Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 70%

 1012837623 Xl3.1-IMAGE:8547448.5.5 - 34 ESTs
                                                                       ........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8547448.5.5                                       AGAGCAGACACCTCCAGTTACTCAAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGGGGCAGAAATGATACAATTCCCATCACAGAGACGTCACTTCCGATCATAGCCATCATCAGCGTTGGATTCTCCATTGCGTTTTTCTGTGTACTGGCTATGCTTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATAATTATACGGAGCCTTTATGCAGCGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATCTATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACCGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTTGTCAATAGTCAAATTTGTGAGGTTTTAGAATT
                                                  Xl3.1-CHK-1012722254                                             GACACCTCCAGTTACTCAAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGGGGCAGAAATGATACAATTCCCATCACAGAGACGTCACTTCCGATCATAGCCATCATCAGCGTTGGATTCTCCATTGCGTTTTTCTGTGTACTGGCTATGCTTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATAATTATACGGAGCCTTTATGCAGCGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATCTATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACCGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTTGTCAATAGTCAAATTTGTGAGGTTTTxxAxTxTTCCCA
                                                      consensus depths                                            2     8     5     9    13    13    14    16    15    16    16    16    16    16    17    17    17    17    17    19    17    19    17    19    18    19    20    20    20    20    19    20    20    20    20    20    19    20    20    20    20    20    20    20    20    20    20    21    20    21    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    22    22    21    23    21    26    21    29    21    30    20    31    20    31    16    32    18    32    18    32    10    31    11    31     9    30     8    30     6    30     6    28     9    27     9    26    10    25    12    23    14    23    11    20    12    20    13    16    12    14    12    14    12    14    10    14    10    14    10    14    10    13    10    13    10    14    10    14    10    14    10    14    10    14    10    14    10    14    10    14    10    14    10    14    10    13    10    13    10    13    10    12    10    12    10    12    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    11    11     9    11     9    11     3     6
  5   1   2      en>5                            Xl3.1-IMAGE:8547448.5                                                 CCTCCAGTTACTCAAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGGGGCAGAAATGATACAATTCCCATCACAGAGACGTCACTTCCGATCATAGCCATCATCAGCGTTGGATTCTCCATTGCGTTTTTCTGTGTACTGGCTATGCTTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAGATGTT
  5   1   2      en>5                            Xl3.1-IMAGE:8463730.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGGGAGCAGTGAGGATGTGGCTCGTGTATATGAGGAGTGAGGTAGAGTTCTGGGCAGAAGATACAATCCATCACAGAGAGTCATTCCGATCATAGCATCATCAGCGTCGTGGATTCCCAGCGTTTTCTGTGTACTGGCTATGCCTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATAATTATACGGAGCCTTTATGCAGCGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATCTATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACCGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTTGTCAATAGTCAAATTTGTGAGGTTTTGAATTATTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------A---
                                               BLH OVR      40      38                                       
                                               EST CLI     -40      29                                       
                                               ORF LNG      40       4                                       
  5   1   2      en>5                            Xl3.1-IMAGE:8547448.5                                                 CCTCCAGTTACTCAAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGGGGCAGAAATGATACAATTCCCATCACAGAGACGTCACTTCCGATCATAGCCATCATCAGCGTTGGATTCTCCATTGCGTTTTTCTGTGTACTGGCTATGCTTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAGATGTT
                                                  Xl3.1-CHK-1012689050                                                       GTTACTCAAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGGGGCAGAAATGATACAATTCCCATCACAGAGACGTCACTTCCGATCATAGCCATCATCAGCGTTGGATTCTCCATTGCGTTTTTCTGTGTACTGGCTATGCTTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAGATGTTGTGAGA
  5   1   2       bld Spl                             IMAGE:8460506.5p ATNTNTTCCCAATGCGNNNGAGACCATCGATACGAATTCGTCCCGACACCTCCAGTTACTCAAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCGTGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTANGAGTATCCTGGGGCAGAAATGATACAATTCCATCACAGAGACGTCACTTCCATCATAGCATCATCAGCGTGGATTCTCCATGCGTTTTCTGTGTACTGCATGCTATTCCACGAGAGATCTGGTGA
  5   1   2       bld Spl                             IMAGE:8461670.5p   AAGAACATAGATACGAATTCGTCCCCGCAGCATTCAAGAGCAGACACCTCCAGTTACTCAAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCGTGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTANGAGTATCCTGGGGCAGAAATGATACATTTCCCATCACAGAGACGTCACTTCCGATCATAGCCATCATCAGCGTGGAATTCTCCATTGCG
  5   1   2       bld Spl       in                    IMAGE:8463650.5p            GAGAAACATAAATTCAATTCGTCCTTCAGAGCAGACACCTCCAGTTACTCAAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAAGAGTATCCTGNGGCAGAAATGATACA
  5   1   2       bld Thy                             IMAGE:8547895.5p               CCAGTCCCCAACGGGCAGGTGTAATTTTATTTCAATTTCGTCCCCTCAAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTGTGTGCTTCGCTGTATTATGGAGCGAGTGGAGCGTAGATATCCTGGGGCAGAAATGATACATTCCATCACGAGACGTCACTTCCGATCTAGCCATCATCACGTTGGATTCTCATTGCGTTTTTCTGTGTACTGGC
  5   1   2       bld Thy                             IMAGE:8548473.5p                      CCTATNNNNNGGGGAAACCGAAAGAATCGTCCCCGTTACTCAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGNGGCAGAAATGATACATTCCCATCACAAGAGTCACTTCGATCATAGCATCATCAGCGTGGATTCTCATGCGTTTCTGTGTACTGCTAGCTATCCACGAGAGACTGGTGATCTATGCTCAATCAACCTGAGAGTCTCAGATCTACATGTCACGG
  5   1   2       chi Spl                             IMAGE:8462470.5p                            GAGATCATCGATAAAAATCGTCCCTCCGTTACTCAAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTANGAGTATCCTGGGGCAGAAATGATACAACCNAGGGTACAGCAGAGAAGGATATGGAGCGATACCAGAAGAAGCTCACTAGCACTGTCCCACGTAGCACNGCATCATGCTTGTGTCGACGACTCCACCCTCATCACGCCACCTGCGAGCCACTGCATCCTGTGTA
  5   1   2       bld Spl                             IMAGE:8463019.5p                                   GAAGACCATCAATTGAATTCGTCCCCTCAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCGTGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTANGAGTATCCTGGGGCAGAAATGATACATTTCCATCAAGAGACGTCACTTCGATCTAGCATCTCAGCGTGGATTCTCATGCGTTTTCTGTGACTGCTAGCTATCGCACGAGAGACTGGTGATCTATGCTCAATCCAACCTGAAGGTCTCAGACTTACATGTCACGGAT
  5   1   2      seed Spl       in                    IMAGE:8464078.5p                                     AGACCATCAATAGAATTCGTCCCCTCAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCGTGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGGGGCAGAAATGATACAATTCCCATCACAGAGACGTCACTTCCGATCA
  5   1   2       bld Spl                             IMAGE:8461292.5p                                                  CTCCAGTTACTCAAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTANGAGTATCCTGNGGCAGAATGATACATTCCCATCACAGAACGTCACTTCGATCTAGCATCATCACGTGGATCTCATGCGTTTCTGGACTGCTATGCTATCCACGAAGATTGGGATCATGCTAATCAACTGAAAGCTCAGATTCAATGTCACGACTCGAGATGATCAGAGTGAATACAATACGACTACGTG
  5   1   2       bld Spl       in                    IMAGE:8464431.5p                                                       GNTTACTCAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAAGAGTATTCTGGGGCAAAAATGATACAATCCCATCCAGAGACGTCACTTCCGATCATAGCATCATCAGCGTGGGATTCCCATTGCGTTTTCTGTGAACGGCAATGCTATCC
