Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012837587 Xl3.1-XL418e06ex.5.5 - 73 ESTs
                                                                       ........-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-XL418e06ex.5.5                                                                                         TTTCTATCCTCAGGTTGTTGTTTTTTTTGCATTTGGATGTGCAGTGCACAAGCATTCTTCCTTTATTAAGTATCGGTGTAATATTAATAGTCATGAATGTGAGGGCTGCAAGGCTGGCAGTCTGCGCCTGTTAGTAGGAAAAGCCTGCGGAGCTGCAACCAGGAACAGAGTCTAGGGGACAAGGATTAAGGAAACCAGAAATCCAAACTTTGCCTAAAACATCCCTCCCAGAATAGCAATTGTGTTCTCAACCCAAAATGAAGAAGAATATCGTCCACTTCTGATGGATTATATATGCTTCCTTATTATGCCTACAGAGCTTTGGTTCTTGTGATTTTGTAGAAACCAAGTGCACCAAAAGCATCGCTCCAGCCTCCCGCTCTGTTAGGCACTCACAGGGACTACTGCACACAGGATTGGGGACAAGGAATAACTGGAAAAGTCTCTTCCCAGCGACCCATGAACATGCTTTGGAAACTAACGGATAATATCAAGTATGAGGAGTGCGAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATGGAGGGGATAAACACCGAAAGTGACGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCAAATCATGGGAGAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACATTTTTTTTTTCTAAAGAAAAAAAAAAAATCTATCTATATATATATATGTGTC
                                                  Xl3.1-CHK-1012722701                                                                                               TCCTCAGGTTGTTGTTTTTTTTGCATTTGGATGTGCAGTGCAxxxGxxTTCTTCCTTTATTAAGTATCGGTGTAATATTAATAGTCATGAATGTGAGGGCTGCAAGGCTGGCAGTCTGCGCCTGTTAGTAGGAAAAGCCTGCGGAGCTGCAACCAGGAACAGAGTCTAGGGGACAAGGATTAAGGAAACCAGAAATCCAAACTTTGCCTAAAACATCCCTCCCAGAATAGCAATTGTGTTCTCAACCCAAAATGAAGAAGAATATCGTCCACTTCTGATGGATTATATATGCTTCCTTATTATGCCTACAGAGCTTTGGTTCTTGTGATTTTGTAGAAACCAAxTxCxCCAAAAGCATCGCTCCAGCCTCCCGCTCTGTTAGGCACTCACAGGGACTACTGCACACAGGATTGGGGACAAGGAATAACTGGAAAAGTCTCTTCCCAGCGACCCATGAACATGCTTTGGAAACTAACGGATAATATCAAGTATGAGGAGTGCGAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATxxAGxxGATAAAxAxxxxAAxxxxCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTxxxxxxAAATCAxGxxxxAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACxxxxxxxxxxxGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGAxAxxxxxxxxxxxxAxAxAAAAAAAAAAAATCTATCTATATATATATATGTGTCATCGGG
                                                      consensus depths                                                                                              2     4     2     4     2     4     2     4     3     5     3     5     3     5     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     4     6     4     6     4     6     4     6     4     7     4     7     4     7     4     7     4     7     4     9     4    10     4    10     5    17     5    21     7    23     7    23     7    23     7    24     7    25     7    26     7    28     7    28     7    29     7    29     7    30    13    30    17    30    29    30    30    31    29    31    30    31    29    30    29    31    29    30    30    31    29    30    30    31    30    31    29    30    29    30    29    31    30    31    29    30    29    31    29    31    29    31    29    31    28    30    29    32    31    32    29    32    29    33    28    32    30    34    31    34    31    34    31    34    30    34    30    34    27    32    27    32    24    32    26    31    27    32    27    32    16    30    15    31    13    26    13    26    12    25    12    25    12    25    10    22    10    22    10    24    10    24    10    24    10    24    10    23     9    20     9    20    10    20    11    21    13    23    14    23    13    23    15    24    16    25    12    25    12    23    16    23    16    25    16    25    18    25    18    27    18    27    18    27    19    27    17    27    20    27    20    28    20    28    21    28    22    28    19    28    21    28    20    28    20    28    21    28    19    27    22    27    22    27    23    28    22    28    22    28    22    28    23    28    24    27    23    27    23    27    12    28    14    27    14    28    12    26    13    25    11    25    12    25    12    25    12    25    12    25    12    25    12    25    10    25    12    24    12    25    12    25    12    25    12    25    12    25    11    25    12    24    11    21     8    17     7    14     5    13     3    11     5     6     2     4     2     4
  5   1   2      en>5                               Xl3.1-XL418e06ex.5                                                                                         TTTCTATCCTCAGGTTGTTGTTTTTTTTGCATTTGGATGTGCAGTGCACAAGCATTCTTCCTTTATTAAGTATCGGTGTAATATTAATAGTCATGAATGTGAGGGCTGCAAGGCTGGCAGTCTGCGCCTGTTAGTAGGAAAAGCCTGCGGAGCTGCAACCAGGAACAGAGTCTAGGGGACAAGGATTAAGGAAACCAGAAATCCAAACTTTGCCTAAAACATCCCTCCCAGAATAGCAATTGTGTTCTCAACCCAAAATGAAGAAGAATATCGTCCACTTCTGATGGATTATATATGCTTCCTTATTATGCCTACAGAGCTTTGGTTCTTGTGATTTTGTAGAAACCAAGTGCACCAAAAGCATCGCTCCAGCCTCCCGCTCTGTTAGGCACTCACAGGGACTACTGCACACAGGATTGGGGACAAGGAATAACTGGAAAAGTCTCTTCCCAGCGACCCATGAACATGCTTTGGAAACTAACGGATAATATCAAGTATGAGGAGTGCGAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACATTTTTTTTTTCTAAAGAAAAAAAAAAAA
  5   1   2      en>5                                 Xl3.1-xl325m09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGAAGCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTTATAAAAGACATTTTTTTCTAAAGAAAAAGAAATAATACAAAAAAAAAAAATCTATCTATATATATATATGTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGATTTTATTTTCATTTTTTTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCACACACAGGGACTGCTGCACACAGGACTGGGCACAAGGAAGAACTGGAAAAGTCTCTTCCCAGCGACCCATGAAAATGCTCTGGAAACTAACGGATAATATCAAATATGAGGAGTTCGAGGATCGCCATGATGGCACCAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGTATCATTTTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCAACAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTGGCCGAAGTCCAAAGAAGACTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGATAGGGTTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAGACGCAAAGCTGCCAATGTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGAGGCAGTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGTGCGAAACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGCAACATTCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACAATAATCCCAACAGCCATACAGACAACAGCAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGATGAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATGAGAAACAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAACCGGGATCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGTGTCAATCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTTATAAAAGACATTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTCTAAAGAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --GC--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G--------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------A---C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------GG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------C-A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---T-G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------C--C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----A------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --C-----A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G-----A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----T------
                                               BLH ATG     465     843                                                                                         
                                               BLH MIN     459     295                                                                                         
                                               BLH MPR     138     295                                                                                         
                                               BLH OVR     459     187                                                                                         
                                               CDS MIN     459     295                                                                                         
                                               ORF LNG     459      19                                                                                         
  5   1   2      en>5                               Xl3.1-XL418e06ex.5                                                                                         TTTCTATCCTCAGGTTGTTGTTTTTTTTGCATTTGGATGTGCAGTGCACAAGCATTCTTCCTTTATTAAGTATCGGTGTAATATTAATAGTCATGAATGTGAGGGCTGCAAGGCTGGCAGTCTGCGCCTGTTAGTAGGAAAAGCCTGCGGAGCTGCAACCAGGAACAGAGTCTAGGGGACAAGGATTAAGGAAACCAGAAATCCAAACTTTGCCTAAAACATCCCTCCCAGAATAGCAATTGTGTTCTCAACCCAAAATGAAGAAGAATATCGTCCACTTCTGATGGATTATATATGCTTCCTTATTATGCCTACAGAGCTTTGGTTCTTGTGATTTTGTAGAAACCAAGTGCACCAAAAGCATCGCTCCAGCCTCCCGCTCTGTTAGGCACTCACAGGGACTACTGCACACAGGATTGGGGACAAGGAATAACTGGAAAAGTCTCTTCCCAGCGACCCATGAACATGCTTTGGAAACTAACGGATAATATCAAGTATGAGGAGTGCGAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACATTTTTTTTTTCTAAAGAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012686348                                                                                               TCCTCAGGTTGTTGTTTTTTTTGCATTTGGATGTGCAGTGCAxxxGxxTTCTTCCTTTATTAAGTATCGGTGTAATATTAATAGTCATGAATGTGAGGGCTGCAAGGCTGGCAGTCTGCGCCTGTTAGTAGGAAAAGCCTGCGGAGCTGCAACCAGGAACAGAGTCTAGGGGACAAGGATTAAGGAAACCAGAAATCCAAACTTTGCCTAAAACATCCCTCCCAGAATAGCAATTGTGTTCTCAACCCAAAATGAAGAAGAATATCGTCCACTTCTGATGGATTATATATGCTTCCTTATTATGCCTACAGAGCTTTGGTTCTTGTGATTTTGTAGAAACCAAxTxCxCCAAAAGCATCGCTCCAGCCTCCCGCTCTGTTAGGCACTCACAGGGACTACTGCACACAGGATTGGGGACAAGGAATAACTGGAAAAGTCTCTTCCCAGCGACCCATGAACATGCTTTGGAAACTAACGGATAATATCAAGTATGAGGAGTGCGAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACATTTTTTTTTxxxAAxxAAAAAA
  5   1   2       bld Emb1      in                    IMAGE:3402854.5p ccctcattctctgtgagtctctccctcctcttcctccccctccacctctGATTAGATACACTGCCTCTTCATTCAATGGACGTCATTTAGAACAGGGCTCTGCCTTGAGTTGCCTCTTCGGTTCACGCTCGATTTCCAAGCATTCTTCCTTTATTAAGTATCGGTGTAATATTAATAGTCATGAATGTGAGGGCTGCAAGGCTGGCAGTCTGCGCCTGTTAGTAGGAAAAGCCTGCGGAGCTGCAACCAGGAACAGAGTCTAGGGGACAAGGATTAAGGAAACCAGAAATCCAAACTTTGCCTAAAACATCCCTCCCAGAATAGCAATTGTGTTCTCAACCCAAAATGAAGAAGAATATCGTCCACTTCTGATGGATTATATATGCTTCCTTATTATGCCTACAGAGCTTTGGTTCTTGTGATTTTGTAGAAACCAATTTCTAGAGCTGGGAttttattttcattttttttttACCACTTCTCTAATTTTCTTCTTTGATCAACGTTTTCTTTCTGATTTCT
  5   1   2       chi Emb4                   IMAGE:4724969-IMAGp.IMAGp                 CTTTAATTTAATGCACATTTGCCTAAAATTTTATTTTTCTAGCATGGTTGATTAGAAAAATATTTTGTCTATTTTCTATCCTCAGGTTGTTGttttttttGCATTTGGATGTGCAGTGCAGTCGTTGATTGCTTTGAATGTACTTCCTATGAATCCATGATGTTTTTGCTCAGTCTGAGCACATTGTTACAATGGGTTCCTTGCAGCAAAGGGAACAGGCATTACTAATAAAAGACAGGCTTGTCTCTCACATCATAACAAACCATTATGGTTATGCGGCTGAGGTTTTTTCATTCTGTAGACATGCATGAGGGCTGTGCACTTTTATCTAAGAACGTGGCCTCTGATTTCTGCAGAAATGTGAGTCTGAGCTAACCATTGCCCTAATGTATTTCTAGGCATCTTTCAGCACGTTCATGGGTGTTGTGGGCCTGTATAATAAACATACTTTTCTGCTGGTCTTTAGATTGGCATCTGCATGGGAAGCTTAAATAAGCTCCTGCCAGTGTAGAAAGGTTTTGCTGCTCAAGTTCAAGAATATCGGTTTAATATATAATTTGTTCTTTTGTCttttttttGTAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACaatctccctatgccagtgcccccccactctctcacacccccaatgctgacttccagccccccTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCC
  5   1   0       chi Emb4                            IMAGE:4724969.5p                  TTTAATTTAATGCACATTTGCCTAAAATTTTATTTTTCTAGCATGGTTGATTAGAAAAATATTTTGTCTATTTTCTATCCTCAGGTTGTTGttttttttGCATTTGGATGTGCAGTGCAGTCGTTGATTGCTTTGAATGTACTTCCTATGAATCCATGATGTTTTTGCTCAGTCTGAGCACATTGTTACAATGGGTTCCTTGCAGCAAAGGGAACAGGCATTACTAATAAAAGACAGGCTTGTCTCTCACATCATAACAAACCATTATGGTTATGCGGCTGAGGTTTTTTCATTCTGTAGACATGCATGAGGGCTGTGCACTTTTATCTAAGAACGTGGCCTCTGATTTCTGCAGAAATGTGAGTCTGAGCTAACCATTGCCCTAATGTATTTCTAGGCATCTTTCAGCACGTTCATGGGTGTTGTGGGCCTGTATAATAAACATACTTTTCTGCTGGTCTTTAGATTGGCATCTGCATGGGAAGCTTAAATAAGCTCCTGCCAGTGTAGAAAGGTTTTGCTGCTCAAGTTCAAGAATATCGGTTTAATATATAATTTGTTCTTTTGTCttttttttGTAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGGCCCCCCACTCTCTCACNACCCCAATGCTGACTTCCAGCCCCCCTACTTTCCTCCGCCCTACCAGGCAATATACCCCCANGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATCCCTCCATGCCCAGCCCACACCACGGCACCCAGGTTTGGCCGGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGGCTACCACATCAAACTTTCTGGTTGGGAACCCCCGGAG
  5   1   2       bld Em10      in                    IMAGE:7981831.5p                                                                                     ATTTAGAACAGGGCTCTGCCTTGAGTTGCCTCTTCGGTTCACGCTCGATTTCCAAGCATTCTTCCTTTATTAAGTATCGGTGTAATATTAATAGTCATGAATGTGAGGGCTGCAAGGCTGGCAGTCTGCGCCTGTTAGTAGGAAAAGCCTGCGGAGCTGCAACCAGGAACAGAGTCTAGGGGACAAGGATTAAGGAAACCAGAAATCCAAACTTTGCCTAAAACATCCCTCCCAGAATAGCAATTGTGTTCTCAACCCAAAATGAAGAAGAATATCGTCCACTTCTGATGGATTATATATGCTTCCTTATTATGCCTACAGAGCTTTGGTTCTTGTGATTTTGTAGAAACCAATTTCTAGAGCTGGGAttttattttcattttttttttaccacttctctaattttcttctttgatcaacgttttctttctgatttctcttcttcAATTTGTAACTATATACTCTTCCCAGATGTTGGTTCACAGTTTTTCCGCTATGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGcccccccactctctcacacccccaatgctgacttccagcccccctacttccctccgcccTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGGCGGAACAGAGACAGAGCCAGAGACAAGTCTGTTA
  5   1   2       bld Emb1                            IMAGE:6637190.5p                                                                                                                              ACGCTCGATTTCCAGCATTCTTTCTTTATTAAGTATCGGTGTAATATTAATAGTCATGAATGTGAGGGCTGCAAGGCTGGCAGTCTGTGCCTGTTAGTAGGAAAAGCCTGCGGAGCTGCGCCCAGGAACAGAGTCTGGGGGACAAGGATTAAGGAAACCAGAAATCCAAACTTTGCCTAAAACACCCCTCCCAGAATAGCAATTGTGCTTTCAACCCAAAATGAAGAAGAATTTCCTCCACTTCTGATGGATTATATATGCTTCCTTATTATGCCTACAGAGCTTTGGTCTTTATGATTTTCTAGAGACCAATTTCTAGACCTGGGattttattttcatttttttttaccacttctctatttttttttttttAAATTTCTTCTTTGATCAACGTTTTCTTTCTGATTTCTCTTCTGCAATTTGTATCTATATCCTCTTCCCAGATGTTGGTTCACAGTTTTTCCGCTATGGATCGCCATGATGGCACCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCACGGTGGGACAATCTCCTTAtgccagtgcccccccactctctcacacccccaatgctgacttccagccccccTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCCTCATACCCAGCCACAACCACAGNCACCCAGGNTTGCCCCGGGACAGAGACAGAGCCCAAGAGACCAGTTTGGTTACACACACATCGGGGGGCTACCGCAACAACTTCTTCGGGTCTGGAACCCCCCGGAGGGATTATAGGAAGGGCACGAAAAATTTACTACATGGGGCATCACGGGATTCCGCTTCAGGGACGGGGGGGACCC
  5   1   1       add Ga12      in                         XL185l09.5p                                                                                                                                                                     GTAATATTAATAGTCATGAATGTGAGGGCTGCAAGGCTGGCAGTCTGTGCCTGTTAGTAGGAAAAGCCTGCGGAGCTGCGCCCAGGAACAGAGTCTGGGGGACAAGGATTAAGGAAACCATCAAATCCAAACTTTGCCTAAAACACCCCTCCCAGAATAGCAATTGTGCTTTCAACCCAAAATGAAGAAGAATTTCCTCCACTTCTGATGGATTATATATGCTTCCTTATTATGCCTACAGAGCTTTGGTCTTTATGATTTTCTAGAGACCAATTTCTAGACCTGGGattttattttcatttttttttACCACTTCTCTATTTNTT
  5   1   2       bld Em10      in                    IMAGE:7980417.5p                                                                                                                                                                                                                                                                                                                                             GGGAGGCTGGGAGGCTGTGGGGCTGTTGCCGGTATGCTAATGAGCACATCAGGACTTGGTACTGGGGaaaaaaaaGAAACTTTCCACCATTAGAGGGAGATCTGAGTGCACCAAAAGCATCGCTCCAGCCTCCCGCTCTGTTAGGCACTCACAGGGACTACTGCACACAGGATTGGGGACAAGGAAGAACTGGAAAAGTCTCTTCCCAGCGACCCATGAACATGCTTTGGAAACTAACGGATAATATCAAGTATGAGGAGTGCGAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGtgcccccccactctctcacacccccaatgctgacttccagcccccctacttcccTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGT
  5   1   2       bld DMZ                                  xl243b14.5p                                                                                                                                                                                                                                                                                                                                                                                                      CTTTGTGAGTGAAATAGCTGAGCGAATTCCAACAGCAGGGCGCAGGCGCGCACAGGTACCAACCAGTTCTTATGAACAGGTGAGATATTGTTGGGAAGGGAGAAGAAGGATTCGTGGAGTCGCTCGCACCAGCAGGCGGATCCCGAAGTGTAGCAGCAGCTGCAACATATCATAGGATGGCTCTACTGGCTAAAATGGGGGAATGGCAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGGGCCTGTATCATTT
  5   1   2       bld Ga12                                 XL173c24.5p                                                                                                                                                                                                                                                                                                                                                                                                                 GCTTCCTTATTATGCCTACAGAGCTTTGGTTCTTGTGATTTTGTAGAAACCAATTTCTAGAGCTGGGAttttattttcattttttttttaccacttctctaattttcttctttgatcaacgttttctttctgatttctcttcttcaatttGTAACTATATACTCTTCCCAGATGTTGGTTCACAGTTTTTCCGCTATGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGNGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTNTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGG
  5   1   2       bld DMZ                                  xl244g18.5p                                                                                                                                                                                                                                                                                                                                                                                                                      GCTGAGCGAATTCCAACAGCAGGGCGCAGGCGCGCACAGGTACCAACCAGTTCTTATGAACAGGTGAGATATTGTTGGGAAGGGAGAAGAAGGATTCGTGGAGTCGCTCGCACCAGCAGGCGGATCCCGAAGTGTAGCAGCAGCTGCAACATATCATAGGATGGCTCTACTGGCTAAAATGGGGGAATGGCAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTccctatgccagtgcccccccactctctcacacccccaatgctgacttccagccccccTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGG
  5   1   2       bld Ga15                               XL418e06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                            GATCTGAGTGCACCAAAAGCATCACTCCAGCCTCCCTCTCTGTTAGGCACACACAGGGACTGCTGCACACAGGACTGGGCACAAGGAAGAACTGGAAAAGTCTCTTCCCAGCGACCCATGAAAATGCTCTGGAAACTAACGGATAATATCAAATATGAGGAGTTCGAGGATCGCCATGATGGCACCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCACGGTGGGACAATCTCCTTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATACCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTTTGTTACACACACATCGGGGGCTACCGCACCAACTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGCTATTGAAGACATATCGCACGTTGAGGACCAGAGTATCAACATCCCAGATCAAACTGTAATTAAGAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTGGCCGAAGTCCAAAGAAGACTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTA
  5   1   2       bld Ga12                                 XL179p02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGGCTGAGTGCACCAAAAGCATCGCTCCAGCCTCCCGCTCTGTTAGGCACTCACAGGGACTACTGCACACAGGATTGGGGACAAGGAATAACTGGAAAAGTCTCTTCCCAGCGACCCATGAACATGCTTTGGAAACTAACGGATAATATCAAGTATGAGGAGTGCGAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAA
  5   1   2       bld Ga12                                 XL220m24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGGCTGAGTGCACCAAAAGCATCGCTCCAGCCTCCCGCTCTGTTAGGCACTCACAGGGACTACTGCACACAGGATTGGGGACAAGGAATAACTGGAAAAGTCTCTTCCCAGCGACCCATGAACATGCTTTGGAAACTAACGGATAATATCAAGTATGAGGAGTGCGAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAA
  5   1   2       bld Em10                            IMAGE:7979272.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTGAGTGCACCAAAAGCATCACTCCAGCCTCCCTCTCTGTTAGGCACACACAGGGACTGCTGCACACAGGACTGGGCACAAGGAAGAACTGGAAAAGTCTCTTCCCAGCGACCCATGAAAATGCTCTGGAAACTAACGGATAATATCAAATATGAGGAGTTCGAGGATCGCCATGATGGCACCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCACGGTGGGACAATCTCCTTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATACCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTTTGTTACACACACATCGGGGGCTACCGCACCAACTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGCTATTGAAGACATATCGCACGTTGAGGACCAGAGTATCAACATCCCAGATCAAACTGTAATTAAGAAAGGGCCTGTATCATTGTCTNAATCAATAACATGCNGTGTCGCCCTCTCTCTCACAAGACATCTCTTGGAGAGTCTCATCCCACGAGTGTCTGCTCATCCCGACGCTGTCTTGCTCACTCACTCAATACAGGACGTGCCGAGTCAGAGATGCCCGCGATGCTATGTCCTCTGGGGATTAGAGCAATCAACGAGAGT
  5   1   2       bld Ga12      in                         XL179f19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCACGAGGCAAAAGCATCACTCCAGCCTCCCTCTCTGTTAGGCACACACAGGGACTGCTGCACACAGGACTGGGCACAAGGAAGAACTGGAAAAGTCTCTTCCCAGCGACCCATGAAAATGCTCTGGAAACTAACGGATAATATCAAATATGAGGAGTTCGAGGATCGCCATGATGGCACCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCACGGTGGGACAATCTCCTTAtgccagtgcccccccactctctcacacccccaatgctgacttccagccccccTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATACCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTTTGTTACACACACATCGGGGGCTACCGCACCAACTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGCTATTGAAGACATATCGCACGTTGAGGACCAGAGTATCAACATCCCAGATCAAACTGTAATTAAG
  5   1   2       bld Emb4      in                    IMAGE:4202221.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGTGCACCAAAAGCATCGCTCCAGCCTCCCGCTCTGTTAGGCACTCACAGGGACTACTGCACACAGGATTGGGGACAAGGAATAACTGGAAAAGTCTCTTCCCAGCGACCCATGAACATGCTTTGGAAACTAACGGATAATATCAAGTATGAGGAGTGCGAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTTTCACACCCNCAATGCTGACTTCCAGCCCCCCTACTTACCTTCGGCCTACCAGGCAATATACCCGCAGTGTCAAGATCCCTACTCCCACGTTAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAAACAAGTCTTGTACACACACATCGGGGGCTACCACATCAACTTTCTGGGTTTGGACCCCCGGGAGGGAATAATAGAAGGGACCAA
  5   1   2       bld DMZ                                  xl260p20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGTGCACCAAAAGCATCGCTCCAGCCTCCCGCTCTGTTAGGCACTCACAGGGACTACTGCACACAGGATTGGGGACAAGGAATAACTGGAAAAGTCTCTTCCCAGCGACCCATGAACATGCTTTGGAAACTAACGGATAATATCAAGTATGAGGAGTGCGAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATctccctatgccagtgcccccccactctctcacacccccaatgctgacttccagccccccTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAG
  5   1   2       bld Ga12      in                         XL199c01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATCACTCCAGCCTCCCTCTCTGTTAGGCACACACAGGGACTGCTGCACACAGGACTGGGCACAAGGAAGAACTGGAAAAGTCTCTTCCCAGCGACCCATGAAAATGCTCTGGAAACTAACGGATAATATCAAATATGAGGAGTTCGAGGATCGCCATGATGGCACCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCACGGTGGGACAATCTCCTTAtgccagtgcccccccactctctcacacccccaatgctgacttccagccccccTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATACCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTTTGTTACACACACATCGGGGGCTACCGCACCAACTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGCTATTGAAGACATATCGCACGTTGAGGACCAGAGTATCAACATCCCAGATCAAACTGTAATTAAGAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGANGTGTTCTGCTCA
  5   1   2       bld DMZ       in                         xl267c21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGGTTCTTATGAACAGGTGAGATATTGCTGTGAAGGGAGAAGAAGGAGTTGTGCAGTCGGTCGCACCAGCAAGAGGATCCCCCTGAGGACTATTAGCAGCAACACATCATAGGATGGCTCTACTGGCTAAAATGGGGGAATGGCAGGATCGCCATGATGGCACCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCACGGTGGGACAATCTCCTTATGCCAgtgcccccccactctctcacacccccaatgctgacttccagcccccctacttccctccgcccTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATACCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTTTGTTACACACACATCGGGGGCTACCGCACCAACTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGCTATTGAAGACATATCGCACGTCGAGGACCAGAGTATCAACATCCCAGATCAAACTGTAATTAAGAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTC
  5   1   2       bld DMZ       in                         xl325m09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGTTCTTATGAACAGGTGAGATATTGCTGTGAAGGGAGAAGAAGGAGTTGTGCAGTCGGTCGCACCAGCAAGAGGATCCCCCTGAGGACTATTAGCAGCAACACATCATAGGATGGCTCTACTGGCTAAAATGGGGGAATGGCAGGATCGCCATGATGGCACCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCACGGTGGGACAATCTCCTTATGCCAGtgcccccccactctctcacacccccaatgctgacttccagcccccctacttccctccgcccTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATACCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTTTGTTACACACACATCGGGGGCTACCGCACCAACTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGCTATTGAAGACATATCGCACGTCGAGGACCAGAGTATCAACATCCCAGATCAAACTGTAATTAAGAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTC
  5   1   2       bld DMZ       in                         xl288h02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGTTCTTATGAACAGGTGAGATATTGCTGTGAAGGGAGAAGAAGGAGTTGTGCAGTCGGTCGCACCAGCAAGAGGATCCCCCTGAGGACTATTAGCAGCAACACATCATAGGATGGCTCTACTGGCTAAAATGGGGGAATGGCAGGATCGCCATGATGGCACCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCACGGTGGGACAATCTCCTTATGCCAGtgcccccccactctctcacacccccaatgctgacttccagcccccctacttccctccgcccTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCNATGACCCCTATAGTCTTAATTCCCTCCATACCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTTTGTTACACACACATCGGGGGCTACCGCACCAACTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCANGACTGGGGGACCTGCCTTTACACTCCATACCTCATGCTATTGAAGACATATCGCACGTC
  5   1   2       bld Ga12      in                         XL174m04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATCGCTCCGCCTCCCGCTCTGTTAGGCACTCACAGGGACTACTGCACACAGGATTGGGGACAAGGAATAACTGGAAAAGTCTCTTCCCAGCGACCCATGAACATGCTTTGGAAACTAACGGATAATATCAAGTATGAGGAGTGCGAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTgcccccccactctctcacacccccaatgctgacttccagcccccctacttccctccgcccTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGG
  5   1   2       bld Ga12                                 XL216h05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCGCTCCAGCCTCCCGCTCTGTTAGGCACTCACAGGGACTACTGCACACAGGATTGGGGACAAGGAATAACTGGAAAAGTCTCTTCCCAGCGACCCATGAACATGCTTTGGAAACTAACGGATAATATCAAGTATGAGGAGTGCGAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGcccccccactctctcacacccccaatgctgacttccagcccccctacttccctccgcccTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGGGCCTGTATCATTTTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCA
  5   1   2       bld Em10                            IMAGE:7982318.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGCTGTGAAGGGAGAAGAAGGAGTTGTGCAGTCGGTCGCACCAGCAAGAGGATCCCCCTGAGGACTATTAGCAGCAACACATCATAGGATGGCTCTACTGGCTAAAATGGGGGAATGGCAGGATCGCCATGATGGCACCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCACGGTGGGACAATCTCCTTATGCCAGtgcccccccactctctcacacccccaatgctgacttccagcccccctacttcccTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATACCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTTTGTTACACACACATCGGGGGCTACCGCACCAACTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCTACCTCATGCTATTGAAGACATATCGCACGTTGAGGACCAGAGTATCAACATCCCAGATCAAACTGTAATTAAGAAAGGGCCTGTATCATTGTCTAAATCAATAACAATGCGGTGTCCTCCCTCCCCTCAACAAAAACATCTCTTCGGAGGATCCTCAATCCAACGAGGTGTTCTGCTCATCCCGGGAACCTTCTTTACTCACTCCACTCAAATACAAGTGACATGGCCAAGTCAAAAATA
  5   1   2       bld Ga15                               XL496g09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACAGGACTGGGCACAAGGAAGAACTGGAAAAGTCTCTTCCCAGCGACCCATGAAAATGCTCTGGAAACTAACGGATAATATCAAATATGAGGAGTTCGAGGATCGCCATGATGGCACCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCACGGTGGGACAATCTCCTTAtgccagtgcccccccactctctcacacccccaatgctgacttccagccccccTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATACCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTTTGTTACACACACATCGGGGGCTACCGCACCAACTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGCTATTGAAGACATATCGCACGTTGAGGACCAGAGTATCAACATCCCAGATCAAACTGTAATTAAGAAAGGGCCTGTATCATTGTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCAACAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTGG
  5   1   2       bld Em10                            IMAGE:7979759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATTCGTGGAGTCGCTCGCACCAGCAGGCGGATCCCGAAGTGTAGCAGCAGCTGCAACATATCATAGGATGGCTCTACTGGCTAAAATGGGGGAATGGCAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGGGCCTGTATCATTTTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCACAAAGACATCTCTTCGGAGAGTCCCTCATCCACGAGGTGTCTGCTCATCCCGGACGCTGTCTCTGCTCACTCACTCAAGTCANGTGACGTGCAAATCAGAAAGCGTCCGCCGATGCTCAGCTCCTCGGGGATACAGAGCAAACAAACGAGAGTCCGAGAAT
  5   1   2       bld Emb4                   IMAGE:4202568-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAACTGGAAAAGTCTCTTCCCAGCGACCCATGAAAATGCTCTGGAAACTAACGGATAATATCAAATATGAGGAGTTCGAGGATCGCCATGATGGCACCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCACGGTGGGACAATCTCCTTATGCCAGTGCccccccactctctcacacccccaatgctgacttccagcccccctacttccctccgcccTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATACCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTTTGTTACACACACATCGGGGGCTACCGCACCAACTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGCTATTGAAGACATATCGCACGTTGAGGACCAGAGTATCAACATCCCAGATCAAACTGTAATTAAGAAAGGGCCTGTATCATTGTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCAACAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTGGCCGAAGTCCAAAGAAGACTGTCCCCGCCCGAGTGCCTCAATGCTTTCGCTGCTGGGGGGAGTACTAAGGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGCTAGACAAGATAGGGTTAAACCTGCCGGCAAGAAGACGCAAAGCTGCCAATGTCACGCTCCCTCA
  5   1   2      seed Em10                            IMAGE:8318388.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACCAGCAGGCGGATCCCGAAGTGTAGCAGCAGCTGCAACATATCATAGGATGGCTCTACTGGCTAAAATGGGGGAATGGCAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGCccccccactctctcacacccccaatgctgacttccagcccccctacttccctccgcccTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTT
  5   1   2       bld Emb4      in                    IMAGE:4202568.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGAAAAGTCTCTTCCCACGACCCATGAAATGCTCTGGAAACTAACGGATAATATCAAATATGAGGAGTTCGAGGATCGCCATGATGGCACCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCACGGTGGGACAATCTCCTTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATACCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTTTGTTACACACACATCGGGGGCTACCGCACCAACTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCT
  5   1   2       bld Em10                            IMAGE:8317682.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGATCCCGAAGTGTAGCAGCAGCTGCAACATATCATAGGATGGCTCTACTGGCTAAAATGGGGGAATGGCAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACTCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCTATGTTGGCCGGGACACACACAGAGCCAAGAGACAAGACTGTTACACACACTTCGGGGGCTACTCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGTACGAAGATTTACTACATGGGCCTCATGGACTTCAACTCATGACTGGTGGACCTGCCTTTATACTCCATACCCCATGTTATTGAACACCTATCGCACTTTGAAGACTCTAGTATCAACATTCCCAATTAAACTGTAATTAAAAAATACAATCTCTTCGGAGGAGTCCTCAATCCCAACTATGTGTTCTGCTCCTCCCCGGAAGCCTGTTCCTGCCATCTCCACTTCAAAGTACAAGGTAAAGTTTGCAAAATCCCTTATAGGCTGTccccccccTATTGCTCATGATTCGCTC
  5   1   2       bld Emb9                            IMAGE:7974775.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCAACATATCATAGGATGGCTCTACTGGCTAAAATGGGGGAATGGCAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGGGCCTGTATCATTTTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCAACAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAATCCAGAGAAGGCTGTCTCCGCTC
  5   1   2       bld Ga12                                 XL216p20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTGGTTCACAGTTTTTCCGCTATGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAgtgcccccccactctctcacacccccaatgctgacttccagcccccctacttccctccgcccTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAAT
  5   1   2       bld Em10                            IMAGE:7982265.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGGGCCTGTATCATTTTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCAACAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGTGACAGTTGCAGAAATCCAAAAAGGCTGTCCCCGCCCGAGTGCCTCAATGCATCGCTGCTGGGGGGGAGACTAATGAGGGCAAATTCTAAAACGGAGAAGGTCCCGAGGGAAAAGTTGGAAAAAATAGGTTAAATCTGCCGGCGG
  5   1   2       bld Tbd7                                 XL094h01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGGGCCTGTATCATTTTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCAACAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGCGACAGTTGAAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAG
  5   1   2       bld Brn1      in                    IMAGE:6950657.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCGGAATTCCCGGGATCCAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTTTGTTACACACACATCGGGGGCTACCGCACCAACTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGCTATTGAAGACATATCGCACGTTGAGGACCAGAGTATCAACATCCCAGATCAAACTGTAATTAAGAAAGGGCCTGTATCATTGTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCAACAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTGGCCGAAGTCCAAAGAAGACTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCANACGAGCAAAGTACGCGGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGGAACTCCCAGACCAAATCCCATTCTGGAAACCTGGGGATCCCGAGCTGCCTGGACCCACTTTCACCTTTATATCT
  5   1   2       bld Ga15      out                      XL471f10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GANANAAGTTTGTTACANACACATCGGGGGCTACNGCACCAANTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGCTATTGAAGACATATCGCACGTTGAGGACCAGAGTATCAACATCCCAGATCAAACTGTAATTAAGAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTGGCCGAAGTCCAAAGAAGACTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGG
  5   1   2       bld Ga12                                 XL163g18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCATTACATCCCTTGTGGAGGGAGAGG
  5   1   2       bld Emb1                            IMAGE:6864688.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGGACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGGAGCCCAGCAGTATGTGCGGGCTATCACCGGCCCTGCCAGAATTACCCTCCCTGAGGCCACTCCAAAGCAATGGAACAAAATGTTACCTTCAACAAATAATTCCCAACAGCCCTTACAGGACAACCAGCCAA
  5   1   2       bld Ga15                               XL420o01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCCANCAGTATGTGCGGCTATCA
  5   1   2       bld DMZ       in                         xl310b23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGGGCCTGTATCATTTTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCAACAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAAC
  5   1   2       bld Ga15                               XL457j03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAA
  5   1   2       bld DMZ                                  xl248a21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCNGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCA
  5   1   2       bld Bla1      in                    IMAGE:3379759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCGCCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGANGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTTCTTACATCNCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCANAGCAGCGGCTGAATGTGTCAATCNGCAACATTCCCACCCGAACGAGCAAGTAGCGCGGGAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTAGGACAGATCCCCTTGGGGAACTCCAGACCNATNCTATTCNTGACCTGGGATACAGAGCTGCCTGACCCACTTCACCTTATATCTATGGATTTGGGAGCCAGCAGTATGTGCGGCTATCACCCGCCTGCAGAATTACCTCACTGAGGCACTCAAAGCGATGGGACAAATGTACGTCTCAAGTATTCCCACTAGCATACAGGACAA
  5   1   2       bld DMZ                                  xl257k10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAAGAAAGGGCCTGTATCATTGTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCAACAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTGGCCGAAGTCCAAAGAAGACTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAAAATTACCTCACTGAGGCACTCAAAG
  5   1   2       bld DMZ                                  xl285f01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAANGANGGCANAATCTNNNAACGGANGAAGGTCTCTGAGGGAGAAGTTGGACAANATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGG
  5   1   2       bld Tad2      out                   IMAGE:6873765.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAAGTGACGTCACTTTCTGCAGCCACCCAACTCTTCTCTATTGGGNCTCCCCGCCCGCTCGAGGTGAACAGAACGTGGTTTTATGGGCTAACCGGGGATCTAAAAACATGGGGATCCCANTCTGGGCCTAGAACAATGGCCCCGGGCCCTGGATTGATGGGAATCCAATCCCACACCCCCGGATTTCCGGTGGG
  5   1   2       bld Ga15                               XL466j24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCGCTTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCNGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTA
  3   1   2       bld DMZ       in                         xl310b23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATCTNAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTG
  5  -1   2       bld Bla2                            IMAGE:7297538.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTATGTCGTGTGGGATATAGAGGCAATTAAACGAGAGTCTTGAGAGAGTGACAGTAGGTNAATTGCGCAGGAGACGCAAGTGCCATGTCAGCTCCTACATCCGTGTGGAGGAGAGGCAGCCATCTAGCCAGAGATTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACAtttttttttctaaagaaaaaaaaaaaaataatcaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCAATCGCCTTAG
  5   1   2       bld DMZ                                  xl258e12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTAC
  3   1   2       bld Em10      in                    IMAGE:7980417.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAAGGGTTAATCCCCCCGACTGAGAGAGCCATGTGCCAAATATAGCCTCTTACATCCATTGGAGAGGAGAAGGGAGTCCATCTTAGCCAGGGATTTCGGGTATTGGTTGCGAAACAGAATTTTCCTTGCCAAAGGAGGGGCTGAATTTGGTCAAATGGGGCAACATTCCGACCCGAACGAGCAAGGTAACCGCGGAAGAAACATGCTTCTAGGCCACCCAAACAGATTTGTAAAGAATTCAACAGATTTGCTGTCTCAGGACAGATTCCCCCTTGGGGAAACTCCAGACCCAAATCCCTATTCTGGAGCCCTGGGATACAGAAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCCGCCCTGCAGAATTTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCAGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGTAC
  5  -1   2       bld Bla2                            IMAGE:7298017.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGAGGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACAtttttttttctaaagaaaaaaaaaaaaataatacaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGTACCCAATCGCCTTAGACTGCTTAA
  3   1   2       bld Bla1      in                    IMAGE:3379759.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCATCTAGCCAGAGATTTGGGGGTATGTGTGCGAACAAGAATTTCCTGCCCAAGCAGCGGCTGAATTCGTCAATCGGCAAACATTCGGACCAGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATNTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTTTGGAGCNTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACTGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTT
  3   1   2       bld Ga12      in                         XL174m04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTTATAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTNTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATNTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATNTAGAGCATGGNAGNCCAGT
  3   1   2       bld Emb4      in                    IMAGE:4202221.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACCCAGAATTCCCCCCAAAACAGCGGCTGAATTTGCATCGGCAACAATCCGACCCGAACGACCAAGTAACCGGAAAGACAATGCTTCTACCCCCAAACAGATTGGTAAAGAATTCACAGATTTGCTGTTTAGGGACAGATCCCCCTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGTTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGNCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACATTTTTTTTTCTAAAG
  3   1   2       bld Emb1      in                    IMAGE:3402854.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAACATGTTCTAAGCCCCCCACAGATTTGGTAAGGAATTCACAGATTTGCGGTCCAAGGACAGATCCCCCTTGGGAACTTCAGACCCAAATCCTATTCTGGAGCCTGGAATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCACCAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTNTTTACAAAAGACATTTTTTTTTCTAAAGAAAAAAAAAAAAATAATACA
  3   1   2       bld Emb4                            IMAGE:4957379.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCAGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACATTTTTTTTTTCTAAAGAAAAAAAAAAAAAATAATCCA
  3   1   2       add Em10      in                    IMAGE:7981831.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCATACAGAAAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCGGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATTTAGAGCATGGGAGTCCAGTCTGGTCTTGAACATTGCCCGGTCCTGATGAGGGGATCAATCCACACACGGATTCGGTGGGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACATTTTTTTCCTAAAGAAAAAAAAAAAAATAATACAAAAAAAAAAAAAAATCTATATCTATATATATGTGTCATCGGACTGATTCACCGCCTTTCCTTCCAGCTGTGAATTGTAAGAGGGG
  5   1   2       bld Ga15                               XL468l15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACATTTTTTTTTCTAAAGaaaaaaaaaaaaaataatacaaaaaaaaaa
  5   1   2      en>5                                 Xl3.1-xl325m09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGAAGCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTTATAAAAGACATTTTTTTCTAAAGAAAAAGAAATAATACAAAAAAAAAAAATCTATCTATATATATATATGTGT
                                                  Xl3.1-CHK-1012692266                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTTATAAAAGACATTTTTTTCTAAAGAAAAAGAAATAATACAAAAAAAAAAAATCTATCTATATATATATATGTGTCATCGG
  3   1   2       bld Brn1      in                    IMAGE:6950657.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAACGCCCGTTTTCTGGTTCAGTTTCCCATTTCAAAAGTACAAGGGGACCAGTGCCCGAAAGTCCAAAGAAAGACTGTCCCCGCCCGGAGTGCCTCAAGGTTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGGAGGAAGGTCTCTGAGGGAGAAGCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGCCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTATGGAA
  3   1   2       bld DMZ       in                         xl325m09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTTAAAACGGAGGAAGGTCTTTGAGGGAGAAGCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGTTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTATAAA
  3   1   2       bld DMZ       in                         xl288h02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAGGNAGAAGCTAGACAAGATAGGGTTAANCCTGCNGGCAGGAAGACGCAAAGCTGNCAATGTCACGCTCNTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTNGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGNCCCAANCGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTNTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTANCCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCNGATGTTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGT
  3   1   2       bld Ga12      in                         XL179f19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGAAGACGCAAAGCTGCCAATGTCACGCTCNTCACATCCNTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTTATAAAAGA
  3   1   2      seed Neu7                                 XL002d14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTTATAAAAGACATTTTTTTCTAAAGAAAAAGAAATA
  3   1   2       bld Ga12      in                         XL199c01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGC
  3   1   2       bld DMZ       in                         xl267c21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGTTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACT
  3   1   2       bld Emb4      in                    IMAGE:4202568.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCGCNCCAGAATTCCTGCCCAAATGNCCGGTGAATAGTCAACCGCGTACTTCCGACCCCATCGAGCAAGTAACGCGGAAGACATGCTTCTTGCCCCAAACAGTTTGGTAAGGATTCCCAGATTTGCTTCTCAGGCCAGATCTCCCTGAGGGACTCCAGACCAAATCCCATTCTGGAACCTGGAACCAAAGCTGCCTGACCACTTCCACCCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGCCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGNCAATGGAGNCCAAGCAANGACAGCTCNTGTTTTAAGTGTTGGAACTTTTTATAAAAGACATTTTTTTCTAAAGAAAAAGAAATAATACA
  3   1   0       chi Gas8                            IMAGE:3517280.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGCCCCAAAACAAAATTGGAAAGCATTCACCGATTTGGCGGTTCAAGAAAGATTTTCCCTGGGGGACCCCAAAACAAAATCCATTTTGGGAACTGGGAACCCAGAGCTGCCTTAACCCACTCAACCTTAAATCTCATGGGATTTGGGAGCCCAACAGGGGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATA
  5   1   2       bld Ga15      in                       XL496k16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCACGGCGTCCGATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTTATAAAAGACATTTTTTTCTAAAGAAAAAGAAATAATACaaaaaaaaaa
  3   1   2       add Ga12      in                         XL185l09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTCAACCNTATATGTCATGGATNTGGGANCCCAGCAGTGTGTGCAGCTATCNNTGCCNTGCAGAATTACCTCACNGAGGCACTCAAAGCAATGGACAAAANGTACCTCAACNACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACT
  3   1   2       add Ga15      in                       XL496k16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCAAAGCAANGGACAAAANGTNCCTNAACAACAGGCCATACAGACAACAGCAAAGGNGGGGATAAAGANGAAAAACCCCGAAAGNGANGCAACTTTTTGCATTCAACTTTTCNCTATTGGTNTCCCNCCCNCCCGAGNGAACNGAACGNGTTTTTTGGNTAACCGGGATTTAAATCANGGGNGTACNGTTTGGTTTAGNACNTTGTCCNGTCCCTNTGANGGNGTCAATCCCCNCATGGATTTTAACAGAACAGGCAATGGAGCCNAGCAAGACAGCTNTGTTTTAGTGTTGGAACTTTTTATAAAAGACATTTTTTTTTAAAGAAAAAGAAATAATTCAAAAAAAAAAAATCTATCTATATATATATATGTGTCATCGGACTGATTCACCACCTTCCCTTCAGCTGAGATTGTAGAGGCCCAGAGGA
  5   1   2       bld Gas8                            IMAGE:3517072.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACCACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGCCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACtttttataaaagacatttttttctaaagaaaaagaaataatacaaaaaaaaaaaatctatctatatatatatatGTGTCATCGGGACTGATTCACCACCTTCCCTTCAGCTGAGATTGTAGAGGCCCAGAGGATGGCAGTTATCAGTATTGTGAATAAACTTGAACACAAAATACTTACAGTTCCATGTCATGTCTTCAAGTTGTACCTAccccccatcccccTCTAAAGGTAAAAATGAAACACCTTGAACTTTGGTTTTT
  5   1   2       add Tbd2                            IMAGE:3199712.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTGGTTTAGAACATTGTCCAGTCCCTCTGATTTTTTTAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACtttttataaaagacattttttttctaaagaaaaagaaataatacaaaaaaaaaatctatctatatatatatatGTGTCATCGGACTGATTCACCACCTTCCCTTCAGCTGAGATTGTAGAGGCCCAAAGGATGGCAGGTATCAGTATTGTGAATAAACTTGAACACAAAATACTTACAGTTCCATGTCATGTCTTCAAGTTGTACCTAccccccatcccccTCTAAAGGTAAAAATTAAACACCTTGAACTTTGGTTTTTCGGACATAAGTCGCAGCCAATCTAAAAGGGAATCAGTGTTCATGTATATATTTATTTATGTGTAATTTAATGGGGATTGTAAATATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)