Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 06 Jul 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

 This cluster: approximate FL confidence score = 96%

 1012837587 Xl3.1-XL418e06ex.5.5 - 73 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                              2     4     2     4     2     4     2     4     3     5     3     5     3     5     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     4     6     4     6     4     6     4     6     4     7     4     7     4     7     4     7     4     7     4     9     4    10     4    10     5    17     5    21     7    23     7    23     7    23     7    24     7    25     7    26     7    28     7    28     7    29     7    29     7    30    13    30    17    30    29    30    30    31    29    31    30    31    29    30    29    31    29    30    30    31    29    30    30    31    30    31    29    30    29    30    29    31    30    31    29    30    29    31    29    31    29    31    29    31    28    30    29    32    31    32    29    32    29    33    28    32    30    34    31    34    31    34    31    34    30    34    30    34    27    32    27    32    24    32    26    31    27    32    27    32    16    30    15    31    13    26    13    26    12    25    12    25    12    25    10    22    10    22    10    24    10    24    10    24    10    24    10    23     9    20     9    20    10    20    11    21    13    23    14    23    13    23    15    24    16    25    12    25    12    23    16    23    16    25    16    25    18    25    18    27    18    27    18    27    19    27    17    27    20    27    20    28    20    28    21    28    22    28    19    28    21    28    20    28    20    28    21    28    19    27    22    27    22    27    23    28    22    28    22    28    22    28    23    28    24    27    23    27    23    27    12    28    14    27    14    28    12    26    13    25    11    25    12    25    12    25    12    25    12    25    12    25    12    25    10    25    12    24    12    25    12    25    12    25    12    25    12    25    11    25    12    24    11    21     8    17     7    14     5    13     3    11     5     6     2     4     2     4
  5   1   2      en>5                                 Xl3.1-xl325m09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGAAGCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTTATAAAAGACATTTTTTTCTAAAGAAAAAGAAATAATACAAAAAAAAAAAATCTATCTATATATATATATGTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGATTTTATTTTCATTTTTTTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCACACACAGGGACTGCTGCACACAGGACTGGGCACAAGGAAGAACTGGAAAAGTCTCTTCCCAGCGACCCATGAAAATGCTCTGGAAACTAACGGATAATATCAAATATGAGGAGTTCGAGGATCGCCATGATGGCACCAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGTATCATTTTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCAACAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTGGCCGAAGTCCAAAGAAGACTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGATAGGGTTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAGACGCAAAGCTGCCAATGTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGAGGCAGTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGTGCGAAACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGCAACATTCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACAATAATCCCAACAGCCATACAGACAACAGCAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGATGAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATGAGAAACAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAACCGGGATCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGTGTCAATCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTTATAAAAGACATTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTCTAAAGAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --GC--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G--------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------A---C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------GG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------C-A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---T-G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------C--C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----A------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --C-----A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G-----A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----T------