  5   1   2       bld Thy                             IMAGE:8547448.5p                                                        GTTACTCAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTANGAGTATCCTGNGGCAGAAATGATACAATTCCCATCACAGAGACGTCACTTCCGATCATAGCCATCATCAGCGTTGGAATCTCCATTTGCGTTTTCTGTGTACTGGCTATGCTTATTCGCACGGAGAGGATCTGGGTG
  5   1   2       bld Thy       in                    IMAGE:8550443.5p                                                        TTACTCAAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCGTGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGGGGCAGAAATGATACAATTCCCATCACAGAGACGTCACTTCCGATCATACCATCATCAGCGTTGGATTCTCCATGCGTTTTCTGTGTCTGGCTATGCTATCGCACGAGAGATCTGGTGATCTAGTGCTCAAATCAACCTGAGAGGTCTCAGATTTACAATGTCACGGACTCAGATGATGAGTTCA
  5   1   2       bld Sp1       in                    IMAGE:4964664.5p                                                         TACTCAAAGTGTCGAGTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCGTGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGC
  5   1   2       bld Spl       in                    IMAGE:8463469.5p                                                                     GGAGATGCATAATAGAATTCGTCCCCAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGNGGCAGAAATGATACAATTCCCATCACAGAGACGTCACTTCCGATCATAGCCATCATCAGCGTTGGATTCTCCATTGCGTTTTTCTG
  5   1   2       bld Spl       in                    IMAGE:8464353.5p                                                                       GNGTTTGTGCTAAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGATCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCGTGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTACGAGTTTACTGGGGCAGAAATGATACAATTCCATCACAGAGACGCCGCTTCCGATCATAGCCATCATAGCGTTGATTCCCATTGCGTATTCCGTGTACGGCTACGCCCATTCCACGGAAAGATTTGGTGATTCTA
  5   1   2       bld Spl                             IMAGE:8460834.5p                                                                        GTTTGTGCTACAGAAACATGACAAAAATGGGACCTTCGCTGATCTTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCGTGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGNGGCAGAAAATGATACATTCCCATCACAGAGACGTCACTTCCGATCATAGCATCATCAGCGTTGGATCTCCATGCGTTTTCTGTGTACTGCTATGCTATTCGCACGAGAGATCTGGTGATCAGTGCTCGATTCAACCTGAGAGGTCTCAGATCTACAATGTCACGGNATC
  5   1   2       bld Spl                             IMAGE:8461845.5p                                                                                                                    TTCATCACCCTCTTACTTCTCAACTGCTGTATTCAGGCCAACTCCATAACAGTAAATTGCATTGTGACTCAGGACAAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCGTGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGGGGCAGAAATGATACAATTCCCATCACAGAGACGTCACTTCCGATCATAGCCATCATCAGCGTTGGATTCTCCATTGCGTTTTTCTGTGTACTGGCTATGCTTATTCGCANCGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAACCCTGAGAAGGGTCTCANGATCTTACAAATG
  5   1   2       chi Spl                             IMAGE:8462056.5p                                                                                                                                         AAATTTNNCCATTGCTTCNGGAGAGGACACTAAAAAANNNNNTCCCCTCAGGACAAAGACATGACCTGCATGTGGAACATTGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGAGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTATGAGTATCCTGGGGCAGAAATGATACATTTCCCATCACAGAGACGTCACTTCCGATTATAGCCTTCATCATCGTTGGAATTCTCATTGCGATTTTCTGTGTACTGGCGATGGCTTATCGCACGGAGAGGATCTGGTTGATTCTAGTGCTTCAGATTCCAAACCCTGAGAAGGGTCTTCAGGATCTTAATAGATGTTCGACGGGGACTTCCGGAATGGATTGGGATTCCAAAGATGTTGGAAGAATTGAACATAATTATCTGACCTTTTTCCTCTG
  5   1   2       bld Spl       in                    IMAGE:8463730.5p                                                                                                                                                  ATAATNNNNNCCCTCTGNGNNGNAGATNCATAATAGAATTCGTCCCAAGACATGACCTGCATGTGGAACAAAGATGGACTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACAATTCGGATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGGGGCAGAAATGATACAATTCCCATCACAGAGACGTCACTTCCGATCATAGCCATCATCAGCGTTGGATTCTCCATTGCGTTTTTCTGTGTACTGGCTATGCTTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGGGTCTTCANGATCTTTACAAAAT
