTACCAGCACTTACAGTCAACAGACTCTGTGGGTCTGGATTCCAGTCAATTGTCAATGGATGTCAGGAAATTGGCCTCAGGGAATCAGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTTCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACAGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTCCCCTCTGTGTTCAAGAAGGACGGCATTGTGACTGCAGGAAACGCGTCGGGAATTTCTGACGGAGCCGGTGTTGTGATGTTGGCCAGTGAAGAAGCAACTTCCAGCACATCTCACCCACTTGTGAGATAGTGGCTATCATGTGTCGGGAGTGACCCACATATGGGCTTGGCAGTCCTGCATCACTGAGCCTGAGAATCAGATACTCTCAGACTGACTGTAAGTGATAGCTTGCGCATACTGCTGGAAAGCTGGCTACTGAAACAGTAGAGCCT
  5   1   2       bld Tad1      in                    IMAGE:6878582.5p                                                                                                                                                                                                                                                                                                                                                                  GGGAAATTGGCCTCAGGGAATCCGAGATTGTAATGTGTGGAGGATCGGAGAACATGAGCCAATCACCCTATGCTGTGCGGAACATCCGCTTTGGTACCAAGCTGGGAGCAGACATTAAGATGGAAGACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTCCCCTCTGTGTTCAAGAAGGACGGCATTGTGACTGCAGGAAACGCGTCGGGAATTTCTGACGGAGCCGGTGTTGTGATGTTGGCCAGTGAAGAAGCAACTTCCCAGCACAATCTCACCCCACTTGTGAGAATAGTGGCTTATCATGTGTCGGGATGTGACCCCACCTTAGGGGCTTTGGGGCCAGTCCCTGCCATCCCTGAAGCCCTTAAAGAAATCAGGATTAACTCCTCCAAGACATGGGACCCTGTAAAAGGTGAAAGGAGGCTTTTGCTGCCCAATTACCTGGGCTGTGGAGAAACCCCTGGGGCCTTTACCCGGGGGAAGACCCAATGTTTAATGGAAGGGCCCCCTTGC
  5   1   2       bld FaB                             IMAGE:8073286.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACACTTTGTGGGCAGGGCTAACCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTCCCCTCTGTGTTCAAGAAGGACGGCATTGTGACTGCAGGAAACGCGTCGGGAATTTCTGACGGAGCCGGTGTTGTGATGTTGGCTAGTGAAGAAGCAACTTCCAAGCACAATCTCACCCCACTTGTGAGAATAGTGGCTTATCATGTGTCGGGATGTGACCCCAACATTATGGGCTTTGGGCCAGTCCCTGCCATCACTGAAGCCCTGAAGAAATCAGGATTAACTCTCCAAGACATGGACCTTGTAGAGGTGAATGAGGCTTTTGCTTGCCCAGTACCTGTCTGTGGAAAAAGCCCTGTGCCTTAATCGTGAGAAGACCATTGTTAATGGAAGTGCCTTTGCTCTTGAGCATCCCTGGCGGCATCGGATCTCGATCATTCCCATCTGACCATGACTGAAGCCCGTGGAGCAATACGCTGTGGGATCGGCTGTTCGAAGTGTACAGTTGATTTCAACAAACCTGGTCCTGTT
  3   1   2       add Tad1      in                    IMAGE:6877484.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGTGGGCAGGGTTAACCGGACCCTCTGATCCAAGACCCCCCATGGCAATTCACTGCTGAGAATCTAGGGGCAAAATAGGGCATCACCAGGGAAGACTGTGCCAAATACTCTTTCCAGACACAGCAGAGGGGGAAAGCTGCTCAGGATTCGGAATATTTGGTGGCTGAGATGGCTCCTATTGAACTAAAATCAAGGTAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTCCCCTCTGTGTTCAAGAAGGACGGCATTGTGACTGCAGGAAACGCGTCGGGAATTTCTGACGGAGCCGGTGTTGTGATGTTGGCTAGTGAAGAAGCAACTTCCAAGCACAATCTCACCCCACTTGTGAGAATAGTGGCTAATCATGTGTCGGGATGTGACCCCAACATTATGGGCTTTGGGCCAGTCCCTGCCATCACTGAAGCCCTGAAGAAATCAGGATTAACTCTCCAAGACATGGACCTTGTAGAGGTGAATGAGGCTTTTGCTGCCCAGTACCTGGCTGTGGAGAAAGCCCTGGGCCTTAATCGTGAGAAGACCAATGTTAATGGAGGTGCCATTGCTCTTGGGCATCCCCTGGCGGCATCAGGATCTCGAATCATTTCCCATCTGACACATGAACTGAAGCGCCGTGGAGGCAAATACGCTGTGGGATCGGCCTGCATCGGAGGTGGACAAGGTATTCCCATCATCCTTGAGAATGTCTCCTAACCCAATCAGTATGTGATAGCAGAAAGCTGTCCAGGAAAAGAACACACGGGAACCATCCTCGCTATTCTCTACTTTTAATAAAGTAAGTGAAGACCAATAACTATTTGACACTTCGTCTAAGCGCTTATTGCT
  5   1   2       bld Egg1      in                    IMAGE:3301259.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCACGAGGCCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTCCCCTCNNTGTGTTCAA
  5   1   2       bld Egg1      in                    IMAGE:4677938.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCACGAGGCCGACTCTCTGATCAAGACCCCCATGGCAATCACTGCTGAGAATCTAGGGGCAAAATATGGCATCACCAGGGAAGACTGTGACAAATACTCCTTCCAGACACAGCAGAGGTGGAAAGCTGCTCAGGATTCTGGATATTTTGCTGCTGAGATGGCTCCTATTGAACTAAAATCAAGGAAAGGCCCTATCAAAATGGAACTGGACGAGCACCCCAGGCCACAAACTACACTGGAACAGATGGCCAAGCTCCCCTCTGTGTTCAAGAAGGACGGCATTGTGACTGCAGGAAACGCGTCGGGAATTTCTGACGGAGCCGGTGTTGTGATGTTGGCTAGTGAAGAAGCAACTTCCAAGCACAATCTCACCCCACTTGTGAGAATAGTGGCTTATCATGTGTCGGGATGTGACCCCAACATTATGGGCTTTGGGCCAGTCCCTGCCATCACTGAAGCCCTGAAGAAATCAGGATTAACTCTCCAAGACATGGACCTTGTAGAGGTGAATGAGGCTTTTGCTGCCCAGTACCTGNCTGTGGAGAAAGCCCTGGGCCTTAATCGTGAGAAGACCAATGTT
  5   1   2      ests                            Xl3.1-IMAGE:6878582.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAAGACCAATGTTAATGGAGGTGCCATTGCTCTTGGGCATCCCCTGGCGGCATCAGGATCTCGAATCATTTCCCATCTGACACATGAACTGAAGCGCCGTGGAGGCAAATACGCTGTGGGATCGGCCTGCATCGGAGGTGGACAAGGTATTGCCATCATCCTTGAGAATGTCTCCTAAGCCAATCAGGATGTGATTAAGACGCTGTAGGGAGGACCGAAGCTGATATCTTCATCCAATCATGATATCCGCTTGTAATGAAACTTGTACCATCTGCTTTTGGGACTTAAGAAATGTTAACATCAGGCCATATGTACTAAGCACTGCCACAAATTGTTCTGAAATCGCTAGAAGCTCATGTTCTGCAGCTAAACTAACCAATCACTTAATTCAACGGCTAAAGGATAAACACAGCGCTTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATGCACTAACAGAAGAAAGAATCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGAGTCATGGCTCCTGCTTTATTTTACTGGAACGTGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTGATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAACACACAAACTACCTAGCTGTTTAATTACTAATGAGTAGAACTGATGATTTCATTACACAGGCTGTGACGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAATGGACTATAAATCTAATCTCTGTTCTTGTGTTGGCTCTGT
                                                  Xl3.1-CHK-1012690766                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCAATGTTAATGGAGGTGCCATTGCTCTTGGGCATCCCCTGGCGGCATCAGGATCTCGAATCATTTCCCATCTGACACATGAACTGAAGCGCCGTGGAGGCAAATACGCTGTGGGATCGGCCTGCATCGGAGGTGGACAAGGTATTGCCATCATCCTTGAGAATGTCTCCTAAGCCAATCAGGATGTGATTAAGACGCTGTAGGGAGGACCGAAGCTGATATCTTCATCCAATCATGATATCCGCTTGTAATGAAACTTGTACCATCTGCTTTTGGGACTTAAGAAATGTTAACATCAGGCCATATGTACTAAGCACTGCCACAAATTGTTCTGAAATCGCTAGAAGCTCATGTTCTGCAGCTAAACTAACCAATCACTTAATTCAACGGCTAAAGGATAAACACAGCGCTTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATGCACTAACAGAAGAAAGAAxxxxTGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGAGTCATGGCTCCTGCTTTATTTTACTGGAACGTGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTGATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAACACACAAACTACCTAGCTGTTTAATTACTAATGAGTAGAACTGATGATTTCATTACACAGGCTGTGACGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAATGGACTATAAxTxxAxTCTCTGTTCTTGTGTTGGCTCTGTGCTCCA
  3   1   2       bld Panc                            IMAGE:8735037.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAAAGGTTCCCTTCTGTGTCAAGAGACGCATTGGATGCAGAACGGTTCGAATCGACGAGCGTTGGATGTTGTCAGTGAGAGCACTGAGCACATCTCACCCACTTGTGAGATAGTGGCTATCATGTGTCGGATGTGACCCCAACATTATGGGCTTGGGCAGTCCTGCCATCACTGAAGCCTGAAGAAATCAGGATTAACTCTCCAAGACATGGACTTGTAGAGGTGAATGAGGCTTTTGCTGCCCAGTACCTGGCTGTGGAGAAAGCCCTGGGCTTAATCGTGAGAAGACCAATGTTAATGGAGGTGCCATTGCTCTTGGGCATCCCCTGGCGGCATCAGGATCTCGAATCATTTCCCATCTGACACATGAACTGAAGCGCCGTGGAGGCAAATACGCTGTGGGATCGGCCTGCATCGGAGGTGGACAAGGTATTGCCATCATCCTTGAGAATGTCTCCTAAGCCAATCAGGATGTGATTAAGACGCTGTAGGGAGGACCGAAGCTGATATCTTCATCCAATCATGATATCCGCTTGTAATGAAACTTGTACCATCTGCTTTTGGGACTTAAGAAATGTTAACATCAGGCCATATGTACTAAGCACTGCCACAAATTGTTCTGAAATCGCTAGAAGCTCATGTTCTGCAGCTAAACTAACCAATCACTTAATTCAACGGCTAAAGGATAAACACAGCGCTTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATGCACTAACAGAAGAAAGAAAATCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGTCATGGCTCCTGCTTTATTTTACTGGAACGTGTCTCACATTTGGCAGACGCCACACACATCGATCTCTTTTCTTCTTGG
  5   1   2       add Ov1                             IMAGE:8328222.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACTTGTGAGAATAGTGGCTTATCATGTGTCGGGATGTGACCCCAACATTATGGGCTTTGGGCCAGTCCCTGCCATCACTGAAGCCCTGAAGAAATCAGGATTAACTCTCCAAGACATGGACCTTGTAGAGGTGAATGAGGCTTTTGCTGCCCAGTACCTGGCTGTGGAGAAAGCCCTGGGCCTTAATCGTGAGAAGACCAATGTTAATGGAGGCGCCATTGCTCTTGGGCATCCCCTGGCGGCATCAGGATCTCGAATCATTTCCCATCTGACACATGAACTGAAGCGCCGTGGAGGCAAATACGCTGTGGGATCGGCCTGCATCGGAGGTGGACAAGGTATTGCCATCATCCTTGAGAATGTCTCCTAAGCCAATCAGGATGTGAGGAAGACGCTGTAGGGAGGACCGGAGCTGATATCTTCATCCAATCATGATATCCACTTGTACCATCTGCTTTTGGGACTTAAGAAATGTTAACATCAGGCCATATGTACTAAGCACTGCCACAAATTGTTCTGAAATCGCTAGAAGCGCATGTTCTGCAGCTAAACTAACCAAGCACTTAATTCCACGGCTAAAGGATAAACATGGCCCTTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTAtttttgttttttCTATACTCCACTAACAGAAGAAAGAAAATCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAG
  5   1   2       bld Gas8      in                    IMAGE:3517963.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGCTTTTGCTGCCCAGTACCTGGCTGTGGAGAAAGCCCTGGGCCTTAATCGTGAGAAGACCAATGTTAATGGAGGCGCCATTGCTCTTGGGCATCCCCTGGCGGCATCAGGATCTCGAATCATTTCCCATCTGACACATGAACTGAAGCGCCGTGGAGGCAAATACGCTGTGGGATCGGCCTGCATCGGAGGTGGACAAGGTATTGCCATCATCCTTGAGAATGTCTCCTAAGCCAATCAGGATGTGATTAAGACGCTGTAGGGAGGACCGAAGCTGATATCTTCATCCAATCATGATATCCGCTTGTAATGAAACTTGTACCATCTGCTGTTGGGACTTAAGAAATGTTAACATCAGGCCATATGTACTAAGCACTGCCACAAATTGTTCTGAAATCGCTAGAAGCTCATGTTCTGCAGCTAAACTAACCAATCACTTAATTCAACGGCTAAAGGATAAACACAGCGCTTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATNTTTGTTTTTTCTATACTCCTATGCACTAACA
  3   1   2       bld Tad1      in                    IMAGE:6878582.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCTGGCTGTGAAGAAAGCCTTGGGCCTTAATCGGGAGAAGCCCAATGTTAATGAGGCGCCCATGCTTCTTGGGCATCCCTGGGCGGCATCAGGATCTCGAATCATTCCCCATTTGACACATGAACTGAAGCGCCGTGGAGGCAAATACGCTGTGGGATCGGCNTGCATCGGAGGTGGACAAGGTATTGCCATCATTCTTGAGAATGTCTCCTAAGCCAATCAGGATGTGATTAAGACGCTGTAGGGAGGACCGAAGCTGATATCTTCATCCAATCATGATATCCGCTTGTAATGAAACTTGTACCATCTGCTTTTGGGACTTAAGAAATGTTAACATCAGGCCATATGTACTAAGCACTGCCACAAATTGTTCTGAAATCGCTAGAAGCTCATGTTCTGCAGCTAAACTAACCAATCACTTAATTCAACGGCTAAAGGATAAACACAGCGCTTGAGATCTGCAACTGCCGATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATGCACTAACAGAAGAAAGAAAATCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGTCATGGCTCCTGCTTTATTTTACTGGAACGTGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTAATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGGATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAAAACACAAACTACCTAGCTGTTTGATTACTAATGAGTAGAACTGATGATTTCATTACACAGGCTGGACGCTCTTAAGT
  3   1   2       bld Gas5 5g3  in                    IMAGE:3748079.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGACCAATGTTATGCAGGCGCCCATTGCTCTTGGGCATCCCCTGGCGGCATCAGGATCTGAATTCATTTCCCATCTGACACATGAACTGAAGCGCCGTGGAGGCAAATACGCTGTGGGATCGGCTTGCATCGGAGGTGGACAAGGTATTGCCATCATCCTTGAGAATGTCTCCTAAGCCAATCAGGATGTGATTAAGACGCTGTAGGGAGGACCGAAGCTGATATCTTCATCCAATCATGATATCCGCTTGTAATGAAACTTGTACCATCTGCTTTTGGGACTTAAGAAATGTTAACATCAGGCCATATGTACTAAGCACTGCCACAAATTGTTCTGAAATCGCTAGAAGCTCATGTTCTGCAGCTAAACTAACCAATCACTTAATTCAACGGCTAAAGGATAAACACAGCGCTTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATGCACTAACAGAAGAAAGAAAATCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGTCATGGCTCCTGCTTTATTTTACTGGAACGTGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTAATAAATGAACAGGATTTTTAAA
  3   1   2       bld Tbd7 5g3  in                         XL097f12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTAAGCCAATCAGGATGTGAGGAAGACGCTGTAGGGAGGACCGGAGCTGATATCTTCATCCAATCATGATATCCGCTTGTAATGAAACTTGTACCATCTGCTTTTGGGACTTAAGAAATGTTAACATCAGGCCATATGTACTAAGCACTGCCACAAATTGTTCTGAAATCGCTAGAAGCGCATGTTCTGCAGCTAAACTAACCAAGCACTTAATTCCACGGCTAAAGGATAAACACGGCCCTTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATGCACTAACAGAAGAAAAAAAATCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGAGTCATGGCTCCTGCTTTATTTTACTGGAACGTGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTGATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAACACAAACTACCTAGCTGTTTAATTACTAATGAGTAGAACTGATGATTTCATTACACAGGCTGTGACGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAAG
  3   1   2       bld FaB  5g3  in                    IMAGE:8069660.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACTGGTTAAAGACTCGGTTGGGAAGGCCCGGGTGTGGATTTTTTCATGCCAATCATGAGATTCAGCTCGTAATGAAACTTGGCACATTCTGCTTTTTAGGACTTAAGAAAATGTTAACATCAGGGCCATATGTATTAAGCACTGCCACAAATTGTTCTGAAATCGCCTAGAAGCGCATGTTCTGCAGCTAAACTAACCAAGCACTTAATTCCACGGCTAAAGGATAAACACGGCCCTTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATGCACTAACAGAAGAAAGAAAATCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGAGTCATGGCTCCTGCTTTATTTTACTGGAACGTGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTGATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAACACACAAACTACCTAGCTGTTTAATTACTAATGAGTAGTACTGATGATTTCATTACACAGGCTGTGATGCTCTAAATGTGCCTTATCAACAAGGGCATAGACATACATTAATCCCATTCT
  3   1   2       bld Sp1       in                    IMAGE:4969072.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAATCGCTAGAAGCGCATGTTCTGCAGCTAAACTAACCAAGCACTTAATTCCACGGCTAAAGGATAAACACAGCCCTTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATGCACTAACAGAAGAAAGAAAATCCATGTATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGAGTCATGGCTCCTGCTTTATTTTACTGGAACACCGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTGATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAAAACACAAACTACCTAGCTGTTAAATTACTAATGAGTAGAACTGATGATTTCATTACACAGGCTGTGACGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAATGGACTATAAATCTAAAAAAAAAAAAAAAG
  3   1   2       bld Egg1      in                    IMAGE:4677938.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGCAGCTAAACTAACCAAGCACTTAATTCCACGGCTAAAGGATAAACACGGCCCTTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATGCACTAACAGAAGAAAAAAAAATCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGAGTCATGGCTCCTGCTTTATTTTACTGGAACACCGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTGATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAACACACAAACTACCTAGCTGTTTAATTACTAATGAGTAGAACTGATGATTTCATTACACAGGCTGTGACGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAATGGACTATAAATCTAAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5048157.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGCACTTAATTCCACGGCTAAAGGATAAACATGGCCCTTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCACTAACAGAAGAAAGAAAATCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGAGTCATGGCTCCTGCTTTATTTTACTGGAACGTGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTGATAAATGAACAGGATTTATTACACCGTGCCATTAGCTAGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAACACACAAACTACCTAGCTGTTTAATTACTAATGAGTAGTACTGATGATTTCATTACACAGGCTGTGACGCTCTAAATGTGCCTAATCAACAAGGGCTTCAATTAAAATGGACTATAAATCTA
  3   1   2      seed Emb4      in                    IMAGE:4203390.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGAGATCTGCAACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATGCACTAACAGAAGAAAGAAAATCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGTCATGGCTCCTGCTTTATTTTACTGGAACGTGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTAATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAAAACACAAACTACCTAGCTGTTTGATTACTAATGAGTAGAACTGATGATTTCATTACACAGGCTGTGACGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAATGGACTATAAATCTA
  3   1   2       bld Egg1      in                    IMAGE:3301259.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTGCCAATCTTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATGCACTAACAGAAGAAAAAAAAATCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGAGTCATGGCTCCTGCTTTATTTTACTGGAACACCGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTGATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAACACACAAACTACCTAGCTGTTTAATTACTAATGAGTAGAACTGATGATTTCATTACACAGGCTGTGACGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAATGGACTATAAATCTAAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5047814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTGTTTTCCGCCGTCCATGAGTATTTTTGTTTTTTCTATACTCCTATGCACTAACAGAAGAAAGAAAATCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGAGTCATGGCTCCTGCTTTATTTTACTGGAACGTGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTGATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAAAACACAAACTACCTAGCTGTTTAATTACTAATGAGTAGTACTGATGATTTCATTACACAGGCTGTGACGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAATGGACTATAAATCTA
  3   1   2       bld Li1       in                    IMAGE:3398195.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATGCACTAACAGAAGAAAACAAATCCCATGTGTGTTGGCTTTCAGTTCTCTGCTTGTTCTTTAGGTTGATTTTCAAACAGAGTCATGGCTCCTGCTTTATTTTACTGGAACACCGTCTCACATTTGGCAGAAGCCTATCAGATCCTTGGATTTCTGATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAACACACAAACTACCTAGCTGTTTAATTACTAATGAGTAGTACTGATGATTTCATTACACAGGCTGTGATGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAATGGACTATAAATCTA
  5   1   2       bld Gas5      in                    IMAGE:3751436.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTATCAGATCCTTGGATTTCTGATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTTGTATTTAATACATATTGTGTACAACACAAACTACCTAGCTGTTTAATTACTAATGAGTAGAACTGATGATTTCATTACACAGGCTGTGATGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAATGGACTATAAATCTAAATTCTCTGTTCTTGTGTTGGCTCTGTGCTCCACCTGG
  3   1   2       bld Gas8      in                    IMAGE:3517963.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCAGATCCTTGGATTTCTAATAAATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAAAACACAAACTACCTAGCTGTTTGATTACTAATGAGTAGAACTGATGATTTCATTACACAGGCTGTGACGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAATGGACTATAAATCTAAAAAA
  3   1   2       bld Gas5      in                    IMAGE:3751436.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATGAACAGGATTTATTACACCGTGCCATTAGCTTGGAATACACTTGCTGCACTCATTTAACTTGCAAAATAACTCCATACAGAATGTAAAGCTAAATTAGCAAAGATGAATGATCTGTAAAGTAGTATTTAATACATATTGTGTACAACACAAACTACCTAGCTGTTTAATTACTAATGAGTAGAACTGATGATTTCATTACACAGGCTGTGATGCTCTAAATGTGCCTTATCAACAAGGGCTTCAATTAAAATGGACTATAAATCTAAATTCTCTGTTCTTGTGTTGGCTCTGTGCTCCACCTGGGGTCATCCCCGAAAGAAAAGAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)