Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:3402532-IMAGp.5                19 END     1           1        5                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:8541546.3                       8 END     8          10      100                (no blast hit)
     3   2.0    0Xl3.1-xl341n16.5                            5 END     1           1       20                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-IMAGE:8541546.3                       8 PI      88       2139     2916                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012837629 Xl3.1-IMAGE:8820650.3.5 - 73 ESTs
                                                                       ........-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8820650.3.5                                                 ACTGGGTGGTGGTGTGATCAGGTGCACAGAACAGATAAACAGGCTGTGTGGGAGATAAGAGAAACACACACACAGAGGAACCCACTGAAGCACAGCCCTGACACACACACATCTGCCATTCAAGAGATGCACTAAAGTTGCCTGTGATCACTAGTCACACATTGGAGATGCCGAGACCATCCTGAGAGAGAGAAAACAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGCGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTATTCATATGTTAAAGATATCTTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTCCTGGTAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGCGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATGGGAATTGTGCAGATCTGCAAAGGAGAATATTTCTGGCTGGAACCAAAGAACGCCTTTGAGAATTTCCAGGAACCAGACATTGGCCTCATTGCACTAGCCTTTTTGCAGGGATCCTTCGCTTATGGTGGTTGGAACTTCCTTAACTATGTCACAGAAGAACTGGTGGACCCCTACAAGAACTTGCCCCGTGCCATCTTTATCTCTATTCCACTTGTCACCTTTGTGTACGTTTTTGCCAATATTGCCTATGTGACTGCCATGTCCCCCCAGGAACTACTGGCATCCAATGCTGTGGCTGTGACATTTGGTGAGAAGTTGCTAGGTGTTATGGCCTGGATCATGCCAATTTCGGTGGCTCTCTCCACTTTTGGGGGAGTCAATGGATCTCTCTTTACTTCATCCAGATTGTTCTTTGCGGGAGCCAGAGAGGGCCATCTTCCAAGTTTAATGGCAATGATCCACATAAAGCGTTGCACTCCTATTCCAGCACTGCTCTTCACTTGCATCTCCACTCTGCTGATGTTAGTGACCAGTGATATGTACACTCTTATCAATTATGTCGGCTTCATCAATTATCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAACCAGACATTCTTCGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTTGTTTTCAGCTTATGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGATGCCATGACACGAGCTGGTCAAAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAGGCTCTGAGGAAGAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTAACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCTCTGTGTTCCTATTCAGTACTAGTTATTGCACCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTCGAATGAAAAAAAAACGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTTGTCTTTGAATGTAATAAAATGAATCTTGTGCCTTTTTGGTG
                                                  Xl3.1-CHK-1012721799                                                       TGGTGGTGTGATCAGGTGCACAGAACAGATAAACAGGCTGTGTGGGAGATAAGAGAAACACACACACAGAGGAACCCACTGAAGCACAGCCCTGACACACACACATCTGCCATTCAAGAGATGCACTAAAGTTGCCTGTGATCACTAGTCACACATTGGAGATGCCGAGACCATCCTGAGAGAGAGAAAACAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGCGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTATTCATATGTTAAAGATATCTTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTCCTGGTAATATATCCTACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGCGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATGGGAATTGTGCAGATCTGCAAAGGAGAATATTTCTGGCTGGAACCAAAGAACGCCTTTGAGAATTTCCAGGAACCAGACATTGGCCTCATTGCACTAGCCTTTTTGCAGGGATCCTTCGCTTATGGTGGTTGGAACTTCCTTAACTATGTCACAGAAGAACTGGTGGACCCCTACAAGAACTTGCCCCGTGCCATCTTTATCTCTATTCCACTTGTCACCTTTGTGTACGTTTTTGCCAATATTGCCTATGTGACTGCCATGTCCCCCCAGGAACTACTGGCATCCAATGCTGTGGCTGTGACATTTGGTGAGAAGTTGCTAGGTGTTATGGCCTGGATCATGCCAATTTCGGTGGCTCTCTCCACTTTTGGGGGAGTCAATGGATCTCTCTTTACTTCATCCAGATTGTTCTTTGCCGGAGCCAGAGAGGGCCATCTTCCAAGTTTAATGGCAATGATCCACATAAAGCGTTGCACTCCTATTCCAGCACTGCTCTTCACTTGCATCTCCACTCTGCTGATGTTAGTGACCAGTGATATGTACACTCTTATCAATTATGTCGGCTTCATCAATTATCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAACCAGACATTCTTCGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTTGTTTTCAGCTTATGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGATGCCATGACACGAGCTGGTCAAAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAGGCTCTGAGGAAGAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTAACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCTCTGTGTTCCTATTCAGTACTAGTTATTGCACCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTCGAATGAAAAAAAAACGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTTGTCTTTGAATGTAATAAAATGAATCTTGTGCCTTTTTGGTGAAACGT
                                                      consensus depths                                                      6    10     9    14     9    14     9    14     9    14     9    15     9    15     9    15     9    15     9    15    15    16    15    16    14    16    14    17     9    17     9    17     9    17    10    17    10    18    10    18    10    19    10    19    10    19    11    19    11    19    11    19    11    19    11    20    11    20    16    20    18    20    16    20    18    20    19    22    19    22    20    22    20    22    20    22    20    22    20    22    20    22    20    22    20    22    20    22    20    22    20    22    20    21    18    20    20    20    20    20    19    20    21    21    19    20    19    21    18    22    16    22    13    21    17    21    16    20    13    18    11    16    10    14     9    14     9    14     9    14     9    13     9    13     8    13     7    12     7    12     7    12     7    12     5    11     6    10     5     7     5     7     5     6     5     6     6     7     7     8     7     8     7     8     7     8     6     8     7     9     7     9     7     9     7     9     7     9     6     9     7    10     7     9     7     8     8     9     8     9     8     9     8     9     8     9     9    10     9    10     9    11     9    11     9    11     9    11     9    11     8    11     7    12     8    12     6    12     6    12     6    11     6    10     6    10     6    10     6    12     7    12     8    12     8    12    10    13     9    13    10    12    10    12    10    12    11    12    11    12    11    12    11    12    10    12    11    12    13    15    13    15    13    15    13    15    13    15    13    15    14    16    15    17    15    17    15    16    15    16    15    16    15    17    14    15    13    15    11    15    12    16    12    16    13    17    13    16    14    17    13    17    13    16    13    17    13    17    14    17    14    19     9    19     9    19    11    19    11    20    11    20    12    21    12    21    12    21    12    22    12    23    11    23    12    23    11    22    10    21    10    21     9    21     9    22     9    22     9    22     8    21     8    20    10    20    10    20    11    20    11    21    11    21     9    20    11    20    11    20     7    19    12    19    11    20    12    20    13    21    13    21    14    21    14    21    16    24    18    24    18    23    21    23    23    25    23    25    22    25    22    26    22    26    23    25    23    24    23    24    22    24    23    23    22    23    22    23    22    23    22    23    22    23    22    23    22    24    22    24    21    24    21    24    21    24    21    23    20    23    20    23    20    23    20    23    20    23    20    23    21    23    21    23    18    23    19    23    19    23    19    23    19    23    18    23    19    23    18    22    18    21    18    21    17    21    17    20    17    20    15    19    15    18     9    16     6    12     4     5     3     4
  5   1   2       e>1                            Xl3.1-IMAGE:5542437.5                                                   TGGGTGGTGGTGTGATCAGGTGCACAGAACAGATAAACAGGCTGTGTGGGAGATAAGAGAAACACACACACAGAGGAACCCACTGAAGCACAGCCCTGACACACACACATCTGCCATTCAAGAGATGCACTAAAGTTGCCTGTGATCACTAGTCACACATTGGAGATGCCGAGACCATCCTGAGAGAGAGAAAACAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGCGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTATTCATATGTTAAAGATATATTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTTCTGGTAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGCGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATGGGAATTGTGCAGATCTGCAAAGGAGAATATTTCTGGCTGGAACCAAAGAACGCCTTTGAGAATTTCCAGGAACCAGACATTGGCCTCATTGCACTAGCCTTTTTGCAGGGATCCTTCGCTTATGGTGGTTGGAACTTCCTTAACTATGTCACAGAAGAACTGGT
  5   1   2       e>1                            Xl3.1-IMAGE:8820650.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGACTGTGGATAGCAGTCCTGGAAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGCGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATGGGAATTGTGCAGATCTGCAAAGGAGAATATTTCTGGCTGGAACCAAAGAACGCCTTTGAGAATTTCCAGGAACCAGACATTGGCCTCATTGCACTAGCCTTTTTGCAGGGATCCTTCGCTTATGGTGGTTGGAACTTCCTTAACTATGTCACAGAAGAACTGGTGGACCCCTACAAGAACTTGCCCCGTGCCATCTTTATCTCTATTCCACTTGTCACCTTTGTGTACGTTTTTGCCAATATTGCCTATGTGACTGCCATGTCCCCCCAGGAACTACTGGCATCCAATGCTGTTGCTGTGACATTTGGTGAGAAGTTGCTAGGTGTTATGGCCTGGATCATGCCAATTTCTGTGGCTCTCTCCACTTTTGGGGGAGTCAATGGTTCTCTCTTTACTTCATCCAGATTGTTCTTTGCGGGAGCCAGAGAGGGCCATCTTCCAAGTTTAATGGCAATGATCCACATAAAGCGTTGCACTCCTATTCCAGCACTGCTCTTCACTTGCATCTCCACTCTGCTGATGTTAGTGACCAGTGATATGTACACTCTTATCAATTATGTCGGCTTCATCAATTATCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAACCAGACATTCCTCGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTTGTTTTCAGCTTATGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGATGCCATGACACGAGCTGGTCAAAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAGGCTCTGAGGAAGAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTAACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCTCTGTGTTCCTATTCAGTACTAGTTATTGCACCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTCGAATGAAAAAAAAACGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTTGTCTTTGAATGTAATAAAATGAATCTTGTGCCTTTTTG
                                                                   VAR                                                                                                             CGACACCGACACCCACCGAAGCACAGCCCTGACACACACACATCAGCCTTCCCTGCAGGA
                                                                   VAR                                                                                                                                                                                                                         GAGGAGGAGATGCGGAGACCATCCTGAGAGAGGAAGCAGCACCGGATCAGGTGTTGGGAGCAAGGGTGTGTTTATAGCAGTTCCTTTCCCATTGTCTGCTATATTGTCTTGGGGGTCAAGATGGCAGAAGGTGCAAGACTGCGGAATAGTGCGGAGAAGATCCCGGAGGAAAAGGGACAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTGCTATAAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTCAGAGCATTCAGCCATCTCCCTTACCCCTCCATATATTCGCTGTCAAGACCTCAGTATACAGATCTATAAAGATGGAAGGAACTTGTGTGAATGCATATATGTACATATGACAGTGTCTGTCTGTGTGGATACCCCCTGTGTGCCTCTTTGTG
                                                                   SNP                                                                                                                                                                         ---A------C-
                                                                   SNP                                                                                                                                                                                                 -----G------
                                                                   SNP                                                                                                                                                                                                             -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                             -A---T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                         A-------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                     -C---------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----G-----G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---C-A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------T-G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------G--A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------G---G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----G------
                                               BLH ATG     280     638                                                 
                                               BLH MIN     280     232                                                 
                                               BLH MPR     277     232                                                 
                                               BLH OVR     280      19                                                 
                                               CDS MIN     280     232                                                 
                                               EST CLI      -9      15                                                 
                                               ORF LNG     280       4                                                 
  5   1   2       e>1                            Xl3.1-IMAGE:5542437.5                                                   TGGGTGGTGGTGTGATCAGGTGCACAGAACAGATAAACAGGCTGTGTGGGAGATAAGAGAAACACACACACAGAGGAACCCACTGAAGCACAGCCCTGACACACACACATCTGCCATTCAAGAGATGCACTAAAGTTGCCTGTGATCACTAGTCACACATTGGAGATGCCGAGACCATCCTGAGAGAGAGAAAACAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGCGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTATTCATATGTTAAAGATATATTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTTCTGGTAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGCGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATGGGAATTGTGCAGATCTGCAAAGGAGAATATTTCTGGCTGGAACCAAAGAACGCCTTTGAGAATTTCCAGGAACCAGACATTGGCCTCATTGCACTAGCCTTTTTGCAGGGATCCTTCGCTTATGGTGGTTGGAACTTCCTTAACTATGTCACAGAAGAACTGGT
                                                  Xl3.1-CHK-1012689086                                                         GTGGTGTGATCAGGTGCACAGAACAGATAAACAGGCTGTGTGGGAGATAAGAGAAACACACACACAGAGGAACCCACTGAAGCACAGCCCTGACACACACACATCTGCCATTCAAGAGATGCACTAAAGTTGCCTGTGATCACTAGTCACACATTGGAGATGCCGAGACCATCCTGAGAGAGAGAAAACAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGCGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTATTCATATGTTAAAGATATATTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTTCTGGTAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGCGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATGGGAATTGTGCAGATCTGCAAAGGAGAATATTTCTGGCTGGAACCAAAGAACGCCTTTGAGAATTTCCAGGAACCAGACATTGGCCTCATTGCACTAGCCTTTTTGCAGGGATCCTTCGCTTATGGTGGTTGGAACTTCCTTAACTATGTCACAGAAGAACTGGTGGACCC
  5   1   2       bld Tail 5g                         IMAGE:8544127.5p AAAATNTNCCTATTCNANNGGGAGNTACCAAATGAATTCGTCCCGTGGTGTGATCAGGTGCACAGTTGCACAGAACAGATAAACAGCCTGTGTAAGAGATAAGGAaacacacaccgacacccaccgaagcacagccctgacacacacacaTCAGCCTTCCCTGCAGGACAAAAGATGCCCTAAAGTTGCCTGTGATTGCTAGTCACACATTAGAGTGAGGAGGAGATGCGGAGACCATCCTGAGAGAGGAAGCAGCACCGGATCAGGTGTTGGGAGCAAGGGTGTGTTTATAGCAGTTCCTTTCCCATTGTCTGCTATATTGTCTTGGGGGTCAAGATGGCAGAAGGTGCAAGACTGCGGAATAGTGCGGAGAAGATCCCGGAGGAAAAGGGACAGGACTCTGGATCGAGTTCTGGTGAAGCTGGCGGTGTAGCTCTGAAGAAGGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCACTAATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTCGGGGTCACCATCCCAAAATCTGGAGGAGACTATTCATATGTTAAAGATATCTTTGGTGGACTAGCAGGGTTCCTCGACTGTGGATAGCAGTCCTGGTATATATCAACAAATCAAGCAGTATGCCCTGACATCTCCAATACGTCTGCAGCCCTCTCCCTACTGCTTGCACAGATCTGACTCGATGCTGCTGAGCTGTCATGTTCGACTGGGGACTGGCATGTGCCTGCACTCATGAGATGTTCACTG
  5   1   2       bld Int2      out                   IMAGE:8820741.5p             AGATTAACACAAGATCACAAACATACAAATTCGTCCCCTGGGTGGTGGTGTGATCAGGTGCACAGAACAGATAAACAGGCTGTGTGGGAGATAAGAGAaacacacacacagaggaacccactgaagcacagccctgacacacacacaTCTGCCATTCAAGAGATGCACTAAAGTTGCCTGTGATCACTAGTCACACATTGGAGATGCCGAGACCATCCTGAGAGAGAGAAAACAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGCGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTACTCATATGTTAAAGATATATTTGGTGGACTAGCAGGCTCCTCCGACTGTGGATAGCAGTTCTGGTAATATATCCTACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTTTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATGCTGCTGCAGTCTGTCTGTTGTTGTTGACATGGGTGACTGTGCATGTGCGCCTGGGCACACGCGTGCAGACTATTACAGCTGGAAACTTTGGCACTGGACTATCATTATCATGGATTGTACAGATTGGCAAGGAAGATTTTTCTGGCTTGGACA