  5   1   2       add Spl       in                    IMAGE:8463335.5p                                                                                                                                                                                                  GACNTGACCTGCATGTGGAACAAAGCTCCTTTGTCCTTTGAGAACTACTCCCTGTACTACTGGTACACCTCTTATGGTGTGAAGGCAGCTGCCCCTTGTGCTCACTACCTACAGGAACGTGGGATCAACATAGGCTGCTGGTTCAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGTCTAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCTATTTTGTGTGCCTCCACTGTATTATTGGAACCTGTGAAGCGTATGAGAATCCTGGGGCAAAAATGTACAATTTCCATCATAGAAACTTCATTTCCGATCATAGTCAATATCAGCGTTGGATTCTCCATTGCGTATTTCTGTGAACAGGCAATGCTTAATCGCACTGAGAAGATATCGGTGACTCAATGCCTCAGATTCTAAACCCAGATAAAGGTTTTCAGGA
  5   1   2       bld Spl                             IMAGE:8462639.5p                                                                                                                                                                                                                                                                                                                         GCGGATCCATCGATTCGAATTCGTCCCCTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCATGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGGGGCAGAAATGATACAATTCCCATCACAGAGACGTCACTTCCGATCATAGCCATCATCAGCGTTGGATTCTCCATTGCGTTTTTCTGTGTACTGGCTATGCTTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAGATGTTGTGAAGAGTTTGAACCATATTATACGGAGCCTTTATGCAGCGTTTGCGAGACACAGAATCCCAGTGGTAGAGAACAGAAGCTCCCACCACTAATCACTGGGATTGGACGAGATGACAAATGTCGATTTCCAGAGACTACAGAGCATGCTGCTGCATAACATGCACTAGGGATGGTTGCTT
  5   1   2       bld Spl                             IMAGE:8461236.5p                                                                                                                                                                                                                                                                                                                                                 CAACTCGTCCGCTGTCCGAACCTTTAGTACATTCAATGTGAGATTAAACAGCAGCAAACAGGAGCACAAACAACTGTTTCGAAACCTACAAGACTTAGTCAAGCTGGAGCCTCCTGTTAAGCTGCACGTAGAGAACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCGTGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGGGGCAGAAATGATACAATTCCCATCACAGAGACGTCACTTCCGATCATAGCCATCATCAGCGTTGGATTCTCCATTGCGTTTTTCTGTGTACTGGCTATGCTTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAGATGTTGTGAGAGTTTGACCATATTATACGGAGCTTTATCAGCGTTGCGAGACCAGATGCCCATGTAGAGACAGAAGCTCACCACCTATCACTGGATTGGACGAATGACAAAGTCGATTCCTGAAACTACGATGATGCTGCTGCATAACAGCACTAGGATGGTGCTCTCGCTAACTATAATACTACAACACGCGGCCTATGATAGAGGGGTAGACTGTCTTGA
  5   1   2       chi Spl       ?                     IMAGE:8463209.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTNGAGACACGAGTGACTTGGAACTCCTCCTGAGCTGGGAGCCATCCCGTGGCTTCAGGCTGCTCTGTTTCACTTATCAAGTGAAATATCGCAGCCTGGCCAGTGACTCGTGGACGGTAAAGAATGTCACTAGCACCCAGTTTTCCTTGCCCAGCTATAGCCGTGACAAGCTCTACACATTTCATGTGAGAAGCAAGCTGAGCGATTTGTGTGCCTCCGCTGTATTATGGAGCGAGTGGAGCGTAGGAGTATCCTGGGGCAGAAATGATACAAACCCAAGGGGTACAGCAAGAGAAGGATTATGGAGCGATAACCAGAAGACAGCTACACTAGCACTGTCCCCACCGTAGGCACCGGCATCTACTGCTTTGTTGTCTGAACGACCTTCCCACCCCCTTCATCACCCGGCCCACCCCTGCCGCAAGCACCACCTGCAGTTCAGCATGCATGTACATGAACCAAGGATAAACGGGGCCATAGAGATGCTGCTGGAGATGAAGGACATGGAACAGTGAATGGCACACATGAAAGAGATATTGGCACGCTTGGCCAACCCTCCTCCTTCTCCTCCATAGTGGTTTCTCCTTCTTTCTTTGCAATTTCTTTTTATTGAATTTTATAACAATATTATACATCAATAGATAATTCATTGAGTAAATTGACATGACAATTTCAAAGCGATTTAATTAATAATTGGATAATAATAGAATTATTTAACCATATCAGTACAACA
  5   1   2      en>5                            Xl3.1-IMAGE:8463730.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGGGAGCAGTGAGGATGTGGCTCGTGTATATGAGGAGTGAGGTAGAGTTCTGGGCAGAAGATACAATCCATCACAGAGAGTCATTCCGATCATAGCATCATCAGCGTCGTGGATTCCCAGCGTTTTCTGTGTACTGGCTATGCCTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATAATTATACGGAGCCTTTATGCAGCGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATCTATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACCGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTTGTCAATAGTCAAATTTGTGAGGTTTTGAATTATTC