                                               BLH ATG     465     843                                                                                         
                                               BLH MIN     459     295                                                                                         
                                               BLH MPR     138     295                                                                                         
                                               BLH OVR     459     187                                                                                         
                                               CDS MIN     459     295                                                                                         
                                               ORF LNG     459      19                                                                                         
  5   1   2       bld Ga12                                 XL173c24.5p                                                                                                                                                                                                                                                                                                                                                                                                                 GCTTCCTTATTATGCCTACAGAGCTTTGGTTCTTGTGATTTTGTAGAAACCAATTTCTAGAGCTGGGAttttattttcattttttttttaccacttctctaattttcttctttgatcaacgttttctttctgatttctcttcttcaatttGTAACTATATACTCTTCCCAGATGTTGGTTCACAGTTTTTCCGCTATGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGNGGGACAATCTCCCTATGCCAGTGCCCCCCCACTCTNTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGG
  5   1   2       bld DMZ       in                         xl288h02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGTTCTTATGAACAGGTGAGATATTGCTGTGAAGGGAGAAGAAGGAGTTGTGCAGTCGGTCGCACCAGCAAGAGGATCCCCCTGAGGACTATTAGCAGCAACACATCATAGGATGGCTCTACTGGCTAAAATGGGGGAATGGCAGGATCGCCATGATGGCACCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCACGGTGGGACAATCTCCTTATGCCAGtgcccccccactctctcacacccccaatgctgacttccagcccccctacttccctccgcccTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCNATGACCCCTATAGTCTTAATTCCCTCCATACCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTTTGTTACACACACATCGGGGGCTACCGCACCAACTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCANGACTGGGGGACCTGCCTTTACACTCCATACCTCATGCTATTGAAGACATATCGCACGTC
  5   1   2       bld Ga12      in                         XL174m04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATCGCTCCGCCTCCCGCTCTGTTAGGCACTCACAGGGACTACTGCACACAGGATTGGGGACAAGGAATAACTGGAAAAGTCTCTTCCCAGCGACCCATGAACATGCTTTGGAAACTAACGGATAATATCAAGTATGAGGAGTGCGAGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAGTgcccccccactctctcacacccccaatgctgacttccagcccccctacttccctccgcccTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGG
  5   1   2       bld Emb4      in                    IMAGE:4202568.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGAAAAGTCTCTTCCCACGACCCATGAAATGCTCTGGAAACTAACGGATAATATCAAATATGAGGAGTTCGAGGATCGCCATGATGGCACCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCACGGTGGGACAATCTCCTTATGCCAGTGCCCCCCCACTCTCTCACACCCCCAATGCTGACTTCCAGCCCCCCTACTTCCCTCCGCCCTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATACCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTTTGTTACACACACATCGGGGGCTACCGCACCAACTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCT
  5   1   2       bld Ga12                                 XL216p20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTGGTTCACAGTTTTTCCGCTATGGATCGCCATGATGGCAGCAATGGGACTGGTCGGTTACCCCAGCTGGGCTCGGTGGGACAATCTCCCTATGCCAgtgcccccccactctctcacacccccaatgctgacttccagcccccctacttccctccgcccTACCAGCCAATATACCCCCAGTCTCAAGATCCCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAAT
  5   1   2       bld Tbd7                                 XL094h01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTACTCCCACGTCAATGACCCCTATAGTCTTAATTCCCTCCATGCCCAGCCACAACCACAGCACCCAGGTTGGCCGGGACAGAGACAGAGCCAAGAGACAAGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGGGCCTGTATCATTTTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCAACAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGCGACAGTTGAAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAG
  5   1   2       bld Ga15      out                      XL471f10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GANANAAGTTTGTTACANACACATCGGGGGCTACNGCACCAANTCTCCGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCATCACGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGCTATTGAAGACATATCGCACGTTGAGGACCAGAGTATCAACATCCCAGATCAAACTGTAATTAAGAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTGGCCGAAGTCCAAAGAAGACTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGG
  5   1   2       bld Ga12                                 XL163g18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTCTGTTACACACACATCGGGGGCTACCACATCAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCATTACATCCCTTGTGGAGGGAGAGG
  5   1   2       bld Emb1                            IMAGE:6864688.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAACTTTCTGGTCTGGACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGGACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGGAGCCCAGCAGTATGTGCGGGCTATCACCGGCCCTGCCAGAATTACCCTCCCTGAGGCCACTCCAAAGCAATGGAACAAAATGTTACCTTCAACAAATAATTCCCAACAGCCCTTACAGGACAACCAGCCAA
  5   1   2       bld Ga15                               XL420o01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACCCCCGGAGGGATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCCANCAGTATGTGCGGCTATCA
  5   1   2       bld DMZ       in                         xl310b23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGGGCCTGTATCATTTTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCAACAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAAC
  5   1   2       bld Ga15                               XL457j03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTATAGGAGGCACGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAA
  5   1   2       bld DMZ                                  xl248a21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGAAGATTTACTACATGGGCCTCATGGACTCAGCTCAGGACTGGGGGACCTGCCTTTACACTCCATACCTCATGTTATTGAAGACGTATCGCACGTTGAGGACCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCNGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCA
  5   1   2       bld Bla1      in                    IMAGE:3379759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCGCCCGAGTATCAACATCCCAGATCAAACTGTAATTAAAAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGANGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTTCTTACATCNCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCANAGCAGCGGCTGAATGTGTCAATCNGCAACATTCCCACCCGAACGAGCAAGTAGCGCGGGAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTAGGACAGATCCCCTTGGGGAACTCCAGACCNATNCTATTCNTGACCTGGGATACAGAGCTGCCTGACCCACTTCACCTTATATCTATGGATTTGGGAGCCAGCAGTATGTGCGGCTATCACCCGCCTGCAGAATTACCTCACTGAGGCACTCAAAGCGATGGGACAAATGTACGTCTCAAGTATTCCCACTAGCATACAGGACAA
  5   1   2       bld DMZ                                  xl257k10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAAGAAAGGGCCTGTATCATTGTCTAAATCCAATAACAATGCGGTGTCGTCCCTCTCTCTCAACAAAGACAATCTCTTCGGAGGAGTCCTCAATCCCAACGAGGTGTTCTGCTCAGTCCCCGGACGCCTGTCTCTGCTCAGCTCCACTTCAAAGTACAAGGTGACAGTGGCCGAAGTCCAAAGAAGACTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAAAATTACCTCACTGAGGCACTCAAAG
  5   1   2       bld DMZ                                  xl285f01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGACAGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAANGANGGCANAATCTNNNAACGGANGAAGGTCTCTGAGGGAGAAGTTGGACAANATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGG
  5   1   2       bld Tad2      out                   IMAGE:6873765.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTTGCAGAAGTCCAGAGAAGGCTGTCCCCGCCCGAGTGCCTCAATGCTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAAGTGACGTCACTTTCTGCAGCCACCCAACTCTTCTCTATTGGGNCTCCCCGCCCGCTCGAGGTGAACAGAACGTGGTTTTATGGGCTAACCGGGGATCTAAAAACATGGGGATCCCANTCTGGGCCTAGAACAATGGCCCCGGGCCCTGGATTGATGGGAATCCAATCCCACACCCCCGGATTTCCGGTGGG
  5   1   2       bld Ga15                               XL466j24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCGCTTAAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCNGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTA
  3   1   2       bld DMZ       in                         xl310b23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATCTNAAAACGGAGGAAGGTCTCTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTG
  5  -1   2       bld Bla2                            IMAGE:7297538.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTATGTCGTGTGGGATATAGAGGCAATTAAACGAGAGTCTTGAGAGAGTGACAGTAGGTNAATTGCGCAGGAGACGCAAGTGCCATGTCAGCTCCTACATCCGTGTGGAGGAGAGGCAGCCATCTAGCCAGAGATTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACAtttttttttctaaagaaaaaaaaaaaaataatcaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCAATCGCCTTAG
  5   1   2       bld DMZ                                  xl258e12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGAGGGAGAAGTTGGACAAGATAGGGTTAAATCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGGAGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTAC
  3   1   2       bld Em10      in                    IMAGE:7980417.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAAGGGTTAATCCCCCCGACTGAGAGAGCCATGTGCCAAATATAGCCTCTTACATCCATTGGAGAGGAGAAGGGAGTCCATCTTAGCCAGGGATTTCGGGTATTGGTTGCGAAACAGAATTTTCCTTGCCAAAGGAGGGGCTGAATTTGGTCAAATGGGGCAACATTCCGACCCGAACGAGCAAGGTAACCGCGGAAGAAACATGCTTCTAGGCCACCCAAACAGATTTGTAAAGAATTCAACAGATTTGCTGTCTCAGGACAGATTCCCCCTTGGGGAAACTCCAGACCCAAATCCCTATTCTGGAGCCCTGGGATACAGAAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCCGCCCTGCAGAATTTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCAGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGTAC
  5  -1   2       bld Bla2                            IMAGE:7298017.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAGCTGCCAATGTCACGCTCCTTACATCCCTTGTGAGGGGAGAGGCAGTCCATCTAGCCAGAGATTTCGGGTATGTGTGCGAAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACAtttttttttctaaagaaaaaaaaaaaaataatacaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGTACCCAATCGCCTTAGACTGCTTAA
  3   1   2       bld Bla1      in                    IMAGE:3379759.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCATCTAGCCAGAGATTTGGGGGTATGTGTGCGAACAAGAATTTCCTGCCCAAGCAGCGGCTGAATTCGTCAATCGGCAAACATTCGGACCAGAACGAGCAAGTAACGCGGAAGAACATGCTTCTAGCCACCAAACAGATTTGTAAAGAATTCACAGATNTGCTGTCTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTTTGGAGCNTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACTGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTT
  3   1   2       bld Ga12      in                         XL174m04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAACAGAATTTCCTGCCAAAGCAGCGGCTGAATTTGTCAATCGGCAACATTCCGACCCGAACGAGCAAGTAACGCGGAAGAACATGCTTTATAGCCACCAAACAGATTTGTAAAGAATTCACAGATTTGCTGTNTCAGGACAGATCCCCCTTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGCTGCCTGACCCACTTCAACCTTATATNTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATNTAGAGCATGGNAGNCCAGT
  3   1   2       bld Emb4      in                    IMAGE:4202221.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACCCAGAATTCCCCCCAAAACAGCGGCTGAATTTGCATCGGCAACAATCCGACCCGAACGACCAAGTAACCGGAAAGACAATGCTTCTACCCCCAAACAGATTGGTAAAGAATTCACAGATTTGCTGTTTAGGGACAGATCCCCCTGGGGAACTCCAGACCAAATCCTATTCTGGAGCCTGGGATACAGAGTTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGNCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACATTTTTTTTTCTAAAG
  3   1   2       bld Emb1      in                    IMAGE:3402854.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAACATGTTCTAAGCCCCCCACAGATTTGGTAAGGAATTCACAGATTTGCGGTCCAAGGACAGATCCCCCTTGGGAACTTCAGACCCAAATCCTATTCTGGAGCCTGGAATACAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCACCAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTNTTTACAAAAGACATTTTTTTTTCTAAAGAAAAAAAAAAAAATAATACA
  3   1   2       bld Emb4                            IMAGE:4957379.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATATCTCATGGATTTGGGAGCCCAGCAGTATGTGCGGCTATCACCGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAATAATCCCAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCAGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACATTTTTTTTTTCTAAAGAAAAAAAAAAAAAATAATCCA
  3   1   2       add Em10      in                    IMAGE:7981831.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCATACAGAAAACAGCAAAGGAGGGGATAAAGATGAGAAACACCGAAAGTGACGTCACTTTCGGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATTTAGAGCATGGGAGTCCAGTCTGGTCTTGAACATTGCCCGGTCCTGATGAGGGGATCAATCCACACACGGATTCGGTGGGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACATTTTTTTCCTAAAGAAAAAAAAAAAAATAATACAAAAAAAAAAAAAAATCTATATCTATATATATGTGTCATCGGACTGATTCACCGCCTTTCCTTCCAGCTGTGAATTGTAAGAGGGG
  5   1   2       bld Ga15                               XL468l15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCACTTTCTGCAGCCACCAACTCTTCTCTATTGGTCTCCCGCCCGCTCGAGTGAACAGAACGTGTTTTATGGCTAACCGGGATCTAGAGCATGGGAGTCCAGTCTGGTCTAGAACATTGCCCGGTCCTGATGATGGGATCAATCCACACACGGATTCGGTGTGAACAGGCAATGGAGCTACGAAAGACAGCTGTGTTTTAGTGTTGGAACTTTTTACAAAAGACATTTTTTTTTCTAAAGaaaaaaaaaaaaaataatacaaaaaaaaaa
  5   1   2      en>5                                 Xl3.1-xl325m09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGAAGCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTTATAAAAGACATTTTTTTCTAAAGAAAAAGAAATAATACAAAAAAAAAAAATCTATCTATATATATATATGTGT
                                                  Xl3.1-CHK-1012692266                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTTATAAAAGACATTTTTTTCTAAAGAAAAAGAAATAATACAAAAAAAAAAAATCTATCTATATATATATATGTGTCATCGG
  3   1   2       bld Brn1      in                    IMAGE:6950657.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAACGCCCGTTTTCTGGTTCAGTTTCCCATTTCAAAAGTACAAGGGGACCAGTGCCCGAAAGTCCAAAGAAAGACTGTCCCCGCCCGGAGTGCCTCAAGGTTTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTAAAAACGGGAGGAAGGTCTCTGAGGGAGAAGCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGCCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTATGGAA
  3   1   2       bld DMZ       in                         xl325m09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCGCTGCTGGGGGGAGTACTAAGGAGGGCAAAATCTTAAAACGGAGGAAGGTCTTTGAGGGAGAAGCTAGACAAGATAGGGTTAAACCTGCCGGCAGGAAGACGCAAAGCTGCCAATGTCACGCTCCTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGTTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTATAAA
  3   1   2       bld DMZ       in                         xl288h02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAGGNAGAAGCTAGACAAGATAGGGTTAANCCTGCNGGCAGGAAGACGCAAAGCTGNCAATGTCACGCTCNTCACATCCCTAGTGGAGGGAGAGGCAGTCCATTNGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGNCCCAANCGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTNTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTANCCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCNGATGTTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGT
  3   1   2       bld Ga12      in                         XL179f19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGAAGACGCAAAGCTGCCAATGTCACGCTCNTCACATCCNTAGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTTATAAAAGA
  3   1   2      seed Neu7                                 XL002d14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTTATAAAAGACATTTTTTTCTAAAGAAAAAGAAATA
  3   1   2       bld Ga12      in                         XL199c01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTGGAGGGAGAGGCAGTCCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGC
  3   1   2       bld DMZ       in                         xl267c21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCATTTGGCCAGAGATTTCGGCTACGTGTGCGAAACAGAATTCCCTGCCAAAGCGGCGGCTGAATATGTCAACCGGCAACATTCCGACCCAAACGAGCAAGTAACGCGGAAGAACATGCTTCTCGCCACAAAACAGATTTGTAAAGAATTCACAGATTTGCTGTCTCAGGACAGATCTCCCTTGGGGAACTCCAGACCAAATCCCATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGTTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACT
  3   1   2       bld Emb4      in                    IMAGE:4202568.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCGCNCCAGAATTCCTGCCCAAATGNCCGGTGAATAGTCAACCGCGTACTTCCGACCCCATCGAGCAAGTAACGCGGAAGACATGCTTCTTGCCCCAAACAGTTTGGTAAGGATTCCCAGATTTGCTTCTCAGGCCAGATCTCCCTGAGGGACTCCAGACCAAATCCCATTCTGGAACCTGGAACCAAAGCTGCCTGACCACTTCCACCCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGCCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGNCAATGGAGNCCAAGCAANGACAGCTCNTGTTTTAAGTGTTGGAACTTTTTATAAAAGACATTTTTTTCTAAAGAAAAAGAAATAATACA
  3   1   0       chi Gas8                            IMAGE:3517280.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGCCCCAAAACAAAATTGGAAAGCATTCACCGATTTGGCGGTTCAAGAAAGATTTTCCCTGGGGGACCCCAAAACAAAATCCATTTTGGGAACTGGGAACCCAGAGCTGCCTTAACCCACTCAACCTTAAATCTCATGGGATTTGGGAGCCCAACAGGGGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATA
  5   1   2       bld Ga15      in                       XL496k16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCACGGCGTCCGATTCTGGAACCTGGGATCCAGAGCTGCCTGACCCACTTCAACCTTATATCTCATGGATTTGGGAGCCCAGCAGTGTGTGCAGCTATCACTGCCCTGCAGAATTACCTCACTGAGGCACTCAAAGCAATGGACAAAATGTACCTCAACAACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGTCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACTTTTTATAAAAGACATTTTTTTCTAAAGAAAAAGAAATAATACaaaaaaaaaa
  3   1   2       add Ga12      in                         XL185l09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTCAACCNTATATGTCATGGATNTGGGANCCCAGCAGTGTGTGCAGCTATCNNTGCCNTGCAGAATTACCTCACNGAGGCACTCAAAGCAATGGACAAAANGTACCTCAACNACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACT
  3   1   2       add Ga15      in                       XL496k16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCAAAGCAANGGACAAAANGTNCCTNAACAACAGGCCATACAGACAACAGCAAAGGNGGGGATAAAGANGAAAAACCCCGAAAGNGANGCAACTTTTTGCATTCAACTTTTCNCTATTGGTNTCCCNCCCNCCCGAGNGAACNGAACGNGTTTTTTGGNTAACCGGGATTTAAATCANGGGNGTACNGTTTGGTTTAGNACNTTGTCCNGTCCCTNTGANGGNGTCAATCCCCNCATGGATTTTAACAGAACAGGCAATGGAGCCNAGCAAGACAGCTNTGTTTTAGTGTTGGAACTTTTTATAAAAGACATTTTTTTTTAAAGAAAAAGAAATAATTCAAAAAAAAAAAATCTATCTATATATATATATGTGTCATCGGACTGATTCACCACCTTCCCTTCAGCTGAGATTGTAGAGGCCCAGAGGA
  5   1   2       bld Gas8                            IMAGE:3517072.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACCACAGCCATACAGACAACAGCAAAGGAGGGGATAAAGATGAAAAACACCGAAAGTGATGCAACTTTCTGCATTCAACTCTTCACTATTGGTCTCCCGCCCGCCCGAGTGAACAGAACGTGTTTTCTGGCTAACCGGGATCTAAATCATGGGAGTACAGTCTGGTTTAGAACATTGCCCAGTCCCTCTGATGGTGTCAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACtttttataaaagacatttttttctaaagaaaaagaaataatacaaaaaaaaaaaatctatctatatatatatatGTGTCATCGGGACTGATTCACCACCTTCCCTTCAGCTGAGATTGTAGAGGCCCAGAGGATGGCAGTTATCAGTATTGTGAATAAACTTGAACACAAAATACTTACAGTTCCATGTCATGTCTTCAAGTTGTACCTAccccccatcccccTCTAAAGGTAAAAATGAAACACCTTGAACTTTGGTTTTT
  5   1   2       add Tbd2                            IMAGE:3199712.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTGGTTTAGAACATTGTCCAGTCCCTCTGATTTTTTTAATCCACACATGGATTTTAACAGAACAGGCAATGGAGCCAAGCAAGACAGCTCTGTTTTAGTGTTGGAACtttttataaaagacattttttttctaaagaaaaagaaataatacaaaaaaaaaatctatctatatatatatatGTGTCATCGGACTGATTCACCACCTTCCCTTCAGCTGAGATTGTAGAGGCCCAAAGGATGGCAGGTATCAGTATTGTGAATAAACTTGAACACAAAATACTTACAGTTCCATGTCATGTCTTCAAGTTGTACCTAccccccatcccccTCTAAAGGTAAAAATTAAACACCTTGAACTTTGGTTTTTCGGACATAAGTCGCAGCCAATCTAAAAGGGAATCAGTGTTCATGTATATATTTATTTATGTGTAATTTAATGGGGATTGTAAATATG

In case of problems mail me! (