  5   1   2       bld Tail      out                   IMAGE:8541546.5p                     GNGAGTCACCAAAGAATTCGTCCCGGAGACTGGGTGGTGGTGTGATCAGGTGCACAGAACAGATAAACAGGCTGTGTGGGAGATAAGAGAaacacacacacagaggaacccactgaagcacagccctgacacacacacaTCTGCCATTCAAGAGATGCACTAAAGTTGCCTGTGATCACTAGTCACACATTGGAGATGCCGAGACCATCCTGAGAGAGAGAAAACAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGCGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTACTCATATGTTAAAGATATATTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTTCTGGTAATATATCCTACNAATCAAGCAGTTATTGGCCTGACATTCT
  5   1   2       bld Kid                             IMAGE:7011978.5p                                CCCACGCGTCCGAGGAGACTGGGTGGTGGTGTGATCAGGTGCACAGAACAGATAAACAGGCTGTGTGGGAGATAAGAGAaacacacacacagaggaacccactgaagcacagccctgacacacacacaTCTGCCATTCAAGAGATGCACTAAAGTTGCCTGTGATCACTAGTCACACATTGGAGATGCCGAGACCATCCTGAGAGAGAGAAAACAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGCGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTAGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTACTCATATGTTAAAGATATATTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTTCTGGTAATATATCCTACAAATCAAGCAGTTATTGCCCTGACATTCTCCATTACGTCCTGCAGCCCCTT
  5   1   2       bld Emb4                            IMAGE:5542437.5p                                 GGACGCGTGGGCGGACGCGTGGGTCTGGTGTGATCAGGTGCACAGAACAGATAAACAGGCTGTGTGGGAGATAAGAGAaacacacacacagaggaacccactgaagcacagccctgacacacacacaTCTGCCATTCAAGAGATGCACTAAAGTTGCCTGTGATCACTAGTCACACATTGGAGATGCCGAGACCATCCTGAGAGAGAGAAAACAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGCGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTAGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTACTCATATGTTAAAGATATATTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTTCTGGTAATATATCCTACANATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTTTTTCCTACATGCTTTGCACCAGAGTCCTGGACTTCCAATTGCTGGCTGCAAGCCTGTCCTGTTGCTTGGCGGACATGGGGCGAAACTGGGCCCAGTGGTGCCGCTTGGGCCAACACCCCGTTGGCCGGGACATATTTTTACCGGCCG
  5   1   2       bld DMZ  5x3  out                        xl309m24.5p                                          GTGATCAGGTGCACAGTTGCACAGAACAGATAAACAGCCTGTGTAAGAGATAAGGAAacacacacaccgacaccgacacccaccgaagcacagccctgacacacacacaTCAGCCTTCCCTGCAGGACAAAAGATGCCCTAAAGTTGCCTGTGATCGCTAGTCACACATTGGAGTGAGGAGGAGATGCGGAGACCATCCTGAGAGAGGAAGCAGCACCGGATCAGGTGTTGGGAGCAAGGGTGTGTTTATAGCAGTTCCTTTCCCATTGTCTGCTATATTGTCTTGGGGGTCAAGATGGCAGAAGGTGCAAGACTGCGGAATAGTGCGGAGAAGATCCCGGAGGAAAAGGGACAGGACTCTGGATCGAGTTCTGGTGAAGCTGGCGGTGTAGCTCTGAAGAAGGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCACTAATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTCGGGGTCACCATCCCAAAATCTGGAGGAGACTATTCATATGTTAAAGATATCTTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTCCTGGTAATATATCCCACAANTCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGC
  5   1   2      seed Kid                             IMAGE:7012156.5p                                            AGGAGACTGGGTGGTGGTGTGATCAGGTGCACAGAACAGATAAACAGGCTGTGTGGGAGATAAGAGAaacacacacacagaggaacccactgaagcacagccctgacacacacacaTCTGCCATTCAAGAGATGCACTAAAGTTGCCTGTGATCACTAGTCACACATTGGAGATGCCGAGACCATCCTGAGAGAGAGAAAACAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGCGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTAGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTACTCATATGTTAAAGATATATTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTTCTGGTAATATATCCTACAAATCAAGCAGTTATTGCCCTGACATTCT
  5   1   2       bld Kid                             IMAGE:7009537.5p                                            AGGAGACTGGGTGGTGGTGTGATCAGGTGCACAGAACAGATAAACAGGCTGTGTGGGAGATAAGAGAaacacacacacagaggaacccactgaagcacagccctgacacacacacaTCTGCCATTCAAGAGATGCACTAAAGTTGCCTGTGATCACTAGTCACACATTGGAGATGCCGAGACCATCCTGAGAGAGAGAAAACAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGCGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTAGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTACTCATATGTTAAAGATATATTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTTCTGGTAATATATCCCTACAATCAAGCAGTTATTGCCCN
  5   1   2       bld Kid  5g                IMAGE:4032450-IMAGp.IMAGp                                             GGTGTGATCAGGTGCACAGTTGCACAGAACAGATAAACAGCCTGTGTAAGAGATAAGGAAACACacacaccgacacccaccgaagcacagccctgacacacacacaTCAGCCTTCCCTGCAGGACAAAAGATGCCCTAAAGTTGCCTGTGATCGCTAGTCACACATTGGAGTGAGGAGGAGATGCGGAGACCATCCTGAGAGAGGAAGCAGCACCGGATCAGGTGTTGGGAGCAAGGGTGTGTTTATAGCAGTTCCTTTCCCATTGTCTGCTATATTGTCTTGGGGCTCAAGATGGCAGAAGGTGCAAGACTGCGGAATAGTGCGGAGAAGATCCCGGAGGAAAAGGAACATGACTCTGGGTCGAGTTCTGGTGAAGCTGGCGGTGTGGCTCTGAAGAAGGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCACTAATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTCGGGGTCACCATCCCAAAATCTGGAGGAGACTATTCATATGTTAAAGATATCTTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTCCTGGTAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGGTGAACTGTGCCAGCGTGCGCTGGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATG
  5   1   2       bld Kid                             IMAGE:7009795.5p                                              GAGACTGGGTGGTGGTGTGATCAGGTGCACAGAACAGATAAACAGGCTGTGTGGGAGATAAGAGAaacacacacacagaggaacccactgaagcacagccctgacacacacacaTCTGCCATTCAAGAGATGCACTAAAGTTGCCTGTGATCACTAGTCACACATTGGAGATGCCGAGACCATCCTGAGAGAGAGAAAACAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGCGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTACTCTTACGTTAAAGATATATTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGCATTCAATTTTGGTAATATATCCTACAATCAAGCAGTTATTTGCCTGACTTTCTCCAATTACGTCCTGCGATCCCCCCTACCCAA
  5   1   2       bld Emb4 5g                         IMAGE:4930123.5p                                                    GATCAGGTGCACAGTTGCACAGAACAGATAAACAGCCTGTGTAAGAGATAAGGAAacacacacaccgacacccaccgaagcacagccctgacacacACATCAGCCTTCCCTGCAGGACAAAAGATGCCCTAAAGTTGCCTGTGATCGCTAGTCACACATTGGAGTGAGGAGGAGATGCGGAGACCATCCTGAGAGAGGAAGCAGCACCGGATCAGGTGTTGGGAGCAAGGGTGTGTTTATAGCAGTTCCTTTCCCATTGTCTGCTATATTGTCTTGGGGCTCAAGATGGCAGAAGGTGCAAGACTGCGGAATAGTGCGGAGAAGATCCCGGAGGAAAAGGAACATGACTCTGGGTCGAGTTCTGGTGAAGCTGGCGGTGTGGCTCTGAAGAAGGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCACTAATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTCGGGGTCACCATCCCAAAATCTGGAGGAGACTATTCATATGTTAAAGATATCTTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTCCTGGTAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGGCAGCCCCTCTTCCCTACATGGTTTGCACCCAGAGTCGGGACTTCGAATTGGCTGGCTGGCAGCCTGGCCTAATTGGTGCCTGACCATGGGTGGAAACTGGGGCCAGCCGGGGCCGCCTGGGGCAAACCTCCAAGTGGGCCGGGAACATGGGTTTAACCGCCTTGGGGAAAT
  5   1   2       bld DMZ       out                        xl257i06.5p                                                       TGGTGGTGTGATCAGGTGCACAGAACAGATAAACAGGCTGTGTGGGAGATAAGAGAAACACACACACAGAGGAACCCACTGAAGCACAGCCCTGACACACACACATCTGCCATTCAAGAGATGCACTAAAGTTGCCTGTGATCACTAGTCACACATTGGAGATGCCGAGACCATCCTGAGAGAGAGAAAACAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGTGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTAGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTACTCATATGTTAAAGATATATTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTTCTGGTAATATATCCTACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTT
  5   1   2       bld DMZ       out                        xl226c20.5p                                                       TGGTGGTGTGATCAGGTGCACAGAACAGATAAACAGGCTGTGTGGGAGATAAGAGAAACACACACACAGAGGAACCCACTGAAGCACAGCCCTGACACACACACATCTGCCATTCAAGAGATGCACTAAAGTTGCCTGTGATCACTAGTCACACATTGGAGATGCCGAGACCATCCTGAGAGAGAGAAAACAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGTGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTAGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTACTCATATGTTAAAGATATATTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTTCTGGTAATATATCCTA
  5   1   2       chi Tbd7      in                         XL099c16.5p                                                           CACAGNAACAGNATAAACAGCCTGTGTAAGAGATAAGGAAacacacacaccgacaccgacacccaccgaagcacaGCCCTGACACACACACATCAGCCTTCCCTGCAGGACAAAAGATGCCCTAAAGTTGCCTGTGATCGCTAGTCACACATTGGAGTGAGGAGGAGATGCGGAGACCATCCTGAGAGAGGAAGCAGCACCGGATCAGGTGTTGGGAGCAAGGGTGTGTTTATAGCAGTTCCTTTCCCATTGTCTGCTATATTGTCTTGGGGGTCAAGATGGCAGAAGGTGCAAGACTGCGGAATAGTGCGGAGAAGATCCCGGAGGAAAAGGGACAGGACTCTGGATCGAGTTCTGGTGAAGCTGGCGGTGTAGCTCTGAAGAAGGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGTGTTGCTGACATGGGTGAACTGTGCCAGCGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATGGGAATTGTGCAGATCTGC
  5   1   2       bld Neu7 5g3  in                         XL050o10.5p                                                                                                           GCCGACACCGACACCCACCGAANCACAGCCCTGACACACACACATCAGCCTTCCCTGCAGGACAAAAGATGCCCTAAAGTTGCCTGTGATCGCTAGTCACACATTGGAGTGAGGAGGAGATGCGGAGACCATCCTGAGAGAGGAAGCAGCACCGGATCAGGTGTTGGGAGCAAGGGTGTGTTTATAGCAGTTCCTTTCCCATTGTCTGCTATATTGTCTTGGGGGTCAAGATGGCAGAAGGTGCAAGACTGCGGAATAGTGCGGAGAAGATCCCGGAGGAAAAGGGACAGGACTCTGGATCGAGTTCTGGTGAAGCTGGCGGTGTAGCTCTGAAGAAGGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCACTAATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTCGGGGTCACCATCCCAAAATCTGGAGGAGACTATTCATATGTTAAAGATATCTTTGGTGGACTAG
  5   1   2       add Ga18      in                      xlk114f13ex.5p                                                                                                                                                               CTTCCCTGCAGGACAAAAGATGCCCTAAAGTTGCCTGTGATCGCTAGTCACACATTGGAGTGAGGAGGAGATGCGNNNNNNTCCTGAGAGAGGAAGCAGCACCGGATCAGGTGTTGGGAGCAAGGGTGTGTTTATAGCAGTTCCTTTCCCATTGTCTGCTATATTGTCTTGGGGGTCAAGATGGCAGAAGGTGCAAGACTGCGGAATAGTGCGGAGAAGATCCCNGNNNAAAGGGACAGGACTCTGGATCGAGTTCTGGTGAAGCTGGCGGTGTAGCTCTGAAGAAGGAGATTGGGTTGGTGAGCGCCTGTGGNTTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCACTAATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCANNNNNGGGGGTCACCATCCCAAAATCTGGAGGAGACTATTCATATGTTAAAGATATCTTTTGGTGGACTAGCAGGNNTCCTCCGACTGTGGGATAGCAGTCCTGGTAATATATCCNACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTNNACCAGAGTCTGGACTTCGATTGCTGGCTG
  5   1   2       bld Int2                            IMAGE:8822072.5p                                                                                                                                                                                                            GGGAAGAATAATAACGGGAATGAAACGATTCGAATTCGTCCCAGAACACCGGATCTGGTGTTCACAACAAGGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGGGTCGTAAAGATGGCGGAAGGCGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTAGGAATGGCATTGATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGGGGTCACCATCCCAAAATCTGGAGGAGACTACTCATATGTTAAAGATATATTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTTCTGGTAATATATCCTACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTTTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTGTTGTTGTTGACATGGGTGAACTGTGCCAGTGTGCGCTGGGCAACACGCGTGCAGACATATTTACAGCTGGAAAACTTTTGGCACTGGGACTAATCATTATCATGGGAATTGTACAGATTTGCAAAGGAGAGTATTTCTGGCTGGACCAAAGACGCCTTTGAGAATTTCAGAGCCAGACATTGGCCTTATTGCACTAGCCTTTTACAGGATCTTCGCTTATGTGGTGGACTTCTAACTATGTCACAGAAGACTGTTGACCCTTACAAACTGCCCGTGCATCTTAATCTCTAATTCCACGTTGTTCACTTTGGCGATAGGT
  5   1   2       bld Ga14                               Ga14-p16b7.5p                                                                                                                                                                                                                                                                     GTGTTCCANNATNGGTGTTCATAGCAGATCCTTTCCCATTGTCTGCTACATTATCTTTGCGGTCGTAAAGATGGCGGAAGGCGCAAGATTGCGGAATAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGATCAGGATCGGGTTCTGGGGAAGATGGCGGTGTGGCTCTAAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGANAATGCAGGTTCTGTGGGAATGGCATTGATTGTATGGATTGTAACANGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTAGG
  5   1   2       chi Tbd7      in                         XL052e21.5p                                                                                                                                                                                                                                                                                       AACAGNATAAACAGCCTGTGTAAGGAGATAAGGAAacacacacaccgacaccgacacccaccgaagcacagccctgacacacacacaTCAGCCTTCCCTGCAGGACAAAAGATGCCCTAAAGTTGCCTGTGATCGCTAGTCACACATTGGAGTGAGGAGGAGATGCGGAGACCATCCTGAGAGAGGAAGCAGCACCGGATCAGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCACTAATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTCGGGGTCACCATCCCAAAATCTGGAGGAGACTATTCATATGTTAAAGATATCTTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTCCTGGTAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGCGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCA
  5   1   2       bld Brn1      ?                     IMAGE:6950323.5p                                                                                                                                                                                                                                                                                                                                                                              TGCGGAGAAGATCCCGGAGGAAAAGGGACAGGACTCTGGATCGAGTTCTGGTGAAGCTGGCGGTGTAGCTCTGAAGAAGGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCACTAATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTCGGGGTCACCATCCCAAAATCTGGAGGAGACTATTCATATGTTAAAGATATCTTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTCCTGGTAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGCGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATGGGAATTGTGCAGATCTGCAAAGGAGAATATTTCTGGCTGGAACCAAAGAACGCCTTTGAGAATTTCCAGGAACCAGACATTGGCCTCATTGCACTAGCCTTTTTGCAGGATCCTTCGCTTATGGTGGTTGGACTTTCTACTAGTACGAGACTGTGACCTCAACTCCGGCCTACCTCTGCCTGGCTTCATCTCCACTGTATTTGGN
  5   1   2       add Ga18      in                      xlk136b21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCGCGGCTCTACTGCTAGACACCAGGGANACAAAATTTACTACACTCTGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCACTAATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGNANNNNNGGGGTCACCATCCCAAAATCTGGAGGAGANTATTCATATGTTAAAGATATCTTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTCCTGGNAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTNNACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGCGTNNNNNGGNNAACTCGAGTGCAGGACATGNTTACAGCTNGGAAACTTTTGNNACTGGGNCTAATCATTATC
  5   1   2       bld Int2      in                    IMAGE:8820723.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAAGAAGGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTGGGTAATATTATTGGCTCTGGTATATTCGTATCTCCAAAGGGAGTGATGGAGAATGCAGGTTCTGTGGGAATGGCACTAATTGTATGGATTGTAACAGGAGTAATCACAGCAGTAGGAGCCCTTTGCTATGCAGAGCTCGGGGTCACCATTCCAAAATCTGGAGGAGACTATTCATATGTTAAAGATATCTTTGGTGGACTAGCGGGGTTCCTCCGACTGTGGATAGCAGTCCTGGTAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGTGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATGGGAATTGTGCAGATCTGCAAAGGAGAATATTTCTGGCTGGAACCAAAGAACGCCTTTGAGAATTTCCAGGAACCAGACATTGGCCTCATTGCACTAGCCTTTTTGCAGGGATCCTTCGCTTATGGTGGCTGGAACTTCCTTAACTATGTCACAGAAGAACTGGTGGACCCCTACAGAACTTGCCCCGTGCCATCTTTATCTCTATTCCACTTGTTACCTTTGTGTACGTTTTTGCCACATTGCCTATGTGACTGCCATGTCCCCCAGACTACTGGCATCATGCTGTGCTGTGACATTTGTGAGAGTGCTGTGTATGCTGATCATGCAATTTCCGTTGCTCTCTCCACTTTTGGGGGAGTCATGGATCCTCCTTAACTTCATCGATTGTCTGCGATCGAAGCATTCAGTATGCCATGATCCACACATTCAGCGC
  5   1   2       bld Em10                            IMAGE:7979951.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGGTTCCTCCGACTGTGGATAGCAGTCCTGGTAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGCGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATGGGAATTGTGCAGATCTGCAAAGGAGAATATTTCTGGCTGGAACCAAAGAACGCCTTTGAGAATTTCCAGGAACCAGACATTGGCCTCATTGCACTAGCCTTTTTGCAGGGATCCTTCGCTTATGGTGGTTGGAACTTCCTTAACTATGTCACAGAAGAACTGGTGGACCCCTACAAGAACTTGCCCCGTGCCATCTTTATCTCTATTCCACTTGTCACCTTTGTGTACGTTTTTGCCAATATTGCCTATGTGACTGCCATGTCCCCCCAGGAACTACTGGCATCCAATGCTGTGGCTGTGACATTTGGTGAGAAGTTGCTAGGTGTTATGGCCTGGATCATGCCAATTTCGGTGGCTCTCTCCACTTTTGGGGGAGTCAATGGATCTCTCTTTACTTCATCCGATTGTTCTTTGCCGGAGCAAGAGAGGCCATCTCCCCAGTTTATGGCATGATCACATCAGCGTGCACTCTATCCAGCATGCTCTCATTGCATTCCATCGCGATGTATGACAGGAAAGTCACTCTATATAGGGGCTCTCATACTG
  5   1   2       e>1                            Xl3.1-IMAGE:8820650.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGACTGTGGATAGCAGTCCTGGAAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGCGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATGGGAATTGTGCAGATCTGCAAAGGAGAATATTTCTGGCTGGAACCAAAGAACGCCTTTGAGAATTTCCAGGAACCAGACATTGGCCTCATTGCACTAGCCTTTTTGCAGGGATCCTTCGCTTATGGTGGTTGGAACTTCCTTAACTATGTCACAGAAGAACTGGTGGACCCCTACAAGAACTTGCCCCGTGCCATCTTTATCTCTATTCCACTTGTCACCTTTGTGTACGTTTTTGCCAATATTGCCTATGTGACTGCCATGTCCCCCCAGGAACTACTGGCATCCAATGCTGTTGCTGTGACATTTGGTGAGAAGTTGCTAGGTGTTATGGCCTGGATCATGCCAATTTCTGTGGCTCTCTCCACTTTTGGGGGAGTCAATGGTTCTCTCTTTACTTCATCCAGATTGTTCTTTGCGGGAGCCAGAGAGGGCCATCTTCCAAGTTTAATGGCAATGATCCACATAAAGCGTTGCACTCCTATTCCAGCACTGCTCTTCACTTGCATCTCCACTCTGCTGATGTTAGTGACCAGTGATATGTACACTCTTATCAATTATGTCGGCTTCATCAATTATCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAACCAGACATTCCTCGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTTGTTTTCAGCTTATGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGATGCCATGACACGAGCTGGTCAAAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAGGCTCTGAGGAAGAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTAACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCTCTGTGTTCCTATTCAGTACTAGTTATTGCACCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTCGAATGAAAAAAAAACGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTTGTCTTTGAATGTAATAAAATGAATCTTGTGCCTTTTTG
                                                  Xl3.1-CHK-1012686696                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGATAGCAGTCCTGGAAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGCGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATGGGAATTGTGCAGATCTGCAAAGGAGAATATTTCTGGCTGGAACCAAAGAACGCCTTTGAGAATTTCCAGGAACCAGACATTGGCCTCATTGCACTAGCCTTTTTGCAGGGATCCTTCGCTTATGGTGGTTGGAACTTCCTTAACTATGTCACAGAAGAACTGGTGGACCCCTACAAGAACTTGCCCCGTGCCATCTTTATCTCTATTCCACTTGTCACCTTTGTGTACGTTTTTGCCAATATTGCCTATGTGACTGCCATGTCCCCCCAGGAACTACTGGCATCCAATGCTGTTGCTGTGACATTTGGTGAGAAGTTGCTAGGTGTTATGGCCTGGATCATGCCAATTTCTGTGGCTCTCTCCACTTTTGGGGGAGTCAATGGATCTCTCTTTACTTCATCCAGATTGTTCTTTGCGGGAGCCAGAGAGGGCCATCTTCCAAGTTTAATGGCAATGATCCACATAAAGCGTTGCACTCCTATTCCAGCACTGCTCTTCACTTGCATCTCCACTCTGCTGATGTTAGTGACCAGTGATATGTACACTCTTATCAATTATGTCGGCTTCATCAATTATCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAACCAGACATTCTTCGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTTGTTTTCAGCTTATGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGATGCCATGACACGAGCTGGTCAAAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAGGCTCTGAGGAAGAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTAACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCTCTGTGTTCCTATTCAGTACTAGTTATTGCACCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTCGAATGAAAAAAAAACGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTTGTCTTTGAATGTAATAAAATGAATCTTGTGCCTTTTTGGTGAAA
  5   1   2       bld Spl       in                    IMAGE:8463322.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TNTNTGTTAAAGATATCTTTGGTGGACTAGCAGGGTTCCTCCGACTGTGGATAGCAGTCCTGGAAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGCGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATGGGAATTGTGCAGATCTGCAAAGGAGAATATTTCTGGCTGGAACCAAAGAACGCCTTTGAGAATTTCCAGGAACCAGACATTGGCCTCATTGCACTAGCCTTTTTGCAGGGATCCTTCGCTTATGGTGGTTGGAACTTCCTTAACTATGTCACAGAAGAACTGGTGGACCCCTACAAGAACTTGCCCCGTGCCATCTTTATCTCTATTCCACTTGTCACCTTTGTGTACGTTTTTGCCAATATTGCCTATGTGACTGCCATGTCCCCCCAGGAACTACTGGCATCCAATGCTGTGGCTGTGACATTTGGTGAGAAGTTGCTAGGTGTTATGGCCTGAATCATGCCAATTTCGGTGGCTCTCTCCACTTTTGGGGGAGTCAAGGGATCTCTCTTTACTTCATCCAAATGTTCTATGCTGGAACCAGAGAAGGCCATCTCCCAGTT
  5   1   2       bld Em10                            IMAGE:8318118.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGACTGTGGATAGCAGTCCTGGTAATATATCCAACAAATCAAGCAGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTCCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGCTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGTGCCAGCGTGCGCTGGGCAACTCGAGTGCAGGACATGTTTACAGCTGGAAAACTTTTGGCACTGGGTCTAATCATTATCATGGGAATTGTGCAGATCTGCAAAGGAGAATATTTCTGGCTGGAACCAAAGAACGCCTTTGAGAATTTCCAGGAACCAGACATTGGCCTCATTGCACTAGCCTTTTTGCAGGGATCCTTCGCTTATGGTGGTTGGAACTTCCTTAACTATGTCACAGAAGAACTGGTGGACCCCTACAAGAACTTGCCCCGTGCCATCTTTATCTCTATTCCACTTGTCACCTTTGTGTACGTTTTTGCCAATATTGCCTATGTGACTGCCATGTCCCCCCAGGAACTACTGGCATCCAATGCTGTGGCTGTGACATTTGGTGAGAAGTTGCTAGGTGTTATGGCCTGGATCATGCCAATTTCGGTGGCTCTCTCCACTTTTGGGGGAGTCAATGGATCTCTCTTTACTTCATCCAGATTGTTCTTTGCCGGA
  5   1   2       bld DMZ       out                        xl327f19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGAACCAAAGAACGCCTTTGAGAATTTCCAGGAGCCAGACATTGGCCTTATTGCACTAGCCTTTTTACAGGGATCTTTCGCTTATGGTGGTTGGAACTTCCTTAACTATGTCACAGAAGAACTGGTGAACCCTTACAAAAACTTGCCCCGTGCCATCTTTATCTCTATTCCACTTGTCACCTTTGTGTATGTTTTTGCCAATATTGCCTATGTGACTGCCATGTCCCCCCAGGAACTACTAGCATCCAATGCTGTTGCTGTGACATTTGGTGAGAAGTTGCTAGGTGTTATGGCCTGGATCATGCCAATTTCTGTGGCTCTCTCCACTTTTGGGGGAGTCAATGGTTCTCTCTTTACTTCATCCAGATTGTTCTTTGCGGGAGCCAGAGAGGGCCATCTTCCAAGTTTAATGGCAATGATCCACATAAAGCGTTGCACTCCTATTCCAGCACTGCTCTTCACTTGCATCTCCACTCTGCTGATGTTAGTGACCAGTGATATGTACACGCTTATCAATTATGTCGGCTTCATCAATTATCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAGCCAGACATTCTTCGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCTTGCTTGTTTTCAGCTTGTGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCGATCATGCTGACAGGGGTGCCTGTCTATTTTCTGGGA
  5   1   2       bld Panc                            IMAGE:8738720.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTTTGAGAATTTCCAGGAGCCAGACATTGGCCTTATTGCACTAGCCTTTTTACAGGGATCTTTCGCTTATGGTGGTTGGAACTTCCTTAACTATGTCACAGAAGAACTGGTGAACCCTTACAAAAACTTGCCCCGTGCCATCTTTATCTCTATTCCACTTGTCACCTTTGTGTATGTTTTTGCCAATATTGCCTATGTGACTGCCATGTCCCCCCAGGAACTACTAGCATCCAATGCTGTTGCTGTGACATTTGGTGAGAAGTTGCTAGGTGTTATGGCCTGGATCATGCCAATTTCTGTGGCTCTCTCCACTTTTGGGGGGAGTCAATGGTTCTCTCTTTACTTCATCCAGATTGTTCTTTGCGGGAGCCAGAGAGGGCCATCTTCCAAGTTTAATGGCAATGATCCACATAAAGCGTTGCACTCCTATTCCAGCACTGCTCTTCACTTTGCATCTCCACTTCTGCTGATGGTTAGTGACCAGTGATATGTACACGCTTATCAATTATGTCGGCTCATCAATATCTGTTTTATGGAGTACAGTGGCAGGACGATCGTCCTCGATGGAGAGACCGAACTCTCGGCTATCAGGGATCTGATTTCCAGGATTCACCCATTTTGGCCTCGCTGTACACTTGGACACCTGGTCTGGAATGTCTGGTATTCGACGGTCGTCTAATTCGGGAGGGGCGGGAATACAAAGGTCAATCTGGA
  5   1   2       bld FaB                             IMAGE:8071477.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGGGATCCTTCGCTTATGGTGGTTGGAACTTCCTTAACTATGTCACAGAAGAACTGGTGGACCCCTACAAGAACTTGCCCCGTGCCATCTTTATCTCTATTCCACTTGTCACCTTTGTGTACGTTTTTGCCAATATTGCCTATGTGACTGCCATGTCCCCCCAGGAACTACTGGCATCCAATGCTGTGGCTGTGACATTTGGTGAGAAGTTGCTAGGTGTTATGGCCTGGATCATGCCAATTTCGGTGGCTCTCTCCACTTTTGGGGGAGTCAATGGATCTCTCTTTACTTCATCCAGATTGTTCTTTGCCGGAGCCAGAGAGGGCCATCTCCCAAGTTTAATGGCAATGATCCACATCAAGCGTTGCACTCCTATTCCAGCACTGCTCTTCACTTGCATCTCCACTCTGCTGATGTTAGTGACCAGTGATATGTACACTCTTATCAATTATGTGGGCTTCATCAATTACCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAACCAGACATTCCTCGGCCCATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTTGTTTTCAGCTTATGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAACCCGAGTGTTT
  5  -1   2       bld Emb4                            IMAGE:4970668.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGCCCCGTGCCATCTTTATCTCTATTCCACTTGTCACCTTTGTGTATGTTTTTGCCAATATTGCCTATGTGACTGCCATGTCCCCNCAGGAACTACTAGCATCCAATGCTGTTGCTGTGACATTTGGTGAGAAGTTGCTAGGTGTTATGGCCTGGATCATGCCAATTTCTGTGGCTCTCTCCACTTTTGGGGGAGTCAATGGTTCTCTCTTTACTTCATCCAGATTGTTCTTTGCGGGAGCCAGAGAGGGCCATCTTCCAAGTTTAATGGCAATGATCCACATAAAGCGTTGCACTCCTATTCCAGCACTGCTCTTCACTTGCATCTCCACTCTGCTGATGTTAGTGACCAGTGATATGTACACGCTTATCAATTATGTCGGCTTCATCAATTATCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAGCCAGACATTCTTCGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCTTGCTTGTTTTCAGCTTGTGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCGATCATGCTGACAGGGGTGCCTGTCTATTTTCTGGGAGTGCACTGGCAGAACAAACCAGAGTGTTTTAATAATTTTGTGGATGCCGTGACACGAGCTGGTCAGAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGATACAAGAACTAAATTCACTGTTTATGCTTAACTCA
  5   1   2       bld Ga15      in                       XL430b18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTTTGTGTACGTTTTTGCCAATATTGCCTATGTGACTGCCATGTCCCCCCAGGAACTACTGGCATCCAATGCTGTGGCTGTGACATTTGGTGAGAAGTTGCTAGGTGTTATGGCCTGGATCATGCCAATTTCGGTGGCTCTCTCCACTTTTGGGGGAGTCAATGGATCTCTCTTTACTTCATCCAGATTGTTCTTTGCCGGAGCCAGAGAGGGCCATCTCCCAAGTTTAATGGCAATGATCCACATCAAGCGTTGCACTCCTATTCCAGCACTGCTCTTCACTTGCATCTCCACTCTGCTGATGTTAGTGACCAGTGATATGTACACTCTTATCAATTATGTGGGCTTCATCAATTACCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAACCAGACATTCCTCGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTTGTTTTCAGCTTATGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGATGCCATGACACGAGCTGGTCAAAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGGAANAGACCAAA
  5   1   2       bld Brn1      in                    IMAGE:4740276.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTAGCATCCAATGCTGTTGCTGTGACATTTGGTGAGAAGTTGCTAGGTGTTATGGCCTGGATCATGCCAATTTCTGTGGCTCTCTCCACTTTTGGGGGAGTCAATGGTTCTCTCTTTACTTCATCCAGATTGTTCTTTGCGGGAGCCAGAGAGGGCCATCTTCCAAGTTTAATGGCAATGATCCACATAAAGCGTTGCACTCCTATTCCAGCACTGCTCTTCACTTGCATCTCCACTCTGCTGATGTTAGTGACCAGTGATATGTACACGCTTATCAATTATGTCGGCTTCATCAATTATCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAGCCAGACATTCTTCGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCTTGCTTGTTTTCAGCTTGTGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCGATCATGCTGACAGGGGTGCCTGTCTATTTTCTGGGAGTGCACTGGCAGAACAAACCAGAGTGTTTTAAT
  5   1   2       bld Neu7      out                        XL008o11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGAAGAGCAGTGCTGGAATAGGAGTGCAACGCTTTATGTGGATCATTGCCATTAAACTTGGAAGATGGCCCTCTCTGGCTCCCGCAAAGAACAATCTGGATGAAGTAAAGAGAGAACCATTGACTCCCCCAAAAGTGGAGAGAGCCACAGAAATTGGCATGATCCAGGCCATAACACCTAGCAACTTCTCACCAAATGTCACAGCAACAGCATTGGATGCTAGTAACCAGTGATATGTACACACTTATCAATTATGTCGGCTTCATCAATTATCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAGCCAGACATTCTTCGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCTTGCTTGTTTTCAGCTTGTGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCGATCATGCTGACAGGGGTGCCTGTCTATTTTCTGGGAGTGCACTGGCAGAACAAACCAGAGTGTTTTAATAATTTTGTGGGTGAGTATGGTCTCTACAGTGCTATAAGAAACATATATTGCCACTTACTACTATATTCCA
  3   1   2       bld Tad2                            IMAGE:6872780.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTTTTGCCGGGGACCCCCAGTAGAGGGGCCCCTTTTTCTCACAAGATTTTATATGGGCCAAATGATTCCCCCATCCAAGGGGTTTGCAATCCCTATTCCCAGGCATTGCTATTTAACTTGCAACCTTCCATTCTGCTGATGGTTAGTGACCCAGTGATATGTACATTCTTATCAAATATGTGGGCTTCATCAAATACCGTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCTTACGATGGAAGAAACCAGACATTCCTGGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTTGTTTTCAGCTTATGGTCAGGGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATCTGTGGATGCCATGACACGAGCTGGTCAAAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAGGCTCTGAGGAAGAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTAACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCTCTGTGTTCCTATTCAGTACTAGTTATTGCACCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGC
  5   1   2       bld Int2      in                    IMAGE:8820650.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCTTTGCCGGAGCCAGAGAGGGCCATCTCCCAAGTTTAATGGCAATGATCCACATCAAGCGTTGCACTCCTATTCCAGCACTGCTCTTCACTTGCATCTCCACTCTGCTGATGTTAGTGACCAGTGATATGTACACTCTTATCAATTATGTGGGCTTCATCAATTACCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAACCAGACATTCCTCGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTTGTTTTCAGCTTATGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGATGCCATGACACGAGCTGGTCAAAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAGGCTCTGAGGAAGAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTAACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCCTCTGTGTCCTATTCAGTACTAGTTATTGCACCCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTACATGTGCAGTTTTGTTCGTGCTTGTACTGTGAACTATGTCAGCCACTCTGTGGTGTCAAATTAGCCATGTCTGAAGTCTTCGATGAAAAACGAAGAAATAGCAGCTG
  5   1   2       bld Tbd7      out                        XL092a21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCGTTGCACTCCTATTCCGCACTGCTCTTCACTTGCATCTCCACTCTGCTGATGTTAGTGACCAGTGATATGTACACGCTTATCAATTATGTCGGCTTCATCAATTATCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAGCCAGACATTCTTCGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCTTGCTTGTTTTCAGCTTGTGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCGATCATGCTGACAGGGGTGCCTGTCTATTTTCTGGGAGTGCACTGGCAGAACAAACCAGAGTGTTTTAATAATTTTGTGGATGCCGTGACACGAGCTGGTCAGAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAAGCTCTGAGGAAGAAAGTGGAGCACAGGCCTGAACTCAGAGCATTCAGCCATCTCCCTTACCCCTCCATATATTTGCTGTCAAGACCTCAGTATACAGATCTATAAAGATGGAAGGAACTTGTGTGAATGCATATATGTACATATGACAGTGTCTGTCTGTGTGGATACCCCCTGTGTGCCTCTTTGTGTGTACTG
  5   1   2       bld Tbd7      in                         XL052o06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCTATTNCCAGCACTGCTGCTTCACTTGCATCTCCACTCTGCTGATGTTAGTGACCAGTGATATGTACACTCTTATCAATTATGTGGGCTTCATCAATTACCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAACCAGACATTCCTCGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTTGTTTTCAGCTTATGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGATGCCATGACACGAGCTGGTCAAAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAGGCTCTGAGGAAGAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTAACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGNGCGTNTGTGTGGGTACCCCTGTGC
  5   1   2       bld Tail                            IMAGE:8545839.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTGCTGATGTTAGTGACCAGTGATATGTACACTCTTATCAATTATGTGGGCTTCATCAATTACCTGTTTTATGGAGTAACAGTGGCAGGACAGATCGTCCTACGATGGAAGAAACCAGACATTCCTCGGCCTATCAAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTTGTTTTCAGCTTATGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGATGCCATGACACGAGCTGGTCAAAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGAAGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAGGCTCTGAGGAAGAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTAACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTTGGTACCCCTGTGCGCCCCTCTGTGTTCCTATCAGTACTAGTTATGCACCCTTTCCTCAGTAAACATTCGCCCTTGGACAGTATATGATTGAGTTGAGGTGATATTGTCGTTAATTTCTGTGAGTGGGTTGTTTTGTAAGTTGACTAATTCCCAGTCCGTGTTGAATATTATTTCCTGCTGAAACCTAATAAAAATATCTGCTTCTTCGACACCCGGGGATAGG
  5   1   2       bld Emb4                   IMAGE:5537071-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTTGTTTTCAGCTTATGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGGTGAGTATGGTCTTTACAGTGCTATAAGAAACATGTATTGGCACTTTCCTTTATATTTAAAATTGCTCATCCCAACAGCATACCCAAAGTACATTACATAATTGTTTGTTTTTTCCTCCAACCCCTTAGCATGGTTTAGCTGGAACACTCTATGAATCCTACTAAATATAGCAAGGTTCAGGATAAGTGTCTCTTGAAACGTATTGCTCTGTTATAAATTATATGTTATGTTATAAATGTTATAAAGCTTGAATCCCCACCATAGGTCATAAAAGGACTGTAAAAACAGAAATGCAGTACACCTATTAAAAAGACAGTCCATGTCACACACACAAACATTGACTATTCTTTTCCCAGACttttttttGCCAATGTTTTGCTTCTAAGCCAGGCATTGCACATTGTTCTTAGGAACAAATACATACTTTTTATTTTGATTATGATGTTCTGCCAACTAAGAAGAAAACCACTAAACAAATTACTGTCTAAATAACATTTCCCTATCACCCCATTATGCTCAA
  5   1   2       bld Emb4                            IMAGE:5537071.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAGGTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTTGTTTTCAGCTTATGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGGTGAGTATGGTCTTTACAGTGCTATAAGAAACATGTATTGGCACTTTCCTTTATATTTAAAATTGCTCATCCCAACAGCATACCCAAAGTACATTACATAATTGTTTGTTTTTTCCTCCAACCCCTTAGCATGGTTTAGCTGGAACACTCTATGAATCCTACTAAATATAGCAAGGTTCAGGATAAGTGTCTCTTGAAACGTATTGCTCTGTTATAAATTATATGTTATGTTATAAATGTTATAAAGCTTGAATCCCCACCCATAGGTCATAAAAGGACTGTAAAAACAGAAATGCAGTACACCTATTAAAAAGACAGTCCATGTCACACACACAAACATTGACTATTCTTTTCCCCGACttttttttGCCCAATGGTTTGCTTCTAAGCCAGGCATTGCGCATTGTTCTTAAGGAACCAATACTTCTTTTTATTTTGATTATGAATGGTCCTGCCAACTAAGAAGAAAACCCCTAACAAATTCCTGGTCTAATAAAAATTTCCCTATCACCCCCTTATGTTCCAACAGGTTTAGGGGTGCCCCCAAACACATCTGGCCAGGTTTTCCCCACCATTGGAAAAATTGTATCTCCACGGCTTTGACCTAAGCCCCATCCAGGCATTAAGCCACGTTTCTGCAATCCATCCCCCACAAATGGAAAATAATTTACGCCCGTGGAACAATTTTAATTCTCCTGCTTAGGAGGCCAGGA
  5   1   2       bld Tail      in                    IMAGE:8541943.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGAATCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTTGTTTTCAGCTTATGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGATGCCATGACACGAGCTGGTCAAAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAGGCTCTGAGGAAGAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCTCTGTGTTCCTATTCAGTACTAGTTATTGCACCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTGNAATGaaaaaaaaaaCGAAGAATAGCACTCTGCTCAGCGTGTGGATATATCTGTGTACTGTGATGTGCAGTCTAAGTCTGGCTGCACAATGTATCTCTCTGCCACATCCATATGCACTGTGCTCTGA
  5   1   2       bld Tad2                            IMAGE:6935238.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGTCTGTGGAATTGGCCTTGCAATCATGCTTACTGGGGTGCCTGTCTATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGATGCCATGACACGAGCTGGTCAAAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAGGCTCTGAGGAAGAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTAACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCTCTGTGTTCCTATTCAGTACTAGTTATTGCACCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTCGAATGaaaaaaaaaCGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAAGTCTTGGGCTTGCAGCATATGTATCCTTCCTCCGTGCCCAACCCT
  5   1   2       bld Tad2                            IMAGE:6935210.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCTGTGGAATTGGCCTTGCGATCATGCTGACAGGGGTGCCTGTCTATTTTCTGGGAGTGCACTGGCAGAACAAACCAGAGTGTTTTAATAATTTTGTGGATGCCGTGACACGAGCTGGTCAGAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAAGCTCTGAGGAAGAAAGTGGAGCACAGGCCTGAACTCAGAGCATTCAGCCATCTCCCTTACCCCTCCATATATTCGCTGTCAAGACCTCAGTATACAGATCTATAAAGATGGAAGGAACTTGTGTGAATGCATATATGTACATATGACAGTGTCTGTCTGTGTGGATACCCCCTGTGTGCCTCTTTGTGTGTACTGGTTATTGCACCATCTTCCTCAGTATACCATGTGCCCCTAATACACGTAGGTGTATAATTGTCTGTTTCAGTTACATGTGCAGTTTTGTCTGTACTTTGTACTGTTGGACTTTGTATGTCAGccccccccTGTGGGTGCCATAATTTAGCATTGCCTGCCTTTCTTGGGAAAGAAGGAAAGACGAATGAAATAACCAGCCTCTGGCTCAAGCAAAATTGGCAAAATTGTCCTTTTGTGCCTTTGTTAAATGGGGCCAAATTCTGAAGGCTCTTGGGCTTTGGCTGCATAATATTATCCATCCCCTCC
  5   1   2       bld Tbd1                                 AW871751.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTTCCTGGGAGTGTACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGATGCCATGACACGAGCTGGTCAAAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAGGCTCTGAGGAAGAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTAACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCTCTGTGTTCCTATTCAGTACTAGTTATTGCACCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGA
  5   1   2       bld Kid                             IMAGE:7010035.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACTGGCAGAACAAACCCGAGTGTTTTAATAAATTTGTGGATGCCATGACACGAGCTGGTCAAAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAGGCTCTGAGGAAGAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTAACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCTCTGTGTTCCTATTCAGTACTAGTTATTGCACCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTCGAATGaaaaaaaaaCGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAATCATTTTGAATGTAAAGACTGCAGAACTATGGAATN
  5   1   2       bld Neu7                                 XL049f12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACGAGCTGGTCAGAAGCTATGTGTGGTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAAGCTCTGAGGAAGAAAGTGGAGCACAGGCCTGAACTCAGAGCATTCAGCCATCTCCCTTACCCCTCCATATATTCGCTGTCAAGACCTCAGTATACAGATCTATAAAGATGGAAGGAACTTGTGTGAATGCATATATGTACATATGACAGTGTCTGTCTGTGTGGATACCCCGTGTGCCTCTTTGTGTGTACTGGTTATTGCACCATCTTCCTCAGTATACCATGTGCCCTAATAC
  5   1   2       bld DMZ       out                        xl318k22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTGTCTACCCTCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAAGCTCTGAGGAAGAAAGTGGAGCACAGGCCTGAACTCAGAGCATTCAGCCATCTCCCTTACCCCTCCATATATTCGCTGTCAAGACCTCAGTATACAGATCTATAAAGATGGAAGGAACTTGTGTGAATGCATATATGTACATATGACAGTGTCTGTCTGTGTGGATACCCCCTGTGTGCCTCTTTGTGTGTACTGGTTATTGCACCATCTTCCTCAGTATACCATGTGCCCTAATACACGTAGGTGTATAATTGTCTGTTTCAGTTACATGTGCAGTTTTGTCTGTACTTTGTACTGTTGGACTTTGTATGTCAGCCACCCCTGTGGTGCCATAATTAGCAGTGCCTGCTTTCTTGGAAAGAAGAAAGACGATGAAATAGCAGCTCTGCTCAGCAACATGGCATATTGTCTTTGTGCTTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCTGCATATATATCTCCCTCCTGCCCACCCATCCCTATATTGGCAACAGGTTGCTCCTTGAGGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTGTTATTTGAACTTTGCCAGATCCTATATTTCACAAAACCATGGATTGTGTATCATTTGGCTGCTCCACACT
  5   1   2       bld Neu7                                 XL009c09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAATAAANATGAAGATGTGAGTGAAGAGACCAANGAGCAGAGGGCGCCAATCTATAAACCAAGCTCTGAGGAAGAAAGTGGAGCACAGGCCTGAACTCAGAGCATTCAGCCATCTNCCTTACCCCTCCATATATTCGCTGTCAAGACCTCAGTATACAGATCTATAAAGATGGAAGGAACTTGTGTGAATGCATATATGTACATATGACAGTGTCTGTCTGTGTGGATACCCCGTGTGCCTCTTTGTGTGTACTGGTTATTGCACCATCTTCCTCAGTATACCATGTGCCCTAATACACGTAGGTGTATAATTGTCTGTTTCAGTTACATGTGCA
  5   1   2       bld Sp1                             IMAGE:5513001.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCGCCAATCTATAAACCAGGCTCTGAGGAAGAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTAACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCTCTGTGTTCCTATTCAGTACTAGTTATTGCACCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTCGAATGaaaaaaaaaCGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGCCTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTACAAGACAAACATGCTTTCTCTGCTGAAATATCTTGTGAAGCACA
  5   1   2       bld Tail                            IMAGE:8545484.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCTGAGGAAAAAGTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTAACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCTCTGTGTTCCTATTCAGTACTAGTTATTGCACCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTCGAATGaaaaaaaaaCGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGG
  3   1   2       bld Ga18      in                      xlk136b21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AANNGGNNNNNCATGCCNGNNNNCNGNNNNATTAGCCNTCTNCCCTTNNCCNCNTNCCCCANNNNNNNCTNNCAAGNCNNNNANNNTACAGATCTGCAAAGATGGNANGNACTTGTGTGAATGCANAAATGTGCATATGAAAGTGTGCGTCTGTGTGGNANCCCTGTGNGCCCCTCTGTGTTNCCTATTCAGTACTAGNTATTGCACCCTCNTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTCGAATGAAAAAAAAACGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTNNNNNNCAGCATATGTATCTTCCTCCTGNCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTTGTCTTTGAATGTAATAAAATGA
  5   1   2       bld Neu7      in                         XL012e24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGGAGCACATGCCTGAACTCAGGAGCATTTAGCCATCTCCCTTACCCCCTCCCCATGCACCCGCTGTCAAGACCTCAGTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCTCTGTGTTCCTATTCAGTACTAGTTATTGCACCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTGGAATGaaaaaaaaaaCGAAGAAATAGCAACTCTGCTCAGCG
  5   1   2       chi Eye1      in                    IMAGE:6957725.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCGGATATGCACCCGCTGTCAGACCTAGCTGTACAGATCTGCAAAGATGGAAGGAACTTGTGTGAATGCATAAATGTGCATATGAAAGTGTGCGTCTGTGTGGGTACCCCTGTGCGCCCCTCTGTGTTCCTATTCAGTACTAGTTATTGCACCCTCGTCCTCAGTATAACATTTGCCCCTTGGACATGTAATATGATTTGAAGTTGTAGGTGTATAGTTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTCGAATGaaaaaaaaaCGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTTACAAAATCATGGGATTGTGTATCATTTGGCTGCTCTAAACTGCCTGTTTAAGAATCTCCCAACACAAACTGGGCTGAATGGACTTGGGCTATCACCACGAAAATCTTGTTAAAAGGGACAAAAAATGGCTTCCCCTTGGCTGAAAAAATTTCCCTGGGGAAAAGCACACGGGGGACTTTAATGGCATGGGTTTCTTTACCGCCCAGTGGGAAAAAATTTTGTTTGCCCAGCCAACCTCCCAAGTGGAAGTCCCCCGGGTGCttttttttttCAAATCCAAAATAACTGTTTTCCCCACTTTGAGCTGACACCCCAGGGTTACCTTTCGGGGGATTTTTTTAAAACACCGCGCCCCC
  3   1   2       bld Tail      in                    IMAGE:8541943.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGCATTTTCCTTTACCCTCCCCATGACCCCGGTCAAACTCAGTAGATTGCAAGTGAGACTGGTGATGCTAATGGCATGGAGTTGCGTCTGTTGGGTACCTGGCGCCCCTCTGTGTTCTATCAGTACTAGTATTGCACCCTCGTCTCAGTTACATTTGCCCTGACATGTAATATGATTGAAGTGTAGGTGTATAGTGTCTGTATCAGTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTGGAATGAAAAAAAAAAACGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTTGTCTTGAAGTAATAAAATGAATCCCGCCTTTA
  3   1   2       bld Int2      in                    IMAGE:8820723.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCATAGCACCCCGGTTCAAGTCTAGTCAGATGCAGTTGAGACTGTGAATGCAATGGCATTGAAGTGGTAACCTGTGCACCGTCTGGTTCCTATCAGTACTAGTATGCACCTCTCTCAGTATACATTGCCCTGACATGTAATATAATTGAGTGTAGTGTATAGTGTCTGTTATCAGTTACATGTGCAGTTTGTCTGTGCTTTGTACTGTTGGACTTTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGCTGTCTTGGAATGAAAAAAGACGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTTTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGCTGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGATTTAATGCATGGTTCTTACTTCAAGTGGAAAAGTGTGACGCCAGCACACTCTAGTGTAGTCTCAGGTTTTTCTTTACCAATCAAATACTTTTCCCTACTTGACTGACCCAGGTTAATTCAGGGTATTTTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTTTGGGACCCTCAAGTCCTTTAGTATTGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTTGTCCACCACAAAGCAACAAAGAC
  3   1   2       bld Int2      in                    IMAGE:8820650.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGATGAGACTGGTGGGATGCATAATTGGCATTGGAGTGGCTCGGTGGTACCTGGCGCCCCCTCTGGTCCTATCAGTACTAGTATGCACCCTCGTCCTCCAGTATACATTTGCCCCTTGACATGTATATGATTTGAAGTGTAGTGTATAGTGTCTGTATCAGTTACATGTGCAGTTTTGTCTGTGCTTTGTACTGTTGGACATTAATGTCAGCCACTCCTGTGGTGTCATAATTAGCAGTGTCTGATGTCTTCGAATGAAAAAAAAACGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTTTGTCTTTGGAATTAAATTCCACAGATC
  3   1   2       bld Eye1      in                    IMAGE:6957725.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTCCAGTAAAACATTTTCCCCCCTGGGCCATGGAAATATGATTTGAAATTTGTAGGGTGTAAAGTTGTCCTGTTTCAGTTAACATGTGCCAGTTTTGTCGGTGCTTTGTACTGTTGGACATTAATGTCAGCCATTCCGGTGGTGTCATAATTAGCAGTGTCTGATGTTTTCGAATGAAAAAAAAACGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTGTCGTATGAATGTAATAAAATGAATCCTG
  3   1   2       bld Ga18      in                      xlk114f13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCTNGNCNNCAGNNNNACATTTNCCCNNGANNNNNATATGATTTGANNTNGTAGNNNNANANNNNCTGTATCANTTACNATGTGCANTTTTGTCTGTGCTTTGTNCTNTTGGACATTAATNTCAGCNACTCCTGTGGTGTCATNATTAGCAGTGTCTGATGTCTNCGAATGAAAAAAAAAACGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATNNNATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTNNNNNNCAGCATATGTATCTTCCTCCTGNCCACCCATCCCAATATTGNCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGNNNNNNNCTTTGAANGTA
  3   1   2       bld Ga15      in                       XL430b18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTGTACTGTTGGNCATTAATGTCAGCCACTCCTGNGGTGTCATAATTAGCAGTGTCTGATGTNTTCGAATGAAAAAAAAACGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTTGTCTTGAAG
  3   1   2       bld Spl       in                    IMAGE:8463322.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAAAAAACGAAGAATAGCAACTTGCTCAGCGTGTGGAATATTATCTGTGTACTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTTGTCCCGAAGTAAGCACAGATCT
  3   1   2       bld Tbd7      in                         XL052e21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACGAAGAAATAGCAACTCTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCANAGCTGCGNTNNACTGTANAGTTCTGGGNCCCTCAGAGTCCTTTAGNACCGANTNNACACACTCCAGAAATGCTGGATGATTTCCAG
  3   1   2       bld Tbd7      in                         XL052o06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAATAGCAACTCTGGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTT
  3   1   2      seed Neu7 5g3  in                         XL050o10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGCTCAGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTT
  3   1   2       bld Neu7      in                         XL012e24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCGTTGTGGAATATTATCTGTGTACCTTGTGAATGTGCAGATCTGAGGTCTTGGCTTGCAGCATATGTATCTTCCCTCCTGCCCACCCATTCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTGTNTTNAA
  3   1   2       bld Neu7                                 XL039e15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCNTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGAANCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGCATATATATATTTTTNATTTAGGCATTTTGTCTTNCAATGTAATAAAA
  3   1   2       bld Tbd7                                 XL069h21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTCTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATANGAATATATATATTTTTTATT
  5   1   2       bld Tad1                            IMAGE:6878215.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGCTTGCAGCATATGTATCTTCCTCCTGCCCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGttttatatgatatatatattttttatttaggattttGTCTTTGAATGTAATAAAATGAATCTTGTGCCCnnnnnnnnannnannnannnaNAACATGTC
  3   1   2       bld Tbd7      in                         XL099c16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACCAATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCNAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTNTACATGTTTTATATGCATATATATATTTTTTATTTAGGATTTTGTGCGTTGNAATGTAATAAAATG
  3   1   2       bld Unk4                                 AGL_4G08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACCCATCCCAATATTGGCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAAGGCATGGTTCTTACTGCAAGTGGAAAAGTGTAATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTTGTCTTTGAATGTAATAAAATGAATCTTGTGCCTTTTTGGTGAAACGTC
  5   1   2       bld Ga15      in                       XL433o07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGttttatatgatatatatattttttatttaggattttGTCTTTGAATGTAATAAAATGAATCTTGTGCCTTTTTGGTGAAACGTCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL433o07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAACATGTTGCTCCTTGAAGGTTACAAATCATTTGAAATGTAAAAGACTGCAGAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATGATTTCCAGAATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTTGTCTTGAAT
  3   1   2       bld Tbd7      out                        XL105d08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAAATGTAAAAAGACTACAGNAACCTATGGAACTTGTATTTTATTATTTGAACAATGCCAGATCCTATATTTCACAAAATCATGGATTGTGTATCATTTGGCTGCTCTACACTGCCTGTTTAACTATCTCCAACACAGACTGTGCTGATGGAGCTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGTGAAAGCAACAGGGACTTTAATGCATGGTTCTTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTACTTGACTGACCCAGGTTACTTCAGGGTATTCTTAGACCTGCCTCCAATCCAAAGCTGCGATTAACTGTAAAGTTCTGGGACCCTCAAGTCCTTTAGTACCGAATTAACACACTCCAGAAATGCTGGATATTTCCAGAATGCTCTACATGTTTTATA
  3   1   2       bld Ga15      out                      XL431b18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATGGAGNTGGGCTATCACCAGACAATCATGTAACAGGACAAACATGCTTCTCTTGCTGAAGATTTCCTGNGAAAGCAACAGGGACTTTAATGCATGGTTCNTACTGCAAGTGGAAAAGTGTGATGCCAGCACACTTTAGNGTAGTCTCAGGTCTTTCTTTACCAATCAAATACTTTTTCCTANTTGACTGNCCCAGGTTACTTCAGGGTATTNTTAGNCCTGCCTCCAATCCAAAGCTGCGATTANCNGTAAAGTTCTGGGACCCTCAAGTCCTT
  3   1   2       bld Brn1      in                    IMAGE:4740276.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGGCTATCACCAGACAATCATGTAATCTGCACAGGACAAACACGCTTCTATTGCTGAAGATTTCCTGTGAAAGCAACAGGGTAATGCATGGTTCCTATCGCAAGTGAAAAAGTGTGATGCCAGCACACTCTAGTGTAGTCTCAGGTCTTTACCAATCAAATACTTTACCCCACCCCCTACCTGACTGAACCAGGTTACTTCAGGGTATTCTCAGTCCAACCCAAAGCTGCGATTAACTGTAATGTTCTGGGATCATCCAGTCCCTTAGTACCGAATTAACACACTCCAGAAATTCTGGGTAATTTCCAGGATGCTCTACATGTTTTATATGATATATATATTTTTTATTTAGGATTTTGTCTTTGAATGTAATAAAATTAATTTTGTGCCTTTTTGGTGAAACATCAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)