                                                  Xl3.1-CHK-1012695001                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGTGAGGATGTGGCTCGTGTATATGAGGAGTGAGGTAGAGTTCTGGGCAGAAxxxxCAxxCCATCACAGAxxxxxxTxxCxxTCATAGCTTCATCAGCGTxGxxxxTxCxxxGCGTTTTCTGTGTACTGGCTATGCTTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATAATTATACGGAGCCTTTATGCAGCGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATCTATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACCGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTTGTCAATAGTCAAATTTGTGAGGTTTTGAATTATTCCCACAA
  3   1   2       add Thy       in                    IMAGE:8550443.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGTGGTTTTTATCAGAATTAATGCAGATGTAGAAATTATACCCGTTTTCCGGTTACGGACAGTTAAATTATGAGAGCAGTGGGGTGTGGCTCAGTTATATGGCGATGAGGTGGAGTTTTGGCAGAATGTCATTCCATCACGAGAAGCACTCCGATCTAGCATCATCAGCGTGGATTTTCATAGGTTGTTCAGGTACTGGATATGCTATTCGCACGGAGAGGATCTGGTGATTCTAGTGCCTCAGATTCCAAACCTTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATAATTATACGGAGCCTTTATGCAGCGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTTCTTGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATTAAATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGTTTCTTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTAAACCTCCCTACAGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATAATGGGTCGTTGATTGTCAATAGTCAAATTTGTGAGGTTCGC
  3   1   2       bld Spl       in                    IMAGE:8464078.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCAGGTTGGCGAAGATCATGCACATTTCTCCAGTTGCTGACAGTTAACATCATGAGAGCAGTGACGTTTTGGCTCGTGTATATGAGGAGTGAGGTAGAGATCTGGGCGAAATATACATTCCATCAAGAGACTCACTCCGATCATAGCCTCATCAGCGTGGATTCCCATTGCGTTTTCTGTGTACGGCTATGCTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATAATTATACGGAGCCTTTATGCAGCGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATCTATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACAGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTTGTCAATAGTCAAATTTGTGAGGTTTAGAATTNNNTCANCANTTGACATTTGG
  3   1   2       bld Spl       in                    IMAGE:8463469.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAAGATCATGCACAGTTCTGCAGCTAGCGGCAGTCTCACTTCATGGGAGCAGTGAGGATGTGGCTCGTGTATATGAGGAGTGAGGTAGAGTTCTGGGCAGAATGATCATCCCATCACAGAGAGTCACTTCNATCATAGCTTCATCAGCGTTGATTCTCCATTGCGTTTTCTGTGTACTGGCTATGCTTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATAATTATACGGAGCCTTTATGCAGCGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATCTATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACCGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTTGTCAATAGTCAAATTTGTGAGGTTTTAGAATTTTTCCNCCGAAACTCA
  3   1   2       bld Spl                             IMAGE:8464077.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAGCGTAATATGAGATTATGTCCGTTTTGCAATAGTTATAATTAAATTCTGGAAGCAGTAGGTTTTTCTTCGTTTATTGAGGGTGAGTTAGGTTTTGTGGCAGAATGAACATTCCATCCGAGAAGCAATTCGATCAAGCCATCTCAGCGTTGATCTCCATGCGTTTTTTGTGTACTGGTATGCTTATTTGCACGGAGAGGTACTGGGTGATTCTAGTGCATCAGATTCCTAACCCTGAGAAGGGTCTTCAGGATCTTTACATAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATAATTATACGGAGCCTTTATGCAGCGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATCTATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACAGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTTGTCAATAGTCAAATTTGTGAGGTTTAGA
  3   1   2       bld Spl       in                    IMAGE:8464431.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGTCTTAGATCACGCAGTGAGTAGATCTGCCATTCTGCGTAACGGCAGTTCCTTATGGACAGTAGGATGTTCTCGTTATATGAGGATGAGGTAGGTTCTGGCAGATGTACATCCATACAGAGAGTCACTCGATCATAGCATCTTAGCGTGGATCTCCATGCGTTTTCTGTGTACTGCTATGCTATTCGCACGAGAGGATCTGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATAATTATACGGAGCCTTTATGCAGCGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATCTATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACCGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTTGTCAATAGTCAAATTTGTGAGGTTTTAG
  3   1   2       bld Spl       in                    IMAGE:8463335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTGCCAGTTAGCGGCAGGTCTAAAATATGTGGAGCAGTGAGGATTGTGCTCGTTGTATTGAGCGAGTGAGGTAGAGTTTCCTGGGCAGAATGATCAATCCCATCACGAGACGTCACTCCGATCATAGCATCATCAGCGTGGATTCTCCATTGCGTTTTCTGTGTACTGGCTATGCTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGAGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATAATTATACGGAGCCTTTATGCAGCGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATCTATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACCGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTGTCAATAGTCAAATTTGTGAGGT
  3   1   2      seed Spl       in                    IMAGE:8463730.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGTTCTGCCATATACGGCAGTTCACTTTATGGGAGCAGTGAGGATTTTGCTCGTGTATATGAGGAGTGAGGTAGAGATCTGGGCAGAAGATACAATCCATCACAGAGAGTCATTCCGATCATAGCATCATCAGCGTTGATTCTCCATGCGTTTTTCTGTGTACTGGCTATGCTTATTCGCACGGAGAGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCNTGAGAAGGGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATAATTATACGGAGCCTTTATGCAGCGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATCTATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACCGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTTGTCAATAGTCAAATTTGTGAGGTTTTGAATTATTCCCACAGAAAATCATG
  3   1   2       bld Spl                             IMAGE:8463426.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGTATGCGGACAGTTACCATCATGAGAGCAGTGAGGATTTGGCTCGTGTATATGAGGAGTGAGGTAGAGTTCTGGGGAGAATGATACATTCCATCACAGNACGTCACTCGATCANTAGCATCATCAGCGTGGATTCTCCATTGCGTTTTCTGTGTACTGGCTATGCTTATTCGCACGAGAGGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCNTGAGAAGAGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATAATTATACGGAGCCTTTATGCAGCGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATCTATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACCGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTTGTCAATAGTCAAATTTGTGAGGTTTTGAATTTTTCCCCAGATAATAC
  3   1   2       bld Spl       in                    IMAGE:8464353.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTTTTATAAATGCCCATTGGAAAAATAACCTTTCCCATACGGACATACTTCTGAACAGTGGTTGCTCTCGTTATGGAGGGGGGTAGATTCTGCGAAATAATATCTCTCAAGAGCGCTTCGATACGCCTATGAGGTGGTTTCCCAGGTTTTTTGTGACGGGTGTGTTATCGCGGGAGGTATGGGGGATTATAGGCTTCAGTTCCAACCCGTGAGAAGTTTTTCGGTATCTTTACAAAATGTACGAGGGGGATTTCCGGGAAGGGATGGGAGTTTCCAAAGATGTTGTGAAGAGTTTGACCCATATTTATAGGGAGCTTTTATGCAGTGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACTTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAATTAAAGGGGAATGTGTTTTGTTTTTTTTCCAGCTTAAATATCTATATTATAATTTACCCTTATCTATAAATCAGCTGTTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACAGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTTGTCAATAGTCAAATTTGTGAGGTTTTAG
  3   1   2       bld Spl       in                    IMAGE:8463650.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGTTGCTCGCTGTTTTTGAGGGAGGAGCGAGGAGATCCTGGGCAGAAAGATCCATCCCATCACAGAGAGTCACTCGATCATAGCATCATCAGCGTGGATCTTCATCGCGTTTTCTGTGTACTGGCTATGCTTATTCGCACGGAGAGGATCTGGGGATTCTAGTGCCTCAGATTCCAAACCCTGAGAAGAGTCTTCAGGATCTTTACAAAATGTACGACGGGGACTTCCAGGAATGGATTGGAGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATAATTATACGGAGCCTTTATGCAGCGTTTGCGAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATCTATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACCGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTTGTCAATAGTCAAATTTGTGAGGTTTTGAATTATTCCCACAANAAATATATG
  3   1   2       bld Sp1       in                    IMAGE:4964664.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGACACAGAATGCCCAGTGGTAGAGAACAAGAAGCCTCCACCCACCTAAATCAACTGGGATTTGGGACGGAGATTGAGCAAAATGTTCGATTTTCTCTAGAAAGACGTACAGTATGCAATGGCTGCATGGCAATAAAACAATGGCAACTAAAGGGGAATGTGTTTTGCTTTTCTTCCAGCTTAAATATTAAATATTATAATTTAGCCTTATCTATAAATCAGCTGCTCTGTGCTACTATTATATTGAATTTAGTGTATGGCTGGCTGTATTAAAGGGACCTTGTATTTAGCATTTGTTGCGTTGAAACAATGGCACCTCAATGATGCAAATACACATTTTACAAAGTGCTCACTGTGTACCTCCCTACAGCAAATCACCCCAAAAATACAATTGAGGAAACCGAGGGGAGATTTTACACAGGTGTCAAAATGTTTGTGTCGTTGATTTGTCAATAGTCAAATTTGTGAGGTTTTAGAATTTTTTTTCTACTATGAATAAACTTACAATTTAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)