Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 06 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL474b13ex.5                         67 PI      93          6     1516                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012837559 Xl3.1-IMAGE:8550825.5.5 - 38 ESTs
                                                                       .....-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8550825.5.5                                                                                                ACTAAAGTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCAAAGATCTTCACTCTGGGGTATATGGAGGCTCTGTGCATGAGGCAATGACTGATCTCATTGCACTAATGGGGAGCTTAGTAGATAAAAATGGAAAGATCCTAATTCCTGGTATCAATGAGGCAGTTGCACCTGTGTTGAAGGAAGAGAAAGATATTTATGAAGCAATTGAGTTTGATCTAGAAGACTTTGCAAATGATATTGGAGCTGAGAAACTTCTACATGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGTTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAAGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATTTTATATGCTGGAGAATGCAATTAA
                                                  Xl3.1-CHK-1012722237                                                                                                      GTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCAAAGATCTTCACTCTGGGGTATATGGAGGCTCTGTGCATGAGGCAATGACTGATCTCATTGCACTAATGGGGAGCTTAGTAGATAGAAATGGAAAGATCCTAATTCCTGGTATCAATGAGGCAGTTGCACCTGTGTTGAAGGAAGAGAAAGATATTTATGAAGCAATTGAGTTTGATCTAGAAGACTTTGCAAATGATATTGGAGCTGAGAAACTTCTACATGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGTTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAAGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATTTTATATGCTGGAGAATGCAATTAAACAGAT
                                                      consensus depths                                                                                                     7    10    12    15    18    20    20    21    20    21    20    21    21    22    21    22    21    22    21    22    21    22    21    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    21    22    22    22    21    22    22    22    22    22    22    22    22    22    22    22    21    22    21    22    20    21    19    21    21    21    19    22    19    21    17    20    15    20    16    21    15    21    15    21    16    21    12    22    11    22    11    21     9    22    10    21    11    21     8    18     6    19     7    18     6    16     6    17     4    16     5    15     5    14     6    13     6    12     7    13     9    15    10    15     9    14    12    13    12    14    13    14    11    12    11    13    13    14    11    13    13    14    13    14    13    13    14    14    14    15    14    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    15    16    16    16    16    15    15    16    16    16    16    15    15    15    15    16    16    13    14    14    15    14    16    14    16    13    15    14    16    13    15    13    15    13    15    14    16    13    15    13    15    13    15    13    15    13    16    13    14    14    15    14    15    12    15    10    13     7    10     4     7
  5   1   2      ests                            Xl3.1-IMAGE:8550825.5                                                                                                ACTAAAGTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCAAAGATCTTCACTCTGGGGTATATGGAGGCTCTGTGCATGAGGCAATGACTGATCTCATTGCACTAATGGGGAGCTTAGTAGATAGAAATGGAAAGATCCTAATTCCTGGTATCAATGAGGCAGTTGCAC
  5   1   2      ests                              Xl3.1-xlk140c16ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGCATGAGGCAATGACTGATCTCATTGCACTAATG------------GATAAAAATGGAAAGATCCTAATTTCCTGGTATCAATGAGGCAGTTGCACTGTGTTGAAGGAAGAGAAAGATATTTATGAAGCAATTGAGTTTGATCTAGAAGACTTTGCAAATGATATTGGAGCTGAGAAACTTCTACATGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGTTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAAGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATTTTATATGCTGGAGAATGCAATTA
                                                                   SNP                                                                                                                                                                        ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------A
                                               BLH ATG      26    1843                                                                                                
                                               BLH MIN      26     344                                                                                                
                                               BLH MPR       8     344                                                                                                
                                               BLH OVR      26      61                                                                                                
                                               EST CLI       0      57                                                                                                
                                               ORF LNG      26       7                                                                                                
  5   1   2      ests                            Xl3.1-IMAGE:8550825.5                                                                                                ACTAAAGTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCAAAGATCTTCACTCTGGGGTATATGGAGGCTCTGTGCATGAGGCAATGACTGATCTCATTGCACTAATGGGGAGCTTAGTAGATAGAAATGGAAAGATCCTAATTCCTGGTATCAATGAGGCAGTTGCAC
                                                  Xl3.1-CHK-1012688706                                                                                                      GTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCAAAGATCTTCACTCTGGGGTATATGGAGGCTCTGTGCATGAGGCAATGACTGATCTCATTGCACTAATGGGGAGCTTAGTAGATAGAAATGGAAAGATCCTAATTCCTGGTATCAATGAGGCAG
  3  -1   2       bld Te2N      in                    IMAGE:7765365.3p TACCATACCCTATGGGACACTCCTCGAGGTTATTAAGCGTTATGGTGATGCTAAAAGGAAGCCGATGTGTCAGCGCTGAGAGCGCATTTTCAGTCACTAAAGTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACACTACTGGCTAGGCAAAATAGCCCTGTATCACTATGGTCTCGTGGCTCTGCTACTTTTTATGAGTGGATGCACTCCAGATCTCATCTGGGGAATGGAGTCTGGCTGAGCATGACTGATTCTGCATATGGGACTATAAATGATGGAGACTATCTGTTCAGAGCATGCCGGTGAGAGAAGATTA
  5   1   2       bld Sp1  5g3  in                    IMAGE:4965475.5p                                                gtcgacccacgcgtccgcggacgcgtgggcggacgcgtgggTTCAGTCACTAAAGTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTGTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTACTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTA
  5   1   2       bld Int2 5g3  in                    IMAGE:8820648.5p                                                   TTAGATTATATTATGGATGCTAATCATTTATAAATTCGTCCCGTCACTAAAGTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGTGAATGCAGCTCCAAAGATCTTCACTCTGGGGTATATGGAGCTCTGTGCATGAGCAATGACTGATCTCATTGCACTATGGAGCTAGTAGATAGAATGAAAGATCTTATCTGTATCATGAGCAGTGGCACTGTTGTTGAGGAGAGAAAGAATTATGAGCATGGAGTTGATCTAGAGACTTTGCCAATGAATTTGGACGTAATCTCCATGATCAGACGATCGTGATGCCACTGTGTGTGCCGT
  5   1   2       bld Emb9 5g3  in                    IMAGE:7976757.5p                                                                       GGTCCGGATTCCCGGGATTTCAGTCACTAAAGTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTACTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTTCGTGGCATCTGCTACTTTTTTATTGAGTGGATGCAGCTCCAAAGATCTTCACTCTGG
  5   1   2       bld Thy  5g3  in                    IMAGE:8550825.5p                                                                              AACAGCTTTTAAGGCAGTCCTCGATTCGAATTCGTCCCAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCAAAGATCTTCACTCTGGGGTATATGGAGGCTCTGTGCATGAGGCAATGACTGATCTCATTGCACTAATGGGGAGCTTAGTAGATAGAAATGGAAAGATCCTAATTCCTGGTATCAATGAGCAGTTGCACCTGTGTGAGAGAGAAGATATTTATGAGCATTGAGTTTGATCTAGAGACTTTGCAATGATATGAGCTGAGAACTCTACATGATCAAGAAAGATCTGATGCAAGGTGGCGTTCATCTGTTCTCTGCATGCATTGAGGACTTCTGCACTGTCAAACTGTTATCGAAGATATAGAATTCTCTAAGGCTGGTGTCTGTATGACCAAATGCAAACAGTTG
  5   1   2       bld Tail 5g                         IMAGE:8546293.5p                                                                                      GNGGAGCACCAATTGAATTCGTCCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTGTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGAATGCAGCTCCAAGATCTCACTCTGGGTATATGGAGCTCTGTGCATGAGCATGACTGATCTCTTGCCTATGGGAGCTATAGATAGATGGAAGATCTATCTGTTCATGAGCATGCCTGTGTGAGAAAAAATATGACATGATTATCGNAATGCATGATGACTAACTCATATCAGAGT
  5   1   2       bld EmbC 5g                              BU993920.5p                                                                                       GTTTCAGTCACTAAAGTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCAAAGATCTTCACTCTGGGGTATATGGAGGCTCTGTGCATGAGGCAATGACTGATCTCATTGCACTAATGGGGAGCTTAGTAGATAGAAATGGAAAGATCCTAATTCCTGGTATCAATGAGGCAGTTGCACCTGT
  5   1   2       bld Eye1 5g3  in                    IMAGE:4743549.5p                                                                                                ACTAAAGTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTT
  5   1   2       bld Ga18 5g3  in                      xlk140c16ex.5p                                                                                                ACTAAAGTGAGGNCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTACTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGNNAAAAATAAGCCCTGTATCACTTATGGNCTCCGTGGCATCTNCTACTTTTTTATTGAGGTGGAATNNAGCTCCAAAGATCTTCACTCTNGGGNNTATGGNGGCTCTGTNCATGAGGCAATGACTGATCTCATTGCACTAATGGGGANNTTAGNAGNNA
  5   1   2       bld DMZ  5g3  in                         xl232b19.5p                                                                                                CTAAAGTGAGGTCCCATCGAGCAACATGCTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCANCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATANAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACNACTACTGGCTAGGCNAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCNAAGATCTTCACTCTGGGGTATATGGAGGCTCTGTGCATGAGGCAATGACTGATCTCATTGCAC
  5   1   2       bld Tail 5g3  in                    IMAGE:8541754.5p                                                                                                 CTAAAGTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTGTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTACTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCNAAGATCTTCACT
  5   1   2      seed DMZ  5g3  in                         xl319g21.5p                                                                                                 CTAAAGTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCNAAGATCTTCACTCTGGGGTATATGGAGGCTCTGTGCATGAGGCAATGACTGA
  5   1   2       bld DMZ  5g3  in                         xl255c10.5p                                                                                                 CTAAAGTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCNAAGATCTTCACTCTGGGGTATATGGGAGGCTCTGTGCATGAGGCAATGACTGATCTC
  5   1   2       bld Ov1  5g                         IMAGE:6316358.5p                                                                                                    AAGTGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTACTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCAAAGATCTTCACTCTGGGGTATATGGAGGCTCTGTGCATGAGGCAATGACTGATCTCTTTGCCCTAATGGGGAGCTTACTAAATAAAAATGGAAAGATCCTAATTCCTGGTATCAATGGAGCAGTTTGCCCCTGGGTTTAAAGAAAGAAAAAGATAA
  5   1   2       bld Ga18 5g3  in                       xlk80o14ex.5p                                                                                                       TGAGGTCCCATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTACTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTNTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGNCTCCGTGGCATCTNNTACTTTTTTATTGAGGTGGAATGCAGCTCCAAAGATCTNCACTCTGGGGNATATGGAGGCTCTNTGCATGAGG
  5   1   2       bld FaBN 5g                         IMAGE:8077871.5p                                                                                                               CATCAAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTGTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTACTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCAAAGATCTTCACTCTGGGGTATATGGAGGCTCTGTGCATGAGGCAATGACTGATCTCATTGCACTAATGGGGAGCTTAGTAGATAGAAATGGAAGA
  5   1   2       bld Spl  5g                         IMAGE:8460281.5p                                                                                                               CATCGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTGTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCNAAGATCTTCACTCTGGGGTATATGGAGGCTCTGTGCATGAGGCAATGACTGATCTCATTGCACNTATGGGGAGCTAGTAGATAGAAATGGAAAGATCTATTNNNCTGTATCATGAGCAGTGCACTGTGTTGAAGAGAGAAGAATT
  5   1   2       bld Sp1  5g                         IMAGE:4963691.5p                                                                                                                  CGAGCAACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTGTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGTGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGT
  5   1   2       bld FaB  5g                         IMAGE:8072366.5p                                                                                                                       CACATGTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTGTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTACTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATGAGGTGGATGCAGCTCCAAGATCTCACTCTGGGTATATGAGGCTCGTGCATANGCATGACTGATCTCTTGCACTATGGGGAGCTATAATAGAATGAAAATC
  5   1   2       bld Ga12 5g3  in                         XL168g12.5p                                                                                                                        GCACATGTCTGTTCTGCCGCCCTGTTTGAGCACATCGATAAGAACCGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTACTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAA
  5   1   2       bld Spl       in                    IMAGE:8463713.5p                                                                                                                            GTCTGTTCTGCCAGCCCTGTTTGAGCACATCGATAAGAACCAGGATCTGTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCCGAGTGTTTCAGCATGGCCAGAGAAAAGAGGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGACAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGCAAATTAAGCAGGAAATTCCTGTTAATCTCATGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACCTTTTTCAAGGGTGTGGACTACGTTTGCATTTCAGACAACTACTGGCTAGGCAAAAATAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCCAAGATCTTCACTCTGGGGTATATGGAGGCTCTGTGCATGANGCAATGACTGATCTCATG
  5   1   2       chi Thy                             IMAGE:8546927.5p                                                                                                                                                                  TTACTACATGTTTTGTGGTCCATCCATCGAATGCGTCCCAATCCCGAGTGTTTCAGCATGGCCAGAGAACCTATTGGGAAATCAAAAGGATGATGGAGGTAGCTGCGAAGGAGGTTGAGCGTCTTGGTGGTAAAACTGAACTGGTAGACATTGGCAAGCAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAAACCGTATGTGTTTATGGCCATCTGGATGTCCAGCCAGCAGCTCTGGAAGATGGGTGGGACAGCGAGCCCTTTGTTTTGGACGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACACATGACTAAGGCCCTGTGCTTGAATGGATAAACAGCATATAAACTTATCATCAAATTAAGCAGGAAATTCCTGTTAATCTCATGATCTGCTTTTAAAGTATGGAAGATTCTGGATCAGAAAGCTTTGATGAGCTTATTCTTGCTCTGTAGTGATTCTTTTTCTAGGGTGTTGACTTCTTCTCTTATCCTACTATTACTGATAGTTAATAATTAGCTCTGTTTCttttattatctcttagtttcttctatttttttccaaattttaatacttattatacttctttaTGTATGATATTGGATGAATTTTTAGGAGTATTTATGTTGTCTCTTATGTCTGTAACTTACTTATATTAATGCTATTATCTAATTTTTAATCCTGTTTGATTCTGTATCAATAATGATTTCTTATTGAGCTattgataatattttatatattttatattcatacatatttttctattcttttgttgattattatacttctttttttttGTTATA
  3   1   2       bld DMZ  5g3  in                         xl319g21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGCAATGACTGATCTCATTGCACTAATGGGGAGCTTAGTAGATAAAAATGGAAAGATCCTAATTCCTGGTATCAATGAGGCAGTTGCACCTGTGTTGAAGGAAGAGAAAGATATTTATGAAGCAATTGAGTTTGATCTAGAAGACTTTGCAAATGATATTGGAGCTGAGAAACTTCTACACGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGTTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAGGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACAACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCCGATGAATCGACACATT
  3   1   0       add Ga18 5g3  in                       xlk80o14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GNAATGNCTGNNCTCATNNCTATGGGAGCTTAGTAGATAAAAATGGAAAGNNCCTANNCCTGGTATCAATGAGGNANTTGNNCCTGTGTTGAAGGAAGANNAGANNTTTATGAAGCAATTGANTTTGATCTAGAAGNCTTTGCAAATGATATTGGAGCTGAGAAACTTCTACACGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGTTTCCNTCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCNNAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAGGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTNNNNCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAANCCCANCCCCACAGTTAACAGAANTCCAATACCGATGAATCGNCACNNTTNATAT
  3   1   0       add DMZ  5g3  in                         xl232b19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGAAAAGATCNTGATGCACAGGTGGCGGTTTCCATNCCTGTCTCTNCATGGCATTGAGGGAGCCTTCTCNGCAGCTGGTGCAAAANCTGTCATCCCCAGAAAAGTNATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAGGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTNTCNGACTTCAATCACCCTCATTATGTTGCTGGCAGNAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTNACACGNGAAGGCGGGAGCATTCCTGTAACANTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCNGTNGGCTCTGCAGATGATGGAGCNCACTCTCAAAACGAANAGCTGAACAGGTTTANTTATATTCAGGGAGTAAAGCTTNTAGGTGCTTANTTGTATGAAGTNTCCANCCTGGANTAAATCTGATAAAACAACATCCAACNAACCCAACCCCACAGTTAACAGAAATCCAATNCTCGATGAATCGACACAT
  5   1   2      ests                              Xl3.1-xlk140c16ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGCATGAGGCAATGACTGATCTCATTGCACTAATG------------GATAAAAATGGAAAGATCCTAATTTCCTGGTATCAATGAGGCAGTTGCACTGTGTTGAAGGAAGAGAAAGATATTTATGAAGCAATTGAGTTTGATCTAGAAGACTTTGCAAATGATATTGGAGCTGAGAAACTTCTACATGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGTTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAAGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATTTTATATGCTGGAGAATGCAATTA
                                                  Xl3.1-CHK-1012693411                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGCAATGACTGATCTCATTGCACTAATGGGGAGCTTAGTAGATAAAAATGGAAAGATCCTAATTxCxxGxTATCAATGAGGCAGTTGCACTGTGTTGAAGGAAGAGAAAGATATTTATGAAGCAATTGAGTTTGATCTAGAAGACTTTGCAAATGATATTGGAGCTGAGAAACTTCTACATGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGTTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAAGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATTTTATATGCTGGAGAATGCAATTAAACAGA
  3   1   2       chi Ga18 5g3  in                      xlk140c16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ANTCTGGNTCAGNAGGCTNAGATGNCCTNANNNTTNNNNGGAAGGNNNCCTTTTCAAGGGTGNNGNCTACGNTTGCATTTCAGACNACTACTGNCTAGGNAAAAANAAGCCCTGTNTCNCTTANGNTCNCCGTGNNNTCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCAAAGATCTTCACTCTGGGGTATATGGAGNCTCTGTGCATGAGGCAATGACTGATCTCATTGCACTAATGGGGAGCTTAGTAGATAAAAATGGAAAGATCCTAATTCCTGGTATCAATGAGGCAGTTGCACCTGTGTTGAAGGAAGAGAAAGATATTTATGAAGCAATTGAGTTTGATCTAGAAGACTTTGCAAATGATATTGGAGCTGAGAAACTTCTACACGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGNTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGATGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAGGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTNNNNNNCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTNNNNCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATTTTATATGCTNGAGAATGNAAT
  3   1   2       bld Int2 5g3  in                    IMAGE:8820648.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCGCAACGGGTGGGACTACGTTGCATTCCAGACACCTACTGCTAGCAAAATAAGGCTGTATCACTTATGTCTCCGTGCATCTGCTACTTTTTTATTGAGGTGGAATGCAGCTCCAAAGATCTCACTCTGGGGTATATGGAGGCTCTGTGCATGAGGCAATGACTGATCTCATTGCACTAATGGGAGCTTAGTAGATAGAAATGGAAAGATCTAATTCCTGGTATCAATGAGGCAGTTGCACTGTGTTGAAGGAAGAGAAAGATATTTATGAAGCAATTGAGTTTGATCTAGAAGACTTTGCAAATGATATTGGAGCTGAGAAACTTCTACATGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGTTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAAGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCACGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATTTTATATGCTGGAGAATGTCAAATATCACGG
  3   1   2       bld Tail 5g3  in                    IMAGE:8541754.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCATAGTTAGGCCTCGTATTCAATTATGTCTCGTGGCATCGCTACTTTTTATGAGTGAAATGCAGCTTCAAGATCTCACTCTGGGTATATGAGCTCTGTGCATGAGGCAATGACTGATCTCATTGCACTAATGGGGGAGCTTAGTAGATAGAAATGGAAAGATCCTAATTCCTGGTATCAATGAGGCAGTTGCACTGTGTTGAAGGAAGAGAAAGATATTTATGAAGCAATTGAGTTTGATCTAGAAGACTTTGCAAATGATATTGGAGCTGAGAAACTTCTACATGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGTTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAAGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCACGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACTATTTTATATGCTGGAGAATGCAATTAAAACAGGATTTG
  3   1   2       bld Emb9 5g3  in                    IMAGE:7976757.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTTCGAGACTTAGGGAAGTCTACAATTGTGAAAACCGTCCTTGTCGGGCTGTATTTATGGGAGCGTCAAATCCCTTGGATAGAGCTGGCTGAGCATACGATTCATCATAGGGGGCTAGTAGTAAAATGAAAATCTATTCTGTTTCATGAGCAGTGCACCGTGTGAAGAAGAGAAGATATTATGAGCAATGAGTTTATCTAGAAGACTGCAAATGATATGGAGCTGAGAAATTCTACAGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGTTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAAGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCACGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACTC
  3   1   2       bld Thy  5g3  in                    IMAGE:8550825.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAGTTCGGCTCGTATTTATGAGTGAGCAGTCAAAGTCTCCTTGGGTTATGAGCTCGGCAGAGCATGATGATTCATGCATATGGGAGCTAGTGATGAAATGAAGATCTATTTCCTGTATCATGAGGCAGTGCACCGTGTGAAGGAAGAGAAAGATATTATGAAGCAATGAGTTTGATCTAGAAGACTTTGCAAATGATATTGGAGCTGAGAAACTTCTACATGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGTTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAAGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCACGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAACGACCCT
  3   1   2       bld Spl       in                    IMAGE:8463713.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCATAGTCGGCATGTACTTTAGAGTGAGAGTCAGATTCATTGGTATAGAGCTCGGCTGAGCATGATATTCATGCATATGGAGCTAGTGATGAATGAAGATCCTATCTGGTATCATGAGCAGTGCACTGTGTGAGGAAGAGAAGATATTATGAGCAATTGAGTTGATCTAGAAGACTTGCAAATGATATGGAGCTGAGAAACTTCTACATGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGTTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAAGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATTTATAGCGGAGAATCATAACATTA
  5  -1   2       bld Te2N      in                    IMAGE:7765365.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTCCCTTACTTAAGGAAGATTTaaaaaaaaaaGAAGTTCCATTTCCGGTACAAGGGCCATTCCCCTTGTTTAAGAAAAGAAAAGATTTTTGAAACAATAGTTTGAATTTGAAAACCTTGCAATAGTATTGGAAGTGGAAAATTTTACCAGGATCAAAGGAAAAGATCTTGATCCCCGGGTGGCGGTTTCCTTCCCTGTTTATCCAGGCCATGAGGGGACCTTTCTTTGCAGTGGGTCCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTCCCTGATATGAACCCAGAAGATGTGCAAAACCAGGTGGAAGACTACTTGACAAAGAAGTTTAAAGAGCTAGGAAGTCCAACCAAGTTCCAAGTACCAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTACCACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATTTTATATGCTGGAGAATGCAATTA
  3   1   2      seed DMZ  5g3  in                         xl255c10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTAGTAGATAAAAATGGAAAGATCCTAATTCCTGGTATCAATGAGGCAGTTGCACCTGTGTTGAAGGAAGAGAAAGATATTTATGAAGCAATTGAGTTTGATCTAGAAGACTTTGCAAATGATATTGGAGCTGAGAAACTTCTACACGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGTTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAGGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACAACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATT
  3   1   2       bld Ga12 5g3  in                         XL168g12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTTTGATCTAGAAGACTTTGCAAATGATATTGGAGCTGAGAAACTTTTACACGAATCAAAGGAAAAGATCNTGATGCACAGGTGGCGGTTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAGGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATTTTATATGCTGGAGAATGCAATTAAACAGATC
  5   1   2       bld Skin                            IMAGE:8642273.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGACTTTGCAAATGATATTGGAGCTGAGAAACTTCTACATGAATCAAAGGAAAAGATCCTGATGCACAGGTGGCGGTTTCCATCCCTGTCTCTGCATGGCATTGAGGGAGCCTTCTCTGCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAAGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATTTTATATGCTGGAGAAATGCATTAACAGATCTGAATGACATGTTaaaaaaaaaaaaaaaaaaaaaaaNGGCGGCGCAGGCTGAATTCTAGACGCGCTCGAGCTCCGCCTAATGATCTATAGTAATCAACTGAAGATCATGATAGTTGACACCACTAATGATGAAATGCTATGGAATGTAGCATGTATT
  3   1   2       bld Sp1  5g3  in                    IMAGE:4965475.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAGCTGGTGCAAAAACTGTCATCCCCAGAAAAGTAATAGGAAAATTCTCCATAAGGCTGGTGCCTGATATGAACCCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAGGAGCTAGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATTTTATATGCTGGAGAATGCAATTAAACAGATATGAATGACAATGTT
  3   1   2       bld Ov1                             IMAGE:4054998.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGCTGGTGCCTGTATGAACCCAAGAAAATGTGCAAAACCGGGTGGAAGACTACTTGACAAAGAAGTTTAAAGAGCTAGGAAGTCCAAACAAGTTCCAAGTACCAATGGGCCACGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAACGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATTTTATATGCTGGAGAATGCAATTAAACAGATCTGAATGAC
  3   1   2       bld Eye1 5g3  in                    IMAGE:4743549.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGAAGATGTGCAAAAACAGGTGGAAGACTACTTGACAAAGAAGTTTAAGGAGCTAGNAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCAGACTTCAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACGGTTTTTAATGTTGAACCTGATCTAACACGAGAAGGCGGGAGCATTCCTGTAACACTCACCTTCCAGGAGGCAACCGGCAAGAATGTTATGCTTCTACCTGTAGGCTCTGCAGATGATGGAGCCCACTCTCAAAACGAAAAGCTGAACAGGTTTAATTATATTCAGGGAGTAAAGCTTCTAGGTGCTTACTTGTATGAAGTATCCAACCTGGAGTAAATCTGATAAAANGACATCCAACAAACCCAACCCCACAGTTAACAGAAATCCAATACCGATGAATCGACACATTTTATATGCTGGAGAATGCAATTAAACAGATTTGAATGACAATGTTAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)