Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl310d22.5                            3 END     1           1       33                PREDICTED: splicing factor 3b, subunit 3, 130kDa [Gallus gallus]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL520j03ex.5.5                      486 PI      81        117     1442                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6957350.3.5                   295 PI      80        111     1442                (no blast hit)
     4   0.0    0Xl3.1-XL516i20ex.5.5                      262 PI      82        113     1409                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:6951471.3.5                    73 PI      81        114     1445                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:4724989.5                      18 PI      78        130     1291                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:6878723.3.5                    15 PI      77        124     1438                (no blast hit)
     8   0.0    0Xl3.1-IMAGE:6879508.5                       7 PI      77        139     1406                (no blast hit)
     9   0.0    0Xl3.1-IMAGE:8551212.5                       4 PI      78        402      791                (no blast hit)
    10   0.0    0Xl3.1-IMAGE:4743351.5                       3 PI      80        609     1337                tubulin, beta 2C [Gallus gallus]

 This cluster: approximate FL confidence score = 98%

 1012837575 Xl3.1-xl280d23.5.5 - 76 ESTs
                                                                       .....-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xl280d23.5.5                          ACGCGCATCTGCTCAGATTCCTAGCATCGGGGTGTTGCACAAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATCTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTTCCCCCACACTGGATAAGATCATAAAAGTATTTGATATTTGTGCTCTCTCTTTGTATTTTCTAATGTACCTTTCTAACATGAAATCATAGTCATTTTCTCTATGTGCTGCACAGAATAGAGGAATCACATTTGAATTACATTTTATTTTTTGCCATAAAACACGTT
                                                  Xl3.1-CHK-1012722241                                ATCTGCTCAGATxxxxAxCATCGGGGTGTTGCACAAxGxGxxxxxxAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATCTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACxxxxTxGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTTCCCCCACACTGGATAAGATCATAAAAGTATTTGxxxTxxxTxxxxTCTCTTTGTATTTTCTAATGTACCTTTCTAACATGAAATCATAGTCATTTTCTCTATGTGCTGCACAGAATAGAGGAATCACATTTGAATTACATTTTATTTTTTGCCATAAAACACGTTTTAATT
                                                      consensus depths                               5    10     5    15    10    20    11    24    14    26    14    27    14    27    14    27    14    27    27    27    27    27    26    27    27    28    28    28    28    28    29    29    29    29    29    29    29    29    29    29    29    29    29    29    30    30    30    30    30    30    30    30    31    31    32    32    32    32    33    33    33    33    34    34    34    34    33    34    34    34    34    34    32    34    34    34    33    34    33    35    35    38    36    38    35    38    35    39    34    39    34    39    33    39    32    38    33    38    33    38    34    38    33    38    34    39    34    39    33    39    30    39    31    39    29    37    24    34    21    33    17    30    19    31    18    30    16    28    14    29    14    29    14    29    12    31    11    31    12    31    10    29    12    31    12    30    13    29    11    27     9    25    11    25    13    25    11    26    16    27    17    27    18    26    18    26    15    26    19    27    19    26    19    26    18    25    20    27    23    29    23    28    25    30    24    28    22    28    26    28    26    28    25    29    23    28    26    28    24    28    27    28    26    28    24    29    27    29    29    30    27    30    30    30    27    30    28    30    28    30    29    30    29    30    31    32    31    31    31    32    32    32    32    32    33    34    32    34    33    34    18    34    17    34    18    34    18    35    17    35    17    35    16    34    16    34    16    33    16    33    16    33    16    33    16    33    16    33    16    33    16    33    16    33    16    33    16    33    15    32    15    31    10    21     8    15     7    14     3     9     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3
  5   1   2       e>3                                 Xl3.1-xl280d23.5                          ACGCGCATCTGCTCAGATTCCTAGCATCGGGGTGTTGCACAAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATCTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAACAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCAGCGTGCGATCCCCGTCATGGACGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAGAGCAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTTTGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCTATTCAAGAGCTTTTCAAAAGAATCTCTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCCGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTTCCCCCACACTGGATAAGATCATAAAAGTATTTGTGCTCATTCTCGTCTCTTTGTATTTTCTAATGTACCTTTCTAACATGAAATCATAGTCATTTTCTCTATGTGCTGCACAGAATAGAGGAATCACATTTGAATTACATTTTATTTTTTGCCATAAAACACGTT
  5   1   2       e>3                               Xl3.1-XL501f17ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACGATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATTTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCTTTTAGATGTTTCTCCCCATTGGATAAGATCATAAAAATATTTGTGCT
                                                                   VAR                                      CCGGCTGGAAAC
                                                                   VAR                                                  CCGGCCGGACACCATCAGGGTGTTGTACAAAGGGGAAGTAAAGCAACAAGACTGATTATACCGCTGTAACACTAATATCCACCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCTTTTAGATGTTTCTCCCCATTGGATAAGATCATAAAA
                                                                   SNP                                                                                                                                      -------C----
                                                                   SNP                                                                                                                                                              --------G---
                                                                   SNP                                                                                                                                                                          -----------A
                                                                   SNP                                                                                                                                                                                                                                      -----------A
                                                                   SNP                                                                                                                                                                                                                                                  --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                      -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                  --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                          ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                      -----TG-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                              --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                      --A-----T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                  --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --C-----A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --C-----T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --C--T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --G--------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------G-G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --C--A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------C--C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------AT
                                               BLH ATG     117    3615                          
                                               BLH MIN     117     382                          
                                               BLH MPR     117     382                          
                                               BLH OVR     117      46                          
                                               CDS MIN     117     382                          
                                               EST CLI      -6      19                          
                                               ORF LNG     117       4                          
  5   1   2       e>3                                 Xl3.1-xl280d23.5                          ACGCGCATCTGCTCAGATTCCTAGCATCGGGGTGTTGCACAAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATCTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAACAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCAGCGTGCGATCCCCGTCATGGACGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAGAGCAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTTTGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCTATTCAAGAGCTTTTCAAAAGAATCTCTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCCGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTTCCCCCACACTGGATAAGATCATAAAAGTATTTGTGCTCATTCTCGTCTCTTTGTATTTTCTAATGTACCTTTCTAACATGAAATCATAGTCATTTTCTCTATGTGCTGCACAGAATAGAGGAATCACATTTGAATTACATTTTATTTTTTGCCATAAAACACGTT
                                                  Xl3.1-CHK-1012686470                                ATCTGCTCAGATxxxxAxCATCGGGGTGTTGCACAAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATCTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCAGCGTGCGATCCCCGTCATGGACGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAGAGCAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTTTGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCTATTCAAGAGCTTTTCAAAAGAATCTCTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCCGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTTCCCCCACACTGGATAAGATCATAAAAGTATTTGTGCTCATTCTCGTCTCTTTGTATTTTCTAATGTACCTTTCTAACATGAAATCATAGTCATTTTCTCTATGTGCTGCACAGAATAGAGGAATCACATTTGAATTACATTTTATTTTTTGCCATAAAACACGTTTTAATT
  5   1   2       bld Emb4 5g                IMAGE:4203567-IMAGp.IMAGp CAGCAAGTGTATAAAAGGCAACAGAACGCGCATCTGCTCAGATTCCTAGCCGGCCGGACACCATCAGGGTGTTGTACAAAGGGGAAGTAAAGCAACAAGACTGATTATACCGCTGTAACACTAATATCCACCAATCGGAACCATGCGTGAAATCGTGCACCTCCAGGCTGGCCAGTGCGGAAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACAGGGAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATCAACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAAGCGGGGGTAACAACCTGCCTTCGTTTCCCAGGGCAGCTGAATGCTGATTTACGCAAACTGGCTGTCAACATGG
  5   1   2       bld Emb4 5g                         IMAGE:5515764.5p  CCCACGCGTCCGAAAGGCTACAGAACGCGCATCTGCTCAGATTCCTAGCCGGCCGGACACCATCAGGGTGTTGTACAAAGGGGAAGTAAAGCAACAAGACTGATTATACCGCTGTAACACTAATATCCACCAATCGGAACCATGCGTGAAATCGTGCACCTCCAGGCTGGCCAGTGCGGAAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACAGGGAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATCAACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAAATGCACACTCTCGGTTCATCAGTTGGTGGAAATACAGATGAAACTACTGCATAGACATGANGCCTCTATGATATCTGCTCGCA
  5   1   2       bld Em10 5g3  in                    IMAGE:7981601.5p        GAAGGAGCCTCTGACAGCCCAGATTCTTAGCCGGCTGGAAACCATCGGGGTGTTGCACAAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAAGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGAAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCAGACCGAATCATGAATACATTCAGTGTGATGCCATCACCCAAAGTCTCAGACACTGTGGTTGAACCATATAATGCAACCCTCTCTGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTG
  5   1   2       bld Emb4 5g                         IMAGE:5571885.5p                    GGACGCGTGGGTTCTTAGCCGGCTGGAAACCATCGGGGTGTTGCACAAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAAGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGAAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCNCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCAGACCGAATCATGAATACATTCAGTGTGATGCCATCACCCAAAGTCTCAGACACTGGTGGTTGAACCATATAATGCAACCCTCTCTGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTTAAGTTAACAACACCCACATATGGGGGATCTGAAATCACCTTGTATCCCGCTACCATGAAGCGGGGTAACAACCCTGCCTTCCGTTTCCCCAGGGGCACCCTTAAAGGGTTGATCTTACCCAAACTGGGCTGGTCAAAAATGGGGGGCCCTTTTCCC
  5   1   2       bld Eye1 5g                         IMAGE:6946122.5p                     CTGGTACCGGTCCGGATTCTCCGGAAAACCATCGGGGTGTTGCACATTGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAAGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGAAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCAGACCGAATCATGAATACATTCAGTGTGATGCCATCACCCAAAGTCTCAGACACTGTGGGTTGAACCATATAAATGCAACCCTCCTCTGTTCATCAATTTGGTGGGAAAATACAGAATGAAACCCTACTGGCATAGAACAATGAAGGCCCTCTTATGAATATCTGGCTTCCCGCCCCTTTTAAAGTTTAACAAACTCTCAACCATATGGGGGGAATCGGAAATCACCCTTTGTTATCCCGCCAACAAATGGAGCGGGGGTTAAACAACCCCGGCCCTTTCGTTTTTCCCCCAGGGGCAAGGTTTAAAGGCCTGAAATCTACCGCCAAAACCGGGGCGGGTCAAAAACTAGGGGGCCCCTTTCTCCCCCCAATTTGCCAAC
  5   1   2       bld Eye1 5g                         IMAGE:6949008.5p                      CCGGAATTCCCGGGATGCCGGCTGGAACCATCGGGGTGTTGCACAAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAAGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGAAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCAGACCGAATCATGAATACATTCAGTGTGATGCCATCACCCAAAGTCTCAGACACTGTGGTTGAACCATATAATGCAACCCTCTCTGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACAACACCAACATATGGTGATCTGAATCACCTTGTATCCGCTACAATGAGCGGGGGTACAACCTGGCTTCGTTTTCCAAGGCAGCTTAATGCTGATCTACNCAAACTGGCTGTCAACATGGGTGCCCT
  5   1   2       bld DMZ  5g3  in                         xl272b08.5p                       AGAACGCGCATCTGCTCAGATTCCTAGCCGGCCGGACACCATCAGGGTGTTGTACAAAGGGGAAGTAAAGCAACAAGACTGATTATACCGCTGTAACACTAATATCCACCAATCGGAACCATGCGTGAAATCGTGCACCTCCAGGCTGGCCAGTGCGGAAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACAGGGAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATCAACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCACCACTCTCGGTTCATCAGT
  5   1   2      seed DMZ  5g3  in                         xl238f20.5p                       AGAACGCGCATCTGCTCAGATTCCTAGCCGGCCGGACACCATCAGGGTGTTGTACAAAGGGGAAGTAAAGCAACAAGACTGATTATACCGCTGTAACACTAATATCCACCAATCGGAACCATGCGTGAAATCGTGCACCTCCAGGCTGGCCAGTGCGGAAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACAGGGAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATCAACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAA
  5   1   2       bld DMZ  5g3  in                         xl268d13.5p                       AGAACGCGCATCTGCTCAGATTCCTAGCCGGCCGGACACCATCAGGGTGTTGTACAAAGGGGAAGTAAAGCAACAAGACTGATTATACCGCTGTAACACTAATATCCACCAATCGGAACCATGCGTGAAATCGTGCACCTCCAGGCTGGCCAGTGCGGAAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACAGGGAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATCAACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGA
  5   1   2       bld Eye1 5g3  in                    IMAGE:6957637.5p                        AGGCTGGTACCGGTCCGGATTCTCCGGATCGGGGTGTTGCACAAAGGGCTTGTCCAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCGCTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAACGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGAAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCAGACCGAATCATGAATACATTCAGTGTGATGCCATCACCCAAAGTCTCAGACACTGTGGTTGAACCATATAATGCAACCCTCTCTGTTCATCAGTTGGTGGAGAAATACACATGAAACCCTACTGCATAGACCAGGAGGGCCCTCAATGATATCTGCTTCCCGCACTTTTCAGGTTAACAACCCCCACCTAATGGTGAATCTGGAATCACCCTTGGTATCCGGCTACAAATGAGCGGGGGGTAACAACCCTGACCTTCCGTTTCCCAAGGGCAGCTTTTAATGGCTGAATCTACGCCAAAAACGGGGCTGGTAAAAATGGGGGGCCTTTTTCCCCCCCATTGGCCCCtttttttt
  5   1   2       chi Eye1 5g                         IMAGE:7020055.5p                                 CTTAGCCGGCTGGAAACCATCGGGGTGTTGCACAAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAAGGAGCTGAGCTGGTGGACTCTNGTCTAGATGTGGTGAGAAAAGATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCCGAACCGAATCATGAATACATTCAGTGGGGATGCCCATCACCAAAAGTCTCAGAACCTTGTGGGTTGACCCTAATAAGGCCAACCCTCTCCTGGTTCATCAGTTGGTGGGGAAATATTCCGTTGGAAACCTTCTTGGCCAAAACCAATGGGGGGCCCTCTAAGGaaaaaacgggcttccccccccttttaaaggtttaaaaaaacccccccaccccaaaggggggggTAATCTGGAAAAACCCCCCCTTGTGTT
  5   1   2       bld Emb4 5g                IMAGE:5537019-IMAGp.IMAGp                                     CGGACGTGGAAACCATCGGGGTGTTGCACAAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAAGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGAAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCAGACCGAATCATGAATACATTCAGTGTGATGCCATCACCCAAAGTCTCAGACACTGTGGTTGAACCATATAATGCAACCCTCTCTGTTCATCAGTTGGTGGAAAATAC
  5   1   2       bld DMZ  5g3  in                         xl315a06.5p                                     GCCGGCTGGAAACCATCGGGGTGTTGCACAAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAAGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGAAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCAGACCGAATCATGAATACATTCAGTGTGATGCCATCACCCAAAGTCTCAGACACTGTGGTTGAACCATATAATGCAACCCTCTCTGTTCATCANT
  5   1   2       bld Emb4 5g                         IMAGE:5537019.5p                                      GGGACGTGGAACCATCGGGGTGTTGCACAAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAATCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCCAAGTGGTGCTGGCAATAACTGGGCCACAGGTCATTACACCGAAGGAGCTGACCTGGTAGACTCTGTTCCACATGTGGGGAGAAAAGAATCTCAGAGCTGTGACTGGCCTACAAGGGTTTCAACTGCACCCTTCTCTGGGAGGGGGCACACGGCTCTGGTATGGGGACCCCGACTCATCGCAAACATAAGGGGAGGAATACCCCAGACCCGAATCCTGGAAGACGTTACGTGGGGATGCCCACCACCCGAAAGGCCCAACAAACTGGGGGTGCGAACCCCTATCATGGAACCCCATCTATGATCAATCAGGTCggggggggAAGTACGGATAGGACACCTACATGGCCTAGGATCAGTGGGCGGCCCCCCACATACACATTCGGACTTCCCGCCCCTTTGTAGATTACGACAACGCCATGACACTAGGGGGCGTCCGGGCAATCACCCTTGGTGAATCCGCCCTACAACTGAGCGCGGGGCAAAGAGACATAGTCTCTTTCATGTTCCCACCGGGGCAGACGTTACGGTTCTGCGCCTCAGAGCAATGAGAGGCGCGG
  5   1   2       bld Emb4 5g3  in                    IMAGE:4970372.5p                                      CCGGCTGGAAACCATCGTGGTGTTGCACAAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAAGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGAAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCAGACCGAATCATGAATACATTCAGTGTGATGCCATCACCCAAAGTCTCAGACACTGTGGTTGAACCATATAATGCAACCCTCTC
  5   1   2       bld DMZ  5g3  in                         xl251d05.5p                                         TCGATTCNAATTCNGCACGAGGATCAGGGTGTTGTACAAAGGGGAAGTAAAGCAACAAGACTGATTATACCGCTGTAACACTAATATCCACCAATCGGAACCATGCGTGAAATCGTGCACCTCCAGGCTGGCCAGTGCGGAAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACAGGGAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATCAACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGAC
  5   1   2       bld Eye1 5g                         IMAGE:6946997.5p                                            TGGAAACATCGGGGTGTTGCACAAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAAGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGAAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCAGACCGAATCATGAATACATTCAGTGTGATGCCATCACCCAAAGTCTCAGACACTGTGGTTTGAACCATATAATGCAACCCTCTCTGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTAATGATATCTGGCTTCCGCCACTTTTAAAGTTTAACAAACACCAACCATATGGGTGATTCTGAAATCAACCCTTGGTATCCCGCCTAACAAATGGAGGCGGGGGGGTAAAACAAACCCCTGGCCCTTTCGGTTTTTCCCCCAGGGGGGCAGGCCTTTTAAATGGCCTTG
  5   1   2       bld Eye1 5g3  in                    IMAGE:6957739.5p                                            TCGGATCATGGTGGTGTTGCACAAAGTTCCAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAAGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGAAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTTCCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCAGACCGAATCATGAATACATTCAGTGTGATGCCATCACCCAAAGTCTCAGACACTGTGGTTGAACCCATATATGCAACCCTCTCTGTTCATCAGTTGGTGGAAAAAACAGATGAAACCCTACTGCATAGACAATGGAGGCCCCTCTATGATATCGGCTTTCCGCACTTTAAAGGTAAACAACACCCAACATATGGGGTGATCTGAATCCCCCTTGGTATCCGCCTAAAATTGAGCGGGGGGTAACCAACCTGCCCTTTCGTTTTCCCCAGGGGAAGCCTTAATGGCTGAATCCACCGCCAAACCTGGGCTGGTAA
  5   1   2       bld Ga15 5g3  in                       XL500f17ex.5p                                                  CCGGCCGGACACCATCAGGGTGTTGTACAAAGGGGAAGTAAAGCAACAAGACTGATTATACCGCTGTAACACTAATATCCACCAATCGGAACCATGCGTGAAATCGTGCACCTCCAGGCTGGCCAGTGCGGAAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACAGGGAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATCAACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACA
  5   1   2       bld Ga15 5g3  in                       XL501f17ex.5p                                                  CCGGCCGGACACCATCANGGTGTTGTACAAAGGGGAAGTAAAGCAACAAGACTGATTATACCGCTGTAACACTAATATCCACCAATCGGAACCATGCGTGAAATCGTGCACCTCCAGGCTGGCCAGTGCGGAAACCAAATTGGAGCTAAATTTTGGGAAGTCATCANTGATGAACACGGCATTGATCCTACAGGGAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATCAACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCANTTGGTGGAAAATACAGATGAAACCTACTGCATANACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTT
  5   1   2       bld Eye1 5g                         IMAGE:6957847.5p                                                     GCCGGACACCATCAGGGTGTTGTACAAAGGGGAAGTAAAGCAACAAGACTGATTATACCGCTGTAACACTAATATCCACCAATCGGAACCATGCGTGAAATCGTGCACCTCCAGGCTGGCCAGTGCGGAAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACAGGGAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATCAACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGNAGCGGGGGTAACANACCNNTGCCTTCGTTTCCCCAGGGCCAGCTGAAAATGCTGAATCTACCN
  5   1   2       bld DMZ  5g                              xl280d23.5p                                                        GGACACCATCAGGGTGTTGTACAAAGGGGAAGTAAAGCAACAAGACTGATTATACCGCTGTAACACTAATATCCACCAATCGGAACCATGCGTGAAATCGTGCACCTCCAGGCTGGCCAGTGCGGAAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACAGGGAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATCAACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACNATGAGGCCCTCTATGATATCTGCTTCCGCAC
  5   1   2       chi Brn1                            IMAGE:6953361.5p                                                          TGTTGCACAAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAAGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGAAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAAAATACCCAGACCCGAATTATGAATACGTTTCAGTGTGAAGGCCCATCACCCCAAAATTCTTCACAAACCTGGTCTCTTGGAACCCCTAATAAATGGCCAACCCCCTCCTACTGGGTTTCATACACAATTTggggggggaaaaaaaaTTCCCCACGATGTGTAAAAAATCCGTATCCTGGCCCCTATATAAAACACAACGGAAGGGGACCCCCCCTCCCTAAGGAGATAATCCCTGGCCTTTCCCGCGGGACATTTTGTTAAAAGGTTTGAAGAAAGACATCCACAACAGTAACATGGGGGGACATCTCGGAAAATCCACCCACTTTGGTAATAGCCGGCTCTAACAATTGTAACCCGTGGGGATTAAACAAAACCCCTGGCCCCTATGGGTGTTTTCCTCGAGGGGGCCAAGCACTTTAAAAGTTTCTTTCCACTTTAACAGGGAGAAGATGTGGGGCGGAGTTGTATCCCCCGCCCCGGCCATTTTCCTACCCN
  5   1   2       bld DMZ  5g3  in                         xl225g22.5p                                                           CACCATCAGGATGTTGTACAAAGGGGAAGTAAAGCAACAAGACTGATTATACCGCTGTAACACTAATATCCACCAATCGGAACCATGCGTGAAATCGTGCACCTCCAGGCTGGCCAGTGCGGAAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACAGGGAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATCAACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGA
  5   1   2       bld Eye1 5g                         IMAGE:4743362.5p                                                                  AAAGGGCAAGTAAAGCAACAAGAAAGGGCCACACCATCCACTGATTACACCACTGTAAGACTCAACCCATCGGAAACATGCGTGAAATCGTGCACCTCCAAGCTGGCCAGTGCGGTAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAAAGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGAAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGCGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTC
  5   1   2       bld Em10 5g                         IMAGE:7979777.5p                                                                  AGGGTGTTGTACAAAGGGGAAGTAAAGCAACAAGACTGATTATACCGCTGTAACACTAATATCCACCAATCGGAACCATGCGTGAAATCGTGCACCTCCAGGCTGGCCAGTGCGGAAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACAGGGAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATCAACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAATACAGATGAAACTACTGCATAGACATGAGGCCTCTATGATATCTGCTTCGCACTTNAAGTTACGACACNACATATGTGTCTGATCACTCGTATCGCACATGACGGGTACNACTGCTCGTCCCAGCACTGATGCTATACGCATGCTGCACTGTGCTTCTCACGCCTTTAG
  5   1   2       bld Ga18 5g3  in                       xlk66e18ex.5p                                                                                   GGAAGTAAAGCAACAAGACTGATTATACCGCTGTAACACTAATATCCACCAATCGGAACCATGCGTGAAATCGTGCACCTCCAGGCTGGCCAGTGCGGAAACCAAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACAGGGAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATCAACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGNTCTGGTATGGGAACCNTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGNTGGTGGAAAATACAGATGAAANCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCNCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTNCNNAATGAGCGGGTAACNACCNGCCTTNNTTTCCANG
  5   1   2       bld Brn3                            IMAGE:8537333.5p                                                                                                                                                                GAAGAGTATAAATAAAATTCGTCCCCCAATTGGAGCTAAATTTTGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACCGGCAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATTAACGTATACTACAATGAAGCCACAGGTAACAAATTTGTACCCCGTGCCATCCTTGTGGATTTGGAACCAGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCCGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAAGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGAAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCAGACCGAATCATGAATACATTCAGTGTGATGCCATCACCCAAAGTCTCAGACACTGTGGTTGAACCATATAATGCAACCCTCTCTGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTAAGATATCTGCTTTCGCACTTTAAAGTTAACAACACCACATATGGTGATCTGAATCACCTTGTTCCGCTACAAGAGCGGGGTAACACCTGCCTCGTTCCCAGGGCACTTATGCTAACTAGCAAATGGTGTCAAATGTGCTTCCCCGATGCCTTTTATCCGGCTTGCCATTACAATCTGCACAACATACGACCTGATGCGAATACCCTATTTAATCAAAATAGCCTGCACCTCTGACCCCTCAACTCTTCGGAATTTA
  5   1   2       bld Tad2                            IMAGE:6935309.5p                                                                                                                                                                                                          GGGGGAAGTCATCAGTGATGAACACGGCATTGATCCTACAGGGAGTTACCATGGAGACAGTGATTTGCAACTAGAAAGGATCAACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAAGTAACGACACCCACATATGGGTGAATCTGAATCACTCGTATCTGCCACAATGAGCGGGGTAACAACCCTGCCTTTCGTTTCCCAGGGCCAGCTGGAGAGCTTGATTTACCCAAACTGGGGTGGTCAAACATGGGTGCCCTTTCCCCTCGAACTGGCCttttttttAGGCCCCGGGCTTTGCCCCCATTAAACAGACCCGGGGGCAAGCCACGCAATTACCCGAAGCCCCTGAAAAGGGGCCCaaaaaactaaaaaCCGGCA
  5   1   2       bld Brn3                            IMAGE:8540001.5p                                                                                                                                                                                                                                                                                            CACGTATACTACAACGAAGCCACAGGTAACAAATATGTACCCCGTGCTGTCCTTGTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATCTACGCAAACTGGCTGTNCACATGGTGCCTTTCCTCGACTGCACTTTTTATGCCCGGGCTTGCCCATTACAGCGTGGCAGCAGCATNACGAGCCTGACGTGCAGACTACACGCAATGTTGATTCAGACAGATGCGCTGTATCTCTCTGGGCTCTCAGTACTGCACTCGTGAGATGCATGAGAGAATACGAT
  5   1   2       bld Brn3                            IMAGE:8537675.5p                                                                                                                                                                                                                                                                                                                                                  GTGGATTTGGAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATCTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTACACAGCAATGTTTGATTCCAGACATGATGGCGCTGTGATCTCGTCTGGCGCTACTCACGTACTGCTATCTCGTGGAGATGTCATGAAGAGTAATGACGATGCCATGTCAGACAAACAGCACTCTTGTGATGATCCACATGTAGANCATAT
  5   1   2       bld Brn3                            IMAGE:8536660.5p                                                                                                                                                                                                                                                                                                                                                           GAACCGGGCACAATGGACTCTGTCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATCTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCAAGTAGCTGCTATCTTCGTGGAAGATGTCTATGAANGAGTGATGACAGATGCTCATGTCAGAACAAACAGCACTACTT
  5   1   2       bld Tad1      in                    IMAGE:6879063.5p                                                                                                                                                                                                                                                                                                                                                                                GGCAGATCTGGACCATTCGGGCAGATTTTCAGACCAGACAACTTTGTGTTTGGTCAAAGTGGTGCTGGCAATAACTGGGCCAAAGGTCATTACACCGAAGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGAAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCAGACCGAATCATGAATACATTCAGTGTGATGCCATCACCCAAAGTCTCAGACACTGTGGTTGAACCATATAATGCAACCCTCTCTGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACAACACCAACATATGGTGATCTGAATCACCTTGTATCCGCTACAATGAGCGGGGTAACAACCTGCCTTCGTTNNTCCAGGCAGCTTTATGCTGATCTACGCAAACTGGCTGTCAACATGGTGCCTTTTCCCTCGATTGCACTTTTTTTATGCCAAGCCTTTGCCCCCTTTAAACAAGTCGTGGGCAGCCCAACCAATACCGAAGCCTTGACAGATGCCCAGAAACTAACCCCAGCAAATGGTTTTGATTCCCAAGAAACATGAATGGGCAGGCGGTGCCGATCCCCCGGTCCATGGAACGCCTACCTTCCACAGGTAAACCGGCTTATTCTTTCCGGG
  5   1   2       bld Tad1                            IMAGE:6938113.5p                                                                                                                                                                                                                                                                                                                                                                                                    GGGGATTTTCAGACCAGACAACTTTGTATTTGGTCAGAGTGGCGCTGGAAATAACTGGGCCAAAGGTCATTATACAGAGGGAGCTGAGCTGGTGGACTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATTTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGAATTCAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCCTTCCGTGGAAGAATGTCTATGAAAGAAGTAGATGAAACGATGCTCA
  5   1   2       bld Brn2                             Brn2-za40b05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTGGGGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCAGTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGT
  5   1   2       bld Brn2                             Brn2-za50d02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGGGTGAGATAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCAGACCGAATCATGAATACATTCAGTGTGATGCCATCACCCAAAGTCTCAGACACTGTGGTTGAACCATATAATGCAACCCTCTCTGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACAACACCAACATATGGTGATCTGAATCACCTTGTATCCGCTACAATGAGCGGNGTAACAACCTGCCTTCGTTTCCCAGGGCAGCTTAATGCTGATCTACGC
  5   1   2       bld Brn2                             Brn2-za52h10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGGGTGATTAAAGAATCTGAGAGCTGTGACTGCCTACAAGGTTTTCAACTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGTACCCTGCTCATCAGTAAGATAAGGGAAGAGTACCCAGACCGAATCATGAATACATTCAGTGTGATGCCATCACCCAAAGTCTCAGACACTGTGGTTGAACCATATAATGCAACCCTCTCTGTTCATCAGTTGGTGGAAAATACAGATGAAACC
  3   1   2       chi Tad1      in                    IMAGE:6879063.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAACGTGACATCTAAAAAGAGCTGCGGAGGTCCATATTTATTAAAGACTCCCCTGTGGGGAGTGGCTCCAGTTTTTATACACCCGCAGCAGAGAGAGTATCTCGTGCAATGTTGGGTGTTTTGGTGAGTTGTACCCCGCGGGTGGACGTTTTGTGGTTGAGTCACTGTTAGTGTTTAAGATACACGGAGGTTGTTTGAATGGAGTGCGCGAGGTATCACGGAGTACCATAGTCGTCTNCGTGGGGGTGGGGAGCGCCAGATGATTAAAACTAGGTGTGGAGGCTCGGAATGATTATATTCTTATTGGAGCCTCTCCGGGTGCGCGAAGAACATGTGATTTTTTGGCGGGTATTGTGTGCGCCAGGGTGTGAGGATCCAATATTTATGATTAGTAGAGCACATGGAGCCTGTCGGGATCGAGATATTCTTAATCCCTATGGGTTTCCAGTTGTGGGGAACATGGAATATAACTCTTTGCAACTCAAGTGTAAAGGGTGTGTTTTTATTTCTTTTGCATCGTTGGGGAAGGAAAAATGTTCTTTTTTGGACAGGAGGGCGTTAGGATTAGAAGCAGGATGTCGTCCATTTGTCCCATGAAACAAGGAGGCAGCTAGGTTACTTTTGTGGAAATGGATTCCCAACAATTGGGAAGACTCGCAGTTTGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGTTATTCAAGAGCTTTTCAAAAGAATCTCTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCCGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGAGATTTCGACCACTCATAGATGTTTTCCGGGAAAAGCGGGCTTCGTGCGCGGAGTAGCGAGATTTATGCGGTCTTTAATAATAATTTAGTGAGGTCGGGG
  5   1   2       bld Eye1      in                    IMAGE:4743065.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGATGCCATCACCCAAAGTCTCAGACACTGTGGTTGAACCATATAATGCAACCCTCTCTGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACAACACCAACATATGGTGATCTGAATCACCTTGTATCCGCTACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGGCAGCTTAATGCTGATCTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGATTGCACTTTTTTATGCCAGGCTTTGCCCCATTAACAAGTCGTGGCAGCCAACAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCAGCGTGCGATCCCCGTCATGGACGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAGAGCAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTTTGT
  5   1   2       bld Emb3      in                    IMAGE:3399590.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACGCGTCCGCCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACAACACCAACATATGGTGATCTGAATCACCTTGTACCCGCTACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGGCAGCTTAATGCTGATCTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCAATTGCACTTTTTTATGCCAGGCTTTGCCCCATTAACAAGTCGTGGCAGCCAACAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCAGCGTGCGATCCCCGTCATGGACGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCATAACAAGAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCACANTTTGTGACATTCCACCAAGAAGCCTCAAAATGTCTGCAACCTTTATTGATAACAACACTACTATTCAAGAACTTGTCAAAAGAATCTCTGAGCATGTCACTGCCATGTTCCATCGCAAAACTTTCTTGCACTAGTACACTAGTAAAGGCATGCTTAAAATGATTCACACAACTAGAAACACATGAA
  3   1   2       bld Eye1 5g3  in                    IMAGE:6957637.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCCCCCCTCCTTTTTTAGGAGGGTGACCCAGGGGTCTGGTTATATAAATAAACAGGGTGGTGCCCCAAAAGTATGGTTGTAGTTCCCCGGTCTTGGCTATAAATTGTGGGAGTTGCCACAGGGTTGAAGGGAAACCCCAGAATTTCCAATTAATTTTTTAACGGGGGGTATTTAACAGTTTAATTTTGGGTCTGGACTAAGTGGGGGTAATATCAGGGCTCTTTGAATATTTCTTTAGGGTGACCGGGTCACCTTTTAAGGTGGCAAGAATCAGGCATGGTAGATTTGCCATCCCGGATGGTTGGCCGTTAACGTTTACAGTAGAGGTCATTTTTCGTTGGAAGAATGTCTGTGCACAATGTAGTTGAACTGAGTGCTCAGGATCGTGAACATGAGCAGCAGATCCTTCGTAGAATGATTTCCCACCAATGTGAAGACCGCAGTTTGTGACATTCCACCAAGAGGCTTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCTATTCAAGAGCTTTTCAAAAGAATCTTTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACATTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCCGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTTCCCCCACACTTGATAA
  3   1   2       bld Eye1 5g3  in                    IMAGE:6957739.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCCAAGGACGGGGGGTAACAAACCTGCTTTTGGTTTTCCCAGGGCAGGTTTAAAGGCGGATCTACGGCAAAACGGGCGGTTAACCAGGTGCCTTTTCCCTGGATTGCACTTTTTTTATGCCAGGGTTTGGCCCCATTAACCAAGTCGTGGCAGCCAAACAATACCGAGCCCCTGACAGTGCCAGAACTAACACAGCAAATGTTNGATCCCAAGAACATGATGGCAGCGTGCGATCCCCGTCATGGACGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAGAGCAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTTTGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCTATTCAAGAGCTTTTCAAAAGAATCTCTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCCGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGAGATTTCGACCACTCATAGATGTTTCCGCACCACACTGGATAGAT
  5   1   2       bld Eye1                            IMAGE:7019652.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTGCACTTTTTTATGCCAGGCTTTGCCCCATTAACAAGTCGTGGCAGCCAACAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCAGCGTGCGATCCCCGTCATGGACGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAGAGCAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTTTGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCTATTCAAGAGCTTTTCAAAAGAATCTCTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCCGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTTCCCCCACACTGGATAAGATCATAAAAAGTATTTGTGCTNCN
  3   1   2       bld Em10 5g3  in                    IMAGE:7981601.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAGTCGTGGCAGCCAACAATACCGAGGCCCTGACAGTGCCAGGAACTAACACAGCAAATGTTTGATTCAAAGAACATGATGGCAGCGTGCGATCCCCGTCATGGACGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAGAGCAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTTTGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCTATTCAAGAGCTTTTCAAAAGAATCTCTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTTCCCCCAT
  3   1   2       bld DMZ  5g3  in                         xl315a06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCAGCCAACAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCAGCGTGCGATCCCCGTCATGGACGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAGAGCAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTTTGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCTATTCAAGAGCTTTTCAAAAGAATCTCTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCCGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTCCC
  3   1   2       bld Emb4 5g3  in                    IMAGE:4970372.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACAGCAAATGTTTGTTCCAAGAACATGATGGCAGCGTGCGATCCCCGTCATGGACGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAGAGCAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTTTGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCTATTCAAGAGCTTTTCAAAAGAATCTCTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAAGATGATGGTAGAAGTGATTTCGACCACTCATAGA
  3   1   2       bld Neu7                                 XL031g02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAGCAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTTTGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCTATTCAAGAGCTTTTCAAAAGAATCTCTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTTCCCCCACACGGAATAAGNATCATAAAAGTATT
  3   1   2       bld Tbd3                            IMAGE:3548805.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAGCCAGCAGCTACTTTGTTGAATGGATTCCCACCAAATGTGAAGACCGCAGTTTGTGACATTCCACAAGAGGCCTCAAAATGTCTGCAACCTTATTGGGTACCAGCCTGCTATTTCAAGAGCTTTTCAAAAGAATCTCTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCCGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTTCCCCCACACTGGATAAGATCATAAAAGTATTTGTGCTCATTCTCGTCTCTTTGTATTTTCTAATGTACCTTTCTAACATGAAATCATAGTCATTTTCTCTATGTGCTGCACAGAATAGAGGAATCACATTTGAATTACATTTTATTTTTTGCCATAAAACACGTTTTAATTGATAA
  3   1   2       bld Emb3      in                    IMAGE:3399590.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCAAGCTATTTGTGAAATGGATTCCCAACAATGTAAGGCCCCAGTTTTGGTCCATTCACCAAAAGGGCCTACAAATGGTCTGCACCCTTTATTGGTAACAGCACTGCTATTCAAGAGCTTTTCAAAAGAATCTCTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCCGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTTCCCCCCCCCTGGATAAGATCATAAAAGTATTTGTGCTCAAAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1                                 AW764736.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGGATTCCTAACAATGTGAAGACTGCAGTTTGTGACATTCCACCAAGAGGCTTCAAAATGTTTGCAACCTTTATTGGTAACAGCATTGCTATTCAAGAGCTTTTCAAAAGAATCTTTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTTCCCCCACACTGGATAAGATCATAAAAGTATTTGTGCTCAAA
  3   1   2       bld Eye1      in                    IMAGE:4743065.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCAAAAGAATCTCTGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGTGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCCGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAAATGTTTTCCCCCACACTGGATAAGATCATAAAAGTATTTGTGCTCATAAAAAAAAAAAAAA
  3   1   2       bld DMZ       in                         xl309d22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTCCC
  5   1   2       bld DMZ       in                         xl309d22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCACAGAAGCTGAGAGCAACATGAACGACTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTTCCCCCACACTGGATAAGATCATAAAAGTATTTGTGCTCaaaaaaaaaa
  5  -1   2       bld Brn2                             Brn2-zb09d04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCTGATGAGCAAGGCGAGTTTTAGGAAGAGGAAGATTAAGCTTGATGGCAAAGGCTCCTAGCATTTTTAGAAATAAAAAGGCACAGTTTTTTAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTAATGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTTGGCCACTCATAGATGTTTTcccccccccTGGATAAGATCATAAAAGTATTTGTGCTCATTCCCGCCCCTTTGTATTTTCTAATGGACCTTTCTAACATGAAATCATAGTCATTTTCTCTATGTGCTGCCCAGAATAGAGGAATCACATTTGAATTACATTTTATTTTTTGCCATAAAACCGTTTTAATTGGGGAAAAAAATATATATTAGATACTAGTGGTGGAANAATAT
  3   1   2       bld DMZ       out                        xl310d22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGNTGATGAGCAAGGCGAGTNTGAGGAAGAGGAAGATGAAGCTTGATGACAAAGGCTCNTAGCANTNTTAGAAATAAAAAGGCACANTTTTTAAATAGCTAGAGCATTNGCTCNGAAT
  5  -1   2       bld Brn2                             Brn2-za35f11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTTAGAAATAAAAAGGCACAGTTTTTAAATAGCTAGAGCATTTGCTCAGAATTTTGTTTCAGCATGCTTCTTCATTTTCTATTGTCAATGAAACCACAATCAGTTTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTTTTAGCATCTCTTCTAACGTTTACAAAATGCCCAAACATGATTAGGATGATGGTAGAAGTGATTTCGACCACTCATAGATGTTTTCCCCCACACTGGATAAGATCATAAAAGTATTTGTGCTCATTCTCGTCTCTTTGTATTTTCTAATGTACCTTTCTAACATGAAATCATAGTCATTTTCTCTATGTGCTGCACAGAATAGAGGAATCACATTTGAATTACATTTTATTTTTTGCCATAAAACACGTTTTAATTGAT
  5   1   2       e>3                               Xl3.1-XL501f17ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACGATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATTTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCTTTTAGATGTTTCTCCCCATTGGATAAGATCATAAAAATATTTGTGCT
                                                  Xl3.1-CHK-1012689805                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACGATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATTTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCTTTTAGATGTTTCTCCCCATTGGATAAGATCATAAAAATATT
  5   1   2       bld DMZ                                  xl314b18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCTGTTCTAGATGTGGTGAGGAAAGAATCTGAGAGCTGTGACTGCCTACAAGGATTTTCAGCTGACCCATTCTCTGGGTGGTGGCACAGGCTCTGGTATGGGAACCCTGCTCATAAGTAAGATAAGGGAAGAGTATCCAGACAGAATCATGAATACATTCANTGTGATGCCTTCACCCAAGGTCTCAGACACTGTGGTTGAACCATACAATGCAACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACGATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATTTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCTAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAA
  5   1   2       bld Tbd1                                 AW871791.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACACTCTCGGTTCATCAGTTGGTGGAAAATACAGATGAAACCTACTGCATAGACAATGAGGCCCTCTATGATATCTGCTTCCGCACTTTAAAGTTAACGACACCAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATTTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCAT
  3   1   2       bld Ga18 5g3  in                       xlk66e18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTTAAAGTTNACGACACCAACATATGGTGATCTGANNCNCCTCGTATCTGNCACAATGAGCGGGGNANCAACCTGCNNTCNTTTCCCAGGCCAGCTGAATGCTGATTTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGNCTGCACTTTTTTATGCCCGCTTTGCCCCATTAACAANNCGTGGCAGCCAGCAATANCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTNCCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGNNNCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAANNNNNAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGNCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGNCCGCTTTTAGNNNNNNCCCC
  5   1   2       add Skin                            IMAGE:8644321.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAACATATGGTGATCTGAATCACCTCGTATCTGCCACAATGAGCGGGGTAACAACCTGCCTTCGTTTCCCAGGCCAGCTGAATGCTGATTTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTTGATGACAANGCTCCTAGCATTTTTAGAAATCAAAGGCACAGTTTTAAATAGCTAANGCTTTGCTCAGAATTTTGTCAGCAGCT
  3   1   2       bld Tad2                            IMAGE:6872522.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAATTGAGGGGGGGAAAACAACCCTGCCTTTCGTTTTCCCACGGCCAGGGTGGAATGGTTGATTTAACGCAAACTGGGCTGTCAACCATGGTGGCTTTTCCCTTGGACTGCACTTTTTTATGCCCCGGTTTGCCCCATTAACAAGCCGGGGCAGCCAGCAATACCGAGGCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCTTTTTA
  3   1   2       bld Ga15 5g3  in                       XL501f17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGCTGAATGCTGATTTTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCTTT
  5   1   2       bld Brn1                            IMAGE:7019464.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAATGCTGATTTACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTCGACTGCACTTTTTTATGCCCGGCTTTGCCCCATTAACAAGCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCCAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTTGACCGCTTTTTAGATGTTTCTCCCCA
  3   1   2       bld Ga15 5g3  in                       XL500f17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACGCAAACTGGCTGTCAACATGGTGCCTTTCCCTGGACTGCACTTTTTTATGCCCCGGCTTTGCCCCATTAACAAGCCCGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCTTTTAGATGTTCTCCCCAT
  3   1   2       bld DMZ  5g3  in                         xl225g22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTGGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCT
  3   1   2      seed DMZ  5g3  in                         xl238f20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCAGCCAGCAATACCGAGCCCTGACAGTGCCAGAACTAACACAGCAAATGTTTGATTCCAAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCT
  5   1   2       bld Brn3                            IMAGE:8540582.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGAACATGATGGCGGCATGTGATCCTCGTCATGGGCGCTACCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAACTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCTACCTTTTACAAATGCCCTAACATGATTAGATGAACGTGAAAGTATTTGACCGCTTTATAGTTTCTCCCTTTGAAAAAATCATAAATATTTTGCCTCACATAATTCAAATAAGAAATATAAGGGCGCGGTAGGCTGATTTTTAACCGGTCTGACCCTCTcatatagttatacatatcatatatatatCTGAATGGATCTCCTTTGTTTA
  3   1   2       bld DMZ  5g3  in                         xl268d13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTGACCGCTTTAGA
  3   1   2       bld DMZ  5g3  in                         xl272b08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCACAGTAGCTGCTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACCGGTAGAAGTGATTTTGACCGCT
  5   1   2       bld Ga15      in                       XL435n10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCTTTTAGATGTTTCTCCCCATTGGATAAGATCATAAAAATATTTGTGCTCA
  3   1   2       bld Ga15      in                       XL435n10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTATCTTCCGTGGAAGAATGTCTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCTT
  3   1   2       bld Ga15                               XL401a15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTATGAAGGAGGTAGATGAACAGATGCTCAATGTCCAGAACAAAAACAGCAGCTACTTTGTTGAATGGATTCCCAACAATGTGAAGACCGCAGTATGTGACATTCCACCAAGAGGCCTCAAAATGTCTGCAACCTTTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCTTTTAGATGTTCTCCCCATGA
  3   1   2       bld Tbd1                                 AW782514.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTATGTGACATTCCACCAAAAGGCTTCAAAATGTCTGCACCCTTTATTGGTACCAGCANTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCTTTCTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCTTTTAGATGTTTCTCCCCATTGGATAAGATCATAAAAATATTTGTGCTCAAA
  3   1   2       bld DMZ  5g3  in                         xl251d05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTATTGGTAACAGCACTGCCATTCAAGAGCTTTTTAAGAGAATCTCAGAGCAGTTCACTGCCATGTTCCGTCGCAAAGCNNTNTTGCACTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACNGAAGCTGAGAGCAACATGAATGATTGGGTGTCAGAGTATCAGCAGTNCCAAGATGCAACAGGTGATGAGCAAGNNGANNNTGAGGAAGAGGAAGGGGAAGATGAAGCTTGNTGACAAAGGCTCCTAGCATTTTTNGAAATCAAAAGGCACAGTTTTTAAATAGCTAAANCATTNGCTCNGAATTTTGTTCCAGCATGNTTNTTCNTNTTCTATNGTCAATAATACCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAATCAGTTGTTGTTTTTAGCATCTCTNCGAACTTTTACAAAATGCCCCAAGCATGATTAGGATGA
  3   1   2       bld Emb4                            IMAGE:4203567.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCATTTCAAGGCTTTTTTAAGAGAATCTCAGAGCAGTTCCCTGCCTGGTTCGTTCGCAAAGCTTTCTGCANCTGGTACACTGGCGAGGGCATGGATGAGATGGAGTTCACAGAAGCTGAGAGCAACATGAATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGGAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTTTTTAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTGGTGTCAATAATACCCCCATCCAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTGAAGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCTTTTAGATGTTTCTCCCCATTGGATAAGATCATAAAAATATTTGTGCTCAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Brn2                             Brn2-za35d10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATGATTTGGTGTCAGAGTATCAGCAGTACCAAGATGCAACAGCTGATGAGCAAGGCGAGTTTGAGTAAGAGGAAGGGGAAGATGAAGCTTGATGACAAAGGCTCCTAGCATTTTTAGAAATCAAAAGGCACAGTTTTTAAATAGCTAAAGCATTTGCTCAGAATTTTGTTCCAGCATGCTTCTTCATTTTCTATTGTCAATAATGCCACAATCAAATTTTTGTAACCTTTACAATGTCAAAGTAACAGTTGTTGTTTTTAGCATCTCTTCGAACTTTTACAAAATGCCCTAACATGATTAGGATGACGGTAGAAGTGATTTTGACCGCTTTTAGATGTTTCTCCCCATTGGATAAGATCATAAAAATATTTGTGCTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)