Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8534444.5                       7 END     2           4       28                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8534444.5                       7 PI      90        786     1357                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:4740878.5                       2 PI      92       1361     1484                (no blast hit)

 This cluster: approximate FL confidence score = 91%

 1012837639 Xl3.1-IMAGE:6639712.5.5 - 44 ESTs
                                                                       -50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6639712.5.5                                                   CCTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATTTCTCGTGTGGCGGGGGCAATCACTACACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAGTTTAATGAAATGTATCTGGATACAGTGTGTCTTAATATGGTGCAGGATCCTATCCAGTTTGATGTGCTTGTCATGCCAAACCTCTACGGTGACATCTTGAGTGATCTTTGCGCAGGTCTAATTGGAGGCCTGGGAGTGACACCTAGTGGAAATATCGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTTATGGCACAGCCCCAGATATTGCTGGAAAAGACTTTGCCAACCCCACTGCTCTTCTTCTAAGTGCAGTCATGATGCTGCGGCACATGGGTCTCCACGAGTATGGACGCAAAATAGAAAGTGCCTGCTTTGAGACCATAAAATCTGGCAAGGTTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGCCGCAGAATACAGGACAGTGATTAGCATTGTAGCTCTTCAGTAACTTCTGTCAGAACGGTGAACTGACTTGACAAGCACATAACTTCCTGCTGTCTTTATCATGCTTCAGTGCTTCATCTTCTTCACAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACTCTGTGTGTATAGGCTTCTCTGGCAGTGAAAGATTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTAAATTGCAACCTATCAAATTGCTGCATTCATTTCCTACTTGCAGCAGACATTAAAAAGCTAATCACTGATTAGTTGCTATAGGTAACTGCCCATGAGCAAATTTGCCCAGTGTTGATAAATGAGCCCCACTGAATCTGCTGTATTTAAGAGACTTTAGTTTTGGCACAAGATAGGAATGAATATCCAGGGATATTAATTTGTATAACCAAACAAGTCCTACCATTGTATAACATTACTACTGTGCCAATAGATGGTTTGTATCACTACTGCAGTTATAATATTGGCTGCTTACAGCTCCGCTCTCTTTATATGAGGTCTTTCATTGGTTGCTCATTAACTGATCCACCTGCAGAAGGTGCTGCTACAGCAGTATGCCAGAGTCTGAAATAATTGTTATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAATTTGTATTTATTTATAACTTCACTCCATTCTTCCAGTGTTTGGAGGTACTATTCTTTTTTTTTTTTTTTTTTTCTTTCTGATTATGCACTTTTTTGTTTTGCATTTTCATTAAATGTGTGTTCAAAGAGACATTTGGATGTCAAAAACCTGGTGCAGATAAAATGTTTTGTTATGGTAAAAATTATTGTTTGGTGACAGC
                                                  Xl3.1-CHK-1012722715                                                         TGAACATGGCTGGCAGCGCCTGGAGGTCACTGATTTCTCGTGTGGCGGGGGCAATCACTGCACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAGTTTAATGAAATGTATCTGGATACAGTGTGTCTTAATATGGTGCAGGATCCTATCCAGTTTGATGTGCTTGTCATGCCAAACCTCTACGGTGACATCTTGAGTGATCTTTGCGCAGGTCTAATTGGAGGCCTGGGAGTGACACCTAGTGGAAATATCGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTTATGGCACAGCCCCAGATATTGCTGGAAAAGACTTTGCCAACCCCACTGCTCTTCTTCTAAGTGCAGTCATGATGCTGCGGCACATGGGTCTCCACGAGTATGGACGCAAAATAGAAAGTGCCTGCTTTGAGACCATAAAATCTGGCAAGGTTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGCCGCAGAATACAGGACAGTGATTAGCATTGTAGCTCTTCAGTAACTTCTGTCAGAACGGTGAACTGACTTGACAAGCACATAACTTCCTGCTGTCTTTATCATGCTTCAGTGCTTCATCTTCTTCACAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACTCTGTGTGTATAGGCTTCTCTGGCAGTGAAAGATTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTAAATTGCAACCTATCAAATTGCTGCATTCATTTCCTACTTGCAGCAGACATTAAAAAGCTAATCACTGATTAGTTGCTATAGGTAACTGCCCATGAGCAAATTTGCCCAGTGTTGATAAATGAGCCCCACTGAATCTGCTGTATTTAAGAGACTTTAGTTTTGGCACAAGATAGGAATGAATATCCAGGGATATTAATTTGTATAACCAAACAAGTCCTACCATTGTATAACATTACTACTGTGCCAATAGATGGTTTGTATCACTACTGCAGTTATAATATTGGCTGCTTACAGCTCCGCTCTCTTTATATGAGGTCTTTCATTGGTTGCTCATTAACTGATCCACCTGCAGAAGGTGCTGCTACAGCAGTATGCCAGAGTCTGAAATAATTGTTATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAATTTGTATTTATTTATAACTTCACTCCATTCTTCCAGTGTTTGGAGGTACTATTCTTTTTTTTTTTTTTTTTTTCTTTCTGATTATGCACTTTTTTGTTTTGCATTTTCATTAAATGTGTGTTCAAAGAGACATTTGGATGTCAAAAACCTGGTGCAGATAAAATGTTTTGTTATGGTAAAAATTATTGTTTGGTxACAGCCCATAA
                                                      consensus depths                                                        5     8     8    11    12    16    14    18    23    25    22    25    20    26    25    26    25    26    25    26    25    26    24    25    25    25    25    25    25    25    25    25    25    25    23    24    24    24    23    25    24    25    24    24    22    24    24    25    24    25    25    25    19    25    24    25    23    25    25    25    25    25    25    25    25    25    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    23    23    23    23    23    23    22    22    20    21    19    22    16    22    19    22    18    21    18    21    16    21    14    21    14    20    11    18    12    17    11    17    10    16     8    16     8    15     7    14     6    10     4     9     3     8     3     8     3     7     3     5     3     5     3     5     3     5     3     5     2     5     3     5     2     4     2     4     1     3     1     3     1     3     1     2     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     6     4     6     4     6     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     8     4     8     5     9     6    11     7    11     6    11     6    11     5    11     6    11     6    11     6    11     5    11     5    11     5    11     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     9    10     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    11    10    11    10    11    10    11     9    11     8    11     8    11     8    11     6    11     7    10     4    10     6    10     6    10     6    10     6    10     6    10     6    10     6     9     6     9     5     8     3     8
  5   1   2      ests                            Xl3.1-IMAGE:6639712.5                                                 ATCCTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATTTCTCGTGTGGCGGGGGCAATCACTGCACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAGTTTAATGAAATGTATCTGGATACAGTGTGTCTTAATATGGTGCAGGATCCTATCCAGTTTGATGTGCTTGTCATGCCAAACCTCTACGGTGACATCTTGAGTGATCTTTGCGCAGGTCTAATTGGAGGCCTGGGAGTGACACCTAGTGGAAATATCGGTGCTAATGGGGTAGCAATCTTTGAATC
  5   1   2      ests                            Xl3.1-IMAGE:6324220.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGAGTATGGACGCAAAATAGAAAGTGCCTGCTTTGAGACCATAAAATCTGGCAAGGTTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGCCGCAGAATACAGGACAGTGATTAGCATTGTAGCTCTTCAGTAACTTCTGTCAGAACGGTGAACTGACTTGACAAGCACATAACTTCCTGCTGTCTTTATCATGCTTCAGTGCTTCATCTTCTTCACAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACTCTGTGTGTATAGGCTTCTCTGGCAGTGAAAGATTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTAAATTGCAACCTATCAAATTGCTGCATTCATTTCCTACTTGCAGCAGACATTAAAAAGCTAATCACTGATTAGTTGCTATAGGTAACTGCCCATGAGCAAATTTGCCCAGTGTTGATAAATGAGCCCCACTGAATCTGCTGTATTTAAGAGACTTTAGTTTTGGCACAAGATAGGAATGAATATCCAGGGATATTAATTTGTATAACCAAACAAGTCCTACCATTGTATAACATTACTACTGTGCCAATAGATGGTTTGTATCACTACTGCAGTTATAATATTGGCTGCTTACAGCTCCGCTCTCTTTATATGAGGTCTTTCATTGGTTGCTCATTAACTGATCCACCTGCAGAAGGTGCTGCTACAGCAGTATGCCAGAGTCTGAAATAATTGTTATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAATTTGTATTTATTTATAACTTCACTCCATTCTTCCAGTGTTTGGAGGTACTATTCTTTTTTTTTTTTTTTTTTTCTTTCTGATTATGCACTTTTTTGTTTTGCATTTTCATTAAATGTGTGTTCAAAGAGACATTTGGATGTCAAAAACCTGGTGCAGATAAAATGTTTTGTTATGGTAAAAATTATTGTTTGGTGACAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATGGCATGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGGCTTCTCTGGCAGTGAAAGATTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTA
                                                                   SNP                                                                                       ----C-------
                                                                   SNP                                                                                                   ----A-------
                                                                   SNP                                                                                                               -----G------
                                                                   SNP                                                                                                                           -------A----
                                                                   SNP                                                                                                                                       ---A------T-
                                                                   SNP                                                                                                                                                   A---------C-
                                                                   SNP                                                                                                                                                                                                                                                               ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                       -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                               ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                           -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                   ----A--G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                           ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                       ----G-----G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                   -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                           ----C-----C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -G-----C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       A-T---------
                                               BLH ATG      13     636                                                   
                                               EST CLI      31      19                                                   
  5   1   2      ests                            Xl3.1-IMAGE:6639712.5                                                 ATCCTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATTTCTCGTGTGGCGGGGGCAATCACTGCACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAGTTTAATGAAATGTATCTGGATACAGTGTGTCTTAATATGGTGCAGGATCCTATCCAGTTTGATGTGCTTGTCATGCCAAACCTCTACGGTGACATCTTGAGTGATCTTTGCGCAGGTCTAATTGGAGGCCTGGGAGTGACACCTAGTGGAAATATCGGTGCTAATGGGGTAGCAATCTTTGAATC
                                                  Xl3.1-CHK-1012688369                                                       CATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATTTCTCGTGTGGCGGGGGCAATCACTACACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAGTTTAATGAAATGTATCTGGATACAGTGTGTCTTAATATGGTGCAGGATCCTATCCAGTTTGATGTGCTTGTCATGCCAAACCTCTACGGTGACATCTTGAGTGATCTTTGCGCAGGTCTAATTGGAGGCCTGGGAGTGACACCTAGTGGAAATATCGGTGCTAATGGGGTAGCAATCTTTGAATCGGGTCA
  5   1   2       bld Egg1 5g                         IMAGE:3301245.5p GCACGAGGGGCAAAACCACCGCTAGCAAGTTTCCACGCCTTTCTTCTGTTCCTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCAGGGGCAATCACTACACCAGAATATGGAGCCAGGCAGCTTTCTAATCATGTGCACACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGAAAT
  5   1   2       bld Tail 5g                         IMAGE:8544649.5p   CCCCCCAAGTTNNNAGAAGAGTAATAAATATAAATCGTCCCTTCTGATACTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATTTCTCGTGTGGCGGGGGCAATCACTACACCAGAATATGGCACCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAACCACGGTGACTGCAGTGCACAAAGCATATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAATGGCGAGAATTGCAGAAAACTTAAGACATTAGTTTAATG
  5   1   2       bld Thy                             IMAGE:8550111.5p              GAGAGTCATGCATCGATTCGTCCCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGGTGAGACGCTGTAACATTATTTCTCGTGTGGCGGGGGCAATCACTGCACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCTGCTGGACATCCATCCATGAACTTGTTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGAACACCAGAGAACACGGTGACTGCATGCACAAGCAATATCATGAGATGTCTGAGGGCTATCCTGAAAATGCGAGAGTGCAGAAACTTAAGACATAGTTATGAATGACTGATCATGTGCTATATGGCAGATCACAGTGAGTCTGCTGCAACTCACGGATCTGTGACTGCCAGCATGAGCTGATGACATGATTCGGCATGGACACTGATGTCGCACCGATGCGAACTCACTGCTTCAGACACCGAGTCAATGC
  5   1   2       bld Ga12 5g                              XL177f08.5p                    GGTCGACTAGTTTCCCCGCCTCTCTTGTGATCCTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATTTCTCGTGTGGCGGGGGCAATCACTGCACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAG
  5   1   2       bld Egg1 5g                            PBX0035H06.5p                     CACGAGGAGTTTCCCCGCCTCTCTTCTGATCCTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATTTCTCGTGTGGCGGGGGCAATCACTACACCAGAATATGGCACCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGC
  5   1   2       bld Tad2 5g                         IMAGE:6933508.5p                                      GGGTTCTTCTGTTACTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCAGGGGCAATCACTACACCAGAATATGGAGCCAGGCAGCTTTCTAATCATGTGCACACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGAAATGTTACAGCAATTAAAGGGCCTGGTGGAAAGTGGATGATTCCCCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGATTGAAAGGACCTTTAAAGACACCCATCGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAAACATTCGATCTCTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGAACCCCTTACACAGATGTAGACCTGGTCACAATCCGTGAGAACACAGAAGGAGAATATAGTGGAATAGAGCATGTGATTGTGGATGGTGTGGTGCAAAGTATTAAGTTTATTACAGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGGAGCACAGTGACTGCAGTGCACAAAGCTAATATCATGAGGATGTCTGATGGGGCTGTTCCCTGAAAAATTGTCGAGAAGTTTGCAGNAAAGTTTTAAAAGACCTTTAGGTTTAAATGAAAATGGTACCTTGGGATACCCGTTGTGGTCTTAAATAATGGGTCCCAAGGATTCC
  5   1   2       bld Emb4 5g                         IMAGE:5514033.5p                                             CGGACGCGTGGGTGCACTTGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCAGGGGCAATCACTACACCAGAATATGGAGCCAGGCAGCTTTCTAATCATGTGCACACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGAAATGTTACAGCAATTAAAGGGCCTGGTGGAAAGTGGATGATTCCCCCTGAAGCCAAAGAATCTATGGATAAGAACAAGATGGGATTGAAAGGACCTTTAAAGACACCCATCGCTGCTGGGCATCCGTCTATGAACTTGCTGCTCCGCAAAACATTCGATCTCTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTATACAGATGTAGACCTGGTCACAATCCGTGAGAACACAGAAGGAGAATATAGTGGAATAGAGCATGTGATTGTGGATGGTGTGGTGCAAAGTATTAAGCTTATTACAGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTAACTGCAGTGCACAAAGCTAATATCATGAGGATGTCTGATGGGCTGTTCCTGAAAATTGTCGAGAAGTGCAGAAGCTTTAAGACATTAGTTAATGAATGTACTGGATACGTGTGTCTATATGTCCAGATCTACGAGTTGAGTGCAGTATGCAACTCATGTGATATGATGAC
  5   1   2       bld Ga15      out                      XL489g01ex.5p                                                  AGACACTGTACCAGTATGAGGGAAACAAGGCTCCGAGTTATCTCTCGTGTGGCAGGGGCAATCACTACACCAGAATATGGAGCCAGGCAGCTTTCTAATCATGTGCACACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGAAATGTTACAGCAATTAAAGGGCCTGGTGGAAAGTGGATGATTCCCCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGATTGAAAGGACCTTTAAAGACACCCATCGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAAACATTCGATCTCTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGAACCCCTTACACAGATGTAGACCTGGTCACAATCCGTGAGAACACAGAAGGAGAATATAGTGGAATAGAGCATGTGATTGTGGATGGTGTGGTGCAAAGTATTAAGCTTATTACAGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATCATGAGGATGTCTGATGGGCTGTTCCTGAAAAATTGTCGAGAAGTTGCAGAAAGTTTTAAAGACATTAAGTTTAATGAAATGTACCTGGATACCGTGTGTCTTAATATGGTCCAGG
  5   1   2       bld Emb4 5g                         IMAGE:5536408.5p                                                       CATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATTTCTCGTGTGGCGGGGGCAATCACTGCACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCTGCTGGACATCCATCCATGAACTTGTTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGANAAAATGTCGAGAAGTTGCAGAANACTTTAAAGACATTAAGTTTAATGAAATGTATCTGGATACAGTGTGTCTTANTATGGTGCAGGATCCTATCCCAGTTGATGTGCTTGTCATG
  5   1   2       bld Neu7      in                         XL001b10.5p                                                        AACATGGCTGGCAGCGCCTGGNGGTCACTGNATTTCTCGTGTGGCGGGGGCAATCACTACACCAGNAATATGGCACCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGNAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCTGCTGGACATCCATCCATGAACTTGTTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGG
  5   1   2       bld Panc 5g                         IMAGE:8737840.5p                                                        ATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCAGGGGCAATCACTACACCAGAATATGGAGCCAGGCAGCTTTCTAATCATGTGCACACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGAAATGTTACAGCAATTAAAGGGCCTGGTGGAAAGTGGATGATTCCCCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGATTGAAAGGACCTTTAAAGACACCCATCGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAAACATTCGATCTCTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGAACCCCTTACACAGATGTAGACCTGGTCACAATCCGTGAGAACACAGAAGGAGAATATAGTGGAATAGAGCATGTGATTGTGGATGGTGTGGTGCAAAGTATTAAGCTTATTACAGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCCTTTGAGTATGCAAGGAACAACCAGAGAAGCAACAGTGACTGCAGTGCACAAAGCTAATATCATGAGGATGTCTGATGGGCTGTCCTGAAAAATGTCGAAGAAGTTGAGAAAGTTTTAAGACTAGTTTATGAAATTGTACCTGGATACGTGGTGTTCTAATATGGTCAGATCTACTGATGATGTGCTAGTTGCACCCTCTTTGGTGACTTGAATGACTTTGTCCAGCTATGGAGTCTGGGAGGACACCATGGAAAATATCGGGTGCA
  5   1   2       bld Sp1       in                    IMAGE:4174806.5p                                                                GGCTGGCAGCGCCTGGAGGTCATTGATTTCTCGTGTGGCGGGGGCAATCACTGCACCAGAATATGGCACCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATATTTGAGACTGCCAAAACTCCTGTACAGTGGGAAGAGAGGAATGGTACAGCGATTTAAAGACCTAGTGGAAAATGATTAATCGCC
  5   1   2       bld Tbd7                                 XL085l05.5p                                                                   GGGCAGCGCCTGGNGGTNACTGATTTCTCGTGTGGCGGGGGCAATCACTACACCAGAATATGGCACCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCTGCAGGACATCCATCCATGAACTTGTTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTA
  5   1   2       bld DMZ                                  xl222j11.5p                                                                      GAGCGCCTGGAGGTCACTGATTTCTCGTGTGGCGGGGGCAATCACTGCACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCC
  5   1   2      seed Oo1                    IMAGE:6639712-IMAGp.IMAGp                                                                        GCGCCTGGAGGTCACTGATTTCTCGTGTGGCGGGGGCAATCACTGCACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAGTTTAATGAAATGTATCTGGATACAGTGTGTCTTAATATGGTGCAGGATCCTATCC
  5   1   2       bld Oo1                             IMAGE:6639712.5p                                                                         CGCCTGGAGGTCACTGATTTCTCGTGTGGCGGGGGCAATCACTGCACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAGTTTAATGAAATGTATCTGGATACAGTGTGTCTTAATATGGTGCAGGATCCTATCCAGTTTGATGTGCTTGTCATGCCAAACCTCTACGGTGACATCTTGAGTGATCTTTGCGCAGGTCTAATTGGAGGCCTGGGAGTGACACCTAGTGGAAATATCGGTGCTAATGGGGTAGCAATCTTTGAATCGGGTCATGGCACAGCCCCAGATATTGCTGGAAAAGACTTTGNCCACCCCAACTGCTCTTCTTCTAATTGCAGTCATGATGCTGGCGGCACATGGGGTCCTTCACCAAGGTATTGGACGCCAAATTAGAAAGGTC
  5   1   2       bld Neu7      in                         XL022h08.5p                                                                                AGGTNCTGATTTCTCGTGTGGCGGGGGCAATCACTGCACCAGNAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAAC
  5   1   2       bld Neu7      ?                          XL027d18.5p                                                                                  GGTNCTGATTTCTCGTGTGGCGGGGGCAATCACTGCACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGA
  5   1   2       bld Neu7      in                         XL026e24.5p                                                                                        GATTTCTCGTGTGGCGGGGGCAATCACTGCACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAGTTTAATGAAATGTATCTGGATAC
  5   1   2       bld DMZ       in                         xl304o08.5p                                                                                             CTCGTGTGGCGGGGGCAATCACTGCACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAGTTTAATGAAATGTATCTGGATACAGTGTGTCTTAATATGGTGCAGGATCCTATCCAGTTTGATGTGCTTGTCATGCCAAACCTCTACGG
  5   1   2       bld Ov1                             IMAGE:6318170.5p                                                                                               CGTGTGGCAGGGGCAATCACTACACCAGAATATGGAGCCAGGCAGCTTTCTAATCATGTGCACACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGAAATGTTACAGCAATTAAAGGGCCTGGTGGAAAGTGGATGATTCCCCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGATTGAAAGGACCTTTAAAGACACCCATCGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAAACATTCGATCTCTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGAACCCCTTACACAGATGTAGACCTGGTCACAATCCGTGAGAACACAGAAGGAGAATATAGTGGAATAGAGCATGTGATTGTGGATGGTGTGGTGCAAAGTATTAAGCTTATTACAGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATCATGAGGATGTCTGATGGGCTGTTCCTGAAAAATTGTCGAGAAAGTGCAGAAAGTTTTAAAGACATTAAGTTTAATGAAATGTACCTGGATACCGTGTGTCTTTATATGGGTCCCAGATCCTACTGGAGTTTGATGGGCTAGTTATGCCCAAACCTCTATTGTGGACCTAATGGAGGGAACCTTTGTGCAAGGCTTAATGGAAAGGCTGGGAAGGGACCCCAAGGGGAAATATCGGGGCTTAATGGGGGGAGCCATCTCTTTGAATCCGGTTCCTGGGCCCAGCCCCCCAAATTTTGGCTGGGAAAAGAACTTGGGGAAAAACCCCCCCTGGGTTCTCCCTTCCTA
  5   1   2       bld FaBN                            IMAGE:8077533.5p                                                                                                 TGTGGCGGGGGCAATCACTGCACCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCTGCTGGACATCCATCCATGAACTTGTTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAGTTTAATGAAATGTATCTGGATACAGTGTGTCTTAATATGGTGCAGGATCCTATCCAGTTTGATGTGCTTGTCATGCCAAACCTCTACGGTGAC
  5   1   2       bld FaB       in                    IMAGE:8070323.5p                                                                                                 TGTGGCGGGGGCAATCACTGCACCATAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCTGCTGGACATCCATCCATGAACTTGTTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATCCCTGAAAAAATGTCAAGAAGTTGCAGAAAACTTTAAAGAATTAAGTTTTATGAAATGTACCGGGAACAGTGGGTCTAAATATGGTGCGGATCTATTCAGTTTGAGGGCTGTCTAGCCA
  5   1   2       bld Em10                            IMAGE:8320779.5p                                                                                                 TGTGGCGGGGGCAATCACTACACCAGAATATGGCACCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAGTTTAATGAAATGTATCTGGATACAGTGTGTCTTAATATGGTGCAGGATCCTATCCAGTTTGATGTGCTTGTCATGCCCAACTCTACGTGACATCTGAGTGATCTTGCGCAGTTNA
  5   1   2       bld Te2N      out                   IMAGE:7765256.5p                                                                                                  GTGGCAGGGGCAATCACTACACCAGAATATGGAGCCAGGCAGCTTTCTAATCATGTGCACACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGAAATGTTACAGCAATTAAAGGGCCTGGTGGAAAGTGGATