Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xlk136o13ex.3                        49 PI      89         29     1226                (no blast hit)
     2   0.0    0Xl3.1-xl278k15.5                           22 PI      82         81      517                Xsox17-beta protein [Xenopus laevis]
     3   0.0    0Xl3.1-IMAGE:4175390-IMAGp.5                 5 PI      82        261      495                xSox18beta protein [Xenopus laevis]
     4   0.0    0Xl3.1-IMAGE:7295756.3                       4 PI      85         75      517                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012837548 Xl3.1-IMAGE:7980522.5.5 - 52 ESTs
                                                                       .0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:7980522.5.5  ATCAGTCGCTGGGTAGGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTCTTGCCAGGCTCTGCCAGGCATCACCAGGTCCACCAAGCTGGGCAGCCCTCCCCACCCCCTGAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTGTTTTATTTTATTTTGCACTTTTATAAATAAACATTCAAATATAAAAAAAAA
                                                  Xl3.1-CHK-1012722234        CGCTGGGTAGGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACxxxxxxCTTGCCAGGCTCTGCCAGGCATCACCAGGTCCACCAAGCTGGGCAGCCCTCCCCACCCCCTGAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTGTTTTATTTTATTTTGCACTTTTATAAATAAACATTCAAATATAAxxxAAAAAAAAAA
                                                      consensus depths       2     2     8     9    18    21    21    25    21    25    22    27    24    27    24    27    24    27    25    28    25    28    25    28    25    28    25    28    24    28    24    28    24    28    24    28    24    28    25    28    25    28    25    28    27    29    27    29    27    30    27    30    27    30    27    30    27    31    28    31    28    31    30    31    30    31    29    31    28    29    28    29    28    29    28    29    28    30    28    30    23    30    23    30    24    30    24    30    22    29    19    28    20    28    20    30    18    31    18    31    17    31    17    31    15    30    17    29    15    29     9    28    14    29    12    28    11    29    10    23    10    23    10    19     7    17     6    16     6    14     5    14     5    14     5    13     5    13     5    14     5    14     6    15     7    15     7    15     6    16     6    18     6    18     6    18     5    18    12    18    10    18    12    19    11    19    15    19    12    20    16    19    16    19    16    19    17    19    18    19    18    19    18    19    18    19    18    20    19    20    20    21    19    21    20    21    20    20    20    20    19    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    21    21    20    20    20    20    19    20    19    20    18    20    18    20    18    20    18    20    18    20    17    20    18    20    17    20    18    20    18    20    16    19     8    10     8    10     7     9     3     5
  5   1   2       e>2                            Xl3.1-IMAGE:7980522.5             GGTAGGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTGTTCTTCACATCTCCAGCCCAGGACGAGTGC
  5   1   2       e50                                Xl3.1-xlk2a11ex.5                      ACTGTACAACCAGCCAGTGACCTGGCAATCGCAAGCCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGAC------------------------CATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGATCTGCCCAATTCTAGGAGAAAGNCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGNAAGTCTTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGG------------GGGCGCAGATGGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACTCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTTCCTCTGGATTTGGCAGAAGCAGATCCCGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGNCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTACTTGCCAGGCTCTGCAGGNAT------------CAAGCTGGGCAGCCCTCCCCACCCCCTGAGGCTCAG------------------------AACCGGCTGACATGTTGGCAGANGNGGACAGGACTGAATTCGAGCAGNATCTGAGCTATGTGGCCAAGTCAG------------ATTNTCATGCGCAGGAATCGGTGG
  5   1   2       e>2                              Xl3.1-xlk118m19ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCAAGCAGTGGGCTCCCCATTATGACGGTTACAG------------GAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTNTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTACTGCCAGGCTCTGCCAGGCATCACCAGGTCCACCAAGCTGGGCAGCCCTCCCCACCCCCTGAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTGTTTTATTTTATTTTGCACTTTTATAAATAAACATTCAAATA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                  ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                      ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --T---------
                                               BLH ATG      72     641  
                                               BLH MIN      15     105  
                                               BLH OVR      72      63  
                                               EST CLI       2      52  
                                               ORF LNG      72       3  
  5   1   2       e>2                            Xl3.1-IMAGE:7980522.5             GGTAGGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTGTTCTTCACATCTCCAGCCCAGGACGAGTGC
                                                  Xl3.1-CHK-1012688468                   AACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATG
  5   1   2       bld Em10 5g                         IMAGE:7983505.5p GATCAGTCGCTGGGTAGGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCC
  5   1   2       bld DMZ  5g3  in                         xl324o11.5p  ATCAGTCGCTGGGTAGGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCTTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGA
  5   1   2       bld Neu4 5g3  in                    IMAGE:3557165.5p     AGTCGCTGGGTAGGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGANAACGGCTTCATGCACATGGCAGAGGCGCATGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACTCCCACGGGCCAGTTCCTCAGAGCAGNCACTACAGGGAACCCCCAGCAGTGGCTCCCCATTATGACGGNTACAGTNNTGCCACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCN
  5   1   2       bld Em10 5g                         IMAGE:7979833.5p     AGTCGCTGGGTAGGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGNGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAGCAGTGGCTCCCCATATGACGGTACAGTTTGCCACTCCTGAAGCTCTCTCTGGATTGGCAGAGCAATCCGTGTTCTCACTCTCAGCCAGACGATGCAGATATGCTAAGCTCATGCACTACTCACACGACTCATGTGTAGAGAGCACA
  5   1   2       bld Neu4 5g3  in                    IMAGE:3557094.5p      GTCGCTGGGTAGGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGATGTGTCTAGAGAACTTAGCCTGGTTATCATGAGCAGACTTACTCCCACGGCCAGGTTCCTCAGAGCAGCACTACAGGGAACCCCCAG
  5   1   2       bld Emb9 5g                         IMAGE:7978170.5p        CGCTGGGTAGGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTGTTCTTCACATCTCCAGCCCAGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGGCTTACCCCTTCACCCAGG
  5   1   2       bld Em10 5g                         IMAGE:7979088.5p           TGGGTAGGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGAAGTGTCTAGAGAACTTCAGCCTGGTTATCATGAGCAGACTTACCCCCAATGCCAGGTTCCTCAAACAGCCACTAAAGGAACCCCAACAGTGGCTCCCCATATGACGGTTAAATTTTGCCCACTCTTAAACT
  5   1   2       bld Ga18      in                      xlk118o23ex.5p           TGGGTAGGANCTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCAGTNNNNGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGNNTCTGCCAATTCTAGGAGCANNNNNAGNNTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGNAAGATGCTTNNNAGTCTTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGNGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGNGCAGGAGANNNNNTNNTGGGCGCAGATGGAAGGANGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACTCCCACNGCC
  5   1   2       bld Emb9 5g                         IMAGE:7976654.5p                 GGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACTGGTGAAGAGGATGATGAGGGCAGAAAACGGCTTCATGCACATGGCATAGGCGCTTGATAGCTCATTGCTGTGTGCTTATCGAATGATGTGTTCTGAATACTTCAACCTGTGTTATCTGAATAGACTTCTCCCATGGCCTGTTTTCCTTATCATCCACTACGGGAATCTCAGCTTTGTTTCCCCTTAATTACGTTACAGTTGCCATTCTTTATACTTTTCTTGGTATTGGCAAACTATATTTC
  5   1   2       bld Em10 5g                         IMAGE:8319146.5p                 GGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAAAGCAGCCACTACAGGGGAACCCAAGCAGTGGCTCCCCATTATGACGGTTAC
  5   1   2       bld Em10 5g                         IMAGE:7978812.5p                  GAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAAACCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGGATTGGCAGAAGCAGATCCCGTGTTCTTCACATCTCCAGCCCAG
  5   1   2       bld Em10 5g3  in                    IMAGE:7980522.5p                  GAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTGTTCTTCACATCTCCA
  5   1   2       bld Em10 5g                         IMAGE:8319480.5p                  GAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCNNCAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAG
  5   1   2       bld Em10 5g                         IMAGE:8321723.5p                   GAACTGTACACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTGT
  5   1   2       bld Em10 5g3  in                    IMAGE:7981740.5p                    ACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTGTTCNTCACAT
  5   1   2       bld Emb9 5g                         IMAGE:7978638.5p                       GTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCCGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCTAGATGATGC
  5   1   2       bld Em10 5g                         IMAGE:8317446.5p                        GTACACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAAGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGGCAGGTTCCTCAGAGCAGCCCCTACAGGGAACCCAAGCAGTGCCTCCCATTATGACGGGTACAGTTTGCCCACTCTGAAAGCTCTCTCTGGATTTGGCAAAGCGAA
  5   1   2      seed Em10 5g                         IMAGE:8318817.5p                          CAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTG
  5   1   2       bld Em10 5g                         IMAGE:8318235.5p                           AACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCATAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAAGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCATGAGAGTCGCAGTGCTGGGCGCAGATTGGAAGGATGTGTCTAGAGAACTTCATCCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCCTCAGAGCAGCCACTACAGGGAACCCCCAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCTCCACTCCTGAATATCTCTCCTCTGGATTTGGCAAA
  5   1   2       bld Em10 5g                         IMAGE:8321687.5p                               CAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAAAGCGCATTGCTGGGCGCAAATGGGAAGATGTGTCTAGAGAACTTCCACCTGGGTTATCATGAGCAGACTTACCCCACGGCCAGGTTTCTCAGAAGCACCACTACCGGGAACCCCAGGCAGGGCTCCCCCTTAGACCGTACAGTTTGCCCCTCCGAAAACTTCCCTCTG
  3  -1   2       bld Bla2      in                    IMAGE:7295630.3p                                GCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAATTCAGCCTGGGTATCATGAGCAGATTACCCCCCGGCCAGGTTCTCAGAGCACCACTAAGGAACCCCAGCAGTGCTCCCTTATGAGGTACAGTTGCACTCTGAAGCCTCTCTGATTGCAAGCAATCGTGTCTCCTCTCAGCAGACATGCGATAGCTAACTCATGCCTCTCCACAACCTGTGAAACCACGAAGTATTCTCGTAGTGATCATGTGATTCGTCGCTCAGCCGGAAAACTGGGGAGTTGCAAG
  5   1   2       bld Neu2 5g                         IMAGE:2943174.5p                                  CAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCTCTTCTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCATGAGGAAACATGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCA
  5   1   2       bld Ga14 5g                            Ga14-p10e5.5p                                                      GCATTCTTCTCCAACCCTAACTCNCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGNACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTT
  5   1   2       bld Ga14 5g                            Ga14-p18e7.5p                                                           CTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCTTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGG
  5   1   2       bld Em10                            IMAGE:8321638.5p                                                                                                   TGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCAAAGCCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTGTTCTTCACATCTCCAGCCCCAGGACGAGTGCCAGATGATTGCCC
  5   1   2       chi Emb1                            IMAGE:6632992.5p                                                                                                                                                                                                                                                                          atatatatatatatatCGATTCTTGGTGTGGATACAGTGGAGTACTTTATGCTGCTGTCCTGTTGCCCCTGGCTGCCAGTCTAACTCTTCTCTTTGTTCTATCAGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACCCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGGTACTATGGGACAGATGTACTTTGCCAGGGTTCTGCCAGGCAATCAACCAGGCTTCCACCCAGCTTGGGGCAGGCCCTTCCCCANACCCCCCTGGAAGGCTTCA
  5   1   2       bld Ga14                                Ga14-p6d7.5p                                                                                                                                                                                                                                                                                        GCCTTCATTTTGTCCGGCAAGGGACGATGCGCAAGAGACTGGCACAANAGAACCCCGACCTGCACAACGCCGTAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGTCTCTGACTCTGGCAGAGNTGCGCCCCTTTGCGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACNACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCANAGGCGCAGGAGAGCGCAGTGCTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACTCCCACGGCCAGGTT
  5   1   2       e50                                Xl3.1-xlk2a11ex.5                      ACTGTACAACCAGCCAGTGACCTGGCAATCGCAAGCCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGAC------------------------CATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGATCTGCCCAATTCTAGGAGAAAGNCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGNAAGTCTTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGG------------GGGCGCAGATGGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACTCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTTCCTCTGGATTTGGCAGAAGCAGATCCCGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGNCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTACTTGCCAGGCTCTGCAGGNAT------------CAAGCTGGGCAGCCCTCCCCACCCCCTGAGGCTCAG------------------------AACCGGCTGACATGTTGGCAGANGNGGACAGGACTGAATTCGAGCAGNATCTGAGCTATGTGGCCAAGTCAG------------ATTNTCATGCGCAGGAATCGGTGG
                                                  Xl3.1-CHK-1012706572                            CAACCAGCCAGTGACCTGxxAxxxGCAAGCxxTxxTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGC------------NGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGAxxxxxCCAATTCxxGxxxAAAGNCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGNAAGTCTTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCN------------xxxxxGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACTCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGxxxxxxTCCTCTGGATTTGGCAGAAGCAGATCCCGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGNCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTACTTGCCAGGCTCTGCAGGNATCACCAG------------GGGCAGCCCTCCCCACCCCCTGAGGCTCAGCAGATG------------ACATCCAACCGGCTGACATGTTGG------------GGACTGAATTCGAGCAGNATCTGAGCTATGTGGCCAAGTCAGACCTGG------------ATGCGCAGGAAT
  5   1   2      skin Ga18      in                        xlk2a11ex.5p          TCGNCGNNAGNAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCNCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTGNNNNTNNNNGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGATCTGCCAATTCTAGGAGCAAAGNCGAGGCTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGNAAGTCGTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCANNGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGCGCAGGAGAGCNNAGTGNTGGNNNCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACTCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTNCTCTGGATTTGGCAGAANNAGATCCCGNGTNCTTCACATCTNCNGCCCAGGAC
  5   1   2      seed Ga18      in                       xlk65d17ex.5p               GGGTAGGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGTNNNNTNGNNGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGGATCTGCCAATTCTAGGAGCNNNNNNAGGNTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGNAAGTCTTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTNCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGNGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGNNGCAGGAGAGCNNAGTNNTGGNCNCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACTCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGNTACAGNTTNCCCACTCCTGAGAGCTCT
  5   1   2       bld Ga18      in                      xlk118m19ex.5p               TGGGTAGGAACTGTACAACCAGCCAGTGACCTGCAATCGCAAGCGCTTCTTCTCCAACCCCAACTCTCCTCATCATGAGCAGCCCTGATGGTGGTTACGCCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTGCCAATAATGATGACTGGACTCGGGCAGNNNNNTNNNNGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAGAGCGATGCGGATCTGCCAATTCTAGGAGCAANNNNAGGNTCGGATCCGCCGGCCTATGAATGCCTTCATGGTGTGGGCAAAGGACGAGCGCAAGAGACTGGCACAGCAGAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGNAAGTCTTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCNNNGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGANNNGCAGGAGANNNNNNTGNTGGGCNNAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACTCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGA
  5   1   2       bld Ga18      in                      xlk155k01ex.5p                                                                                                                                                                                                                                                                                                                                           GAACCCCGACCTTCACAACGCCGAGCTCAGCAAGATGCTTGGAAGTCTTGGAAGTCTCTGACTCTGGCAGAGAAGCGCCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAAAACGGCTTCATGCACATGGCAGAGGNGCAGGAGAGNNNNTGNTGGGCGCAGATGGAAGGATGTGTCTAGAGAACTTCAGCCTGGGTTATCATGAGCAGACTTACTCCCACGGCCAGGTTCCTCAGAGCAGCCACTACAGGGAACCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGNCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTACTTGCCAGGCTCTGCAGGNATCACCAGNNCCACCAAGCTGGGCAGCCCTCCCCACCCCCTGAGGCTCAGCAGATGGGCNNNNNNATCACATCCAACCGGCTGACATGTTGGCAGANGNGGACAGGACTGAATTCGAGCAGNATCTGAGCTATGTGGCCAAGTCAGACCTGGGNNTGCATTNTCATGCGCAGGAATCGGTGGNNCCTACTGCAGNNNNGGGCCANTTTCTNCTGNCNTTCNATGCCAGNNC
  5   1   2       e>2                              Xl3.1-xlk118m19ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCAAGCAGTGGGCTCCCCATTATGACGGTTACAG------------GAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTNTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTACTGCCAGGCTCTGCCAGGCATCACCAGGTCCACCAAGCTGGGCAGCCCTCCCCACCCCCTGAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTGTTTTATTTTATTTTGCACTTTTATAAATAAACATTCAAATA
                                                  Xl3.1-CHK-1012689670                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------------------------------------ACTCCTGAGAGCTCTCCTCTGGATTTGGCAGAAGCAGATCCCGTNTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGxxAxxxxxxxxxCCACAAACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGxxxxxxTGCCAGGCTCTGCCAGGCATCACCAGGTCCACCAAGCTGGGCAGNCCTCCCCACCCCCTGAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTGTTTTATTTTATTTTGCACTTTTATAAATAAACATTCAAATATAATCC
  3   1   2       bld Ga18      in                       xlk65d17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATGNAGGNCCNCCCCANTNNNNTACNNNNCCGCAGNNNGNACAGNTGNAGAGGATNANNNNGGCAGNAAACGGCTTCATGCACATGGNAGAGNNNNANNAGAGCGCAGTNNNGNNGCAGATGGAAGGATGTGTCTAGAGACTTCAGCCTGGGTTATCATGAGCAGNNNNCTCCCNCGGCCAGNTTCCTCAGAGCAGCCACTACAGGGANCCCCAAGCAGTGNCTCCCCATTATGACGNTTACAGTTNNNCCACTCCTGAGAGCTCTCCTCTGGATTTGGNAGAAGCAGATCCCGTNTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCANCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATNCCACAAACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTACTTNNCNNCTCTNCCAGGCATCACCAGGTCCACCAAGCTGGGCAGNCCTCCCCACCCCCTGAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCAATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACTGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTGTTTTATTTTAT
  3   1   2       bld Ga18      in                      xlk155k01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ANNGCAGTNNTGGCGNAGATGNAAGNATGTNTCTAGNGACTTCANCCTGGNNTATCATGANNAGACNTNCNNNNCGNCCAGGTTCCNTCAGAGNAGCCACTACAGGGANCCCCAAGCAGTGGCTCCCCATTATGACGGTTACAGTTTNCCCACTCCTGAGAGCTCNCTCTGGATTTGGCAGAAGCAGATCCCGTNTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGNCCTACAGCTACAATGGCANCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTACTTNNCANNTCTNCCAGGCATCACCAGGTCCACCAAGCTGGGCAGNCCTCCCCACCCCCTGAGGCTCAGCAGATGGNCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCAATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACTGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTnTTTTnTTTT
  3   1   2       bld Ga18      in                      xlk118o23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGNCGCAGATGGNANGATNTNNCTAGNNNACTTCAGCNTGNNNTNATCATGAGCANNCTTACTCCCNCGGNCAGNTNCCNNAGAGCAGCCACTACAGGNNNCCCAANNAGTGGCNCCCCATTATGACGGTTACAGTTTNNCCACTCCTGAGAGCTCTCCTCTGGATTTNNNAGAAGNAGATNCCGTGTTCTTCACATCTCCAGCCCAGNNCGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGGGTATGATGGCATGTCAGANCTCCCCACACATGTACTATGGACAGATGTACTNCCNNNTCTNCCAGGCATCACCAGGTCCACCAAGCTGGGCAGNCCTCCCCACCCCCTGAGGCTCAGCAGATGGNNAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCAATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACTGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTGTTT
  3   1   2       bld Ga18      in                      xlk118m19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGNAGATGNAAGGATNTNTCTANNGANTTCAGCNTNNNTTNTCATGANNAGACTTNCTCCCANGNCCAGGTTCCTCAGAGCAGCCNCTACNNGGAACCCCAAGNAGTGGCTCCCCATTATGACGNTTACAGTTTGCCCACTCCTGAGAGCTCTCCTCTGGATTNNNNAGAAGCAGATCCCGTNTTCTTCACNTCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTNCTTNNCNNNTCTNCCAGGCATCACCAGGTCCACCAAGCTGGGCAGNCCTCCCCACCCCCTGAGGCTCAGCAGATGGNCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCAATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACTGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTGTTTTATT
  3   1   2       bld Ga18      in                        xlk2a11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCAAGNAGTNNNNNCCCATTATGANGNNTNNAGNTTNNCNCTCCTGAGAGNNNNCTCTGGATTNGNNAGAAGNAGNNNCGTNNCTTCANNNCNCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGNAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGGGTATGATGGCATGTCAGANCTCCCCACACATGTACTATGGACAGATGTACTTNCNANNTNTNCCAGGCATCACCAGCTCCACCAAGCTGGGCAGNCCTCCCCACCCCCTGAGGCTCAGCAGATGGNNAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTNCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTGTTTTATTTT
  5  -1   2       bld Emb1                            IMAGE:6631411.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGATGAAATANNNNNNNCACANNNNCCTATNCTAAANGCATGGNAAGGNNNNCTGTNACTGGGnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnGGGNGNGAAGGGGAGGTTCTCCTTCTCCGACGTAGGGAATTTCAGGCCGGGGTAAGCAAGAGGGNNNNGAGGNGGGCGAAANGGGNNAATTTTTTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACAACATGTACTATGGACAGATGTCCTCCCTAGTCTCTGCCAGGCATCCCCAGGTCCACCAAGCTGGGCAGCCCTCCCCACCCCCCTGAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCAATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACTGTGTGATTATTGTGTACGTGGTACACTGCttttatttttgcgcttttaaataatttttatacattgttttattttattttgcacttttataaataaacattcaaatata
  3   1   2      seed Em10 5g3  in                    IMAGE:7980522.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTACTTGCCAGGCTCTGCCAGGCATCACCAGCTCCACCAAGCTGGGCAGCCCTCCCCACCCCCTGAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTGTTTTATTTTATTTGCACTTAAAAAAAACAT
  3   1   2       bld DMZ  5g3  in                         xl324o11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCCAGATGATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTACTTGCCAGGCTCTGCCAGGCATCACCAGGTCCACCAAGCTGGGCAGCCCTCCCCACCCCCTGAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACTGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTG
  5   1   2       bld Gas5                            IMAGE:3749490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGCCCTACAGCTACAATGGCAGCTACCCTCACCAGCAGAACTCCATGTTGGTAAGACAGATGCCACAAACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGGGTATGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTACTTGCCAGGCTCTGCCAGGCATCACCAGCTCCACCAAGCTGGGCAGCCCTCCCCACCCCCTGAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACT
  3   1   2       add Neu4 5g3  in                    IMAGE:3557165.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTCACCAGCAGNAATTCATGGTGGTAAGCAGATGCCCCAACTTGAGCAAATGGTCAAGTCAGTCCAGTTCAGGGTATAATGGCATGTCAGAGCCCCCCACACATGTACTATGGCAGAATGTACTTGCAGGCTCTGCCAGGCATCACCAGCTCCCCCAAGTTGGGCAGCCCTCCCACCCCCCTGAGGTTCAGCAGATGGCAAGAGCAGATCACATCCACCCGGCTGACATGTTGCCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTNTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGNACTTACTGATCAAAATGAGNTTTGATCTCGATTATTTNNTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGNNTACACTGCTTTNNTATTTTTGCGCTTNNTTAAATAATTTTNNTATACATTGTTTNNTATTTTATTTNNTGCACTTTTATAAATAANNACACTTCAAATATAATTCCAAA
  5  -1   2       bld Bla2      in                    IMAGE:7295630.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCATGCAGTACCTCACGCCGAATTCAGTTGTAGCAGATCCCCAAATAGCAATTGTCCAGTCAGTCATTCAGGGTATGAGCCATTCAGAGTCCCCACACATGACTATGACAGATGTACTGCCAGGTTTGCCAGGCATCACAGCTCCACCAAGCTGGGCAGCCCTCCCCANCCCCTGAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCttttatttttgcgcttttaaataatttttatacattgttttattttattttGCACTTTTATAAATAAACATTCAAATATAATCCaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCA
  3   1   2       bld Neu4 5g3  in                    IMAGE:3557094.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACAGATGCCTCGTACTGAGCAAATGGGTCAAGTCAGTCCAGTTCAGAGGATGATGGCAAGTCAAAGTCCCCCCACATGTCTTATGGTCAGATGTACTAGCCAGGCTCTGCCAGGCATCACCAGCTCCNCCAAGCTGGGCAGCCCTCCCCACCCCCTGAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTGTTTTATTTTATTTTGCACTTTTATAAATAAACATTCAAATATAATCCAAA
  5  -1   2       add EggS                            IMAGE:4785714.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCAAACTGAGCAAAAGGTCAAATCAGCCATTTCAGGGTATAATGGCAGTCAGAGTCTCCCCCCACATTTATATGGCCAGAGTTTTTTCCAGGTTTTCCAAGCATTccccagctcccccaagcgggccagccctcccccaccccctgAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTGCCAGAAGTGGACAGGCTGAAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACTGGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCACCTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTAACTTTACAGGTAACTGGCTCCAGACTTACTGATCAAAATAAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACTGTGTGATTATTGTGTACGTGGTACACTGCttttatttttgcgcttttaaataatttttataCATTGTTT
  3   1   2       bld Ga18      in                      xlk128g12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACGCGTCCGGGCATGTCAGANCTCCCCACACATGTACTATGGACAGATGTACTTNCCNNNTCTNCCAGGCATCACCAGCTCCACCAAGCTGGGCAGNCCTCCCCACCCCCTGAGGCTCAGCAGATGGNCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGnGCTTTTAAATAATTTTTATACATTnTTTTA
  5  -1   2       bld Emb1                   IMAGE:6631411-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGATGGCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTACTTGCCAGGCTCTGCCAGGCATCACCAGGTCCACCAAGCTGGGCAGCCCTCCCCAGCCCCTGAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAAGGGGCCAATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTGGCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTAGGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACTGTGTGATTATTGTGTACGTGGTACACTGCttttatttttgcgcttttaaataatttttatacattgttttattttattttgcacttttataaataaacattcaaatata
  5   1   2       bld Ga18      in                      xlk128g12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCATGTCAGAGCTCCCCACACATGTACTATGGACAGATGTACTTGCCAGGCTCNNNNNGATCACCAGCTCCACCAAGCTGGGCAGCCCTCCCCACCCCCTGAGGCTCAGCAGATGGGCAGNNNNATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGNCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAANGGTGTGATTATTGTGTACGTGGNANACTGCttttatttttgcgcttttaaataatttttatacattgttttattttattttgcacttttataaatnaacattcaaatataaaaaaaaaa
  3   1   2       bld Em10 5g3  in                    IMAGE:7981740.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACCAAAGTTGGGCAGCCCTCCCCCACCCGTGAGGCTCAGCAGATGGGCAGAGCAGATCACATCCAACCGGCTGACATGTTGGCAGAGGTGGACAGGACTGAATTCGAGCAGTATCTGAGCTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTTGTT
  3   1   2       bld Neu4                            IMAGE:3557684.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGCAGATGGGCAGACCAGATCACATCCAACGGGCTGACATTTTGCAAAAGATGGACAGGACTGAATCGAAGCAGTATCTAAACTATGTGGCCAAGTCAGACCTGGGTATGCATTATCATGCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAAAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTGTTTTATTTGGGTTTGCTCTTTTATAAATAACCATTAAGATATATCnCAAAAAAAAAAAAAGGATTATTGCCGCGCTCAAAGATTAGAGGTTCTTGATCCACCGCGGGNGAACTG
  3   1   2       bld Ga18      in                      xlk142l24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCNNNNNCCGCAGGAATCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGCGCTTTTAAATAATTTTTATACATTnTTTTATTTTATTT
  5   1   2       bld Ga18      in                      xlk142l24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCGGTGGTGCCTACTGCAGACAATGGGCCCATTTCTTCTGTCCTTTCCGATGCCAGTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGAGACTGACACCGTGCCCTATAGATTCTGCAGTATTCACACACACCCCAGTATTGAGAAGGACGGGCTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTgcttttatttttgcgcttttaaataatttttatacattgttttattttattttgcacttttataaataaacattcaaatataaaaaaaaaa
  5   1   2       bld Neu4                            IMAGE:3557239.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATGTAACTTATTTTACATACAACTGGCCAGTAAAGTAAGAAATGAAATATTGTCTACCAGGTAACTGGCTCCAGACTTACTGATCAAAATGAGTTTGATCTCGATTATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTgcttttatttttgcgcttttaaataatttttatacattgttttattttattttgcacttttataaataaacattcaaatataatccataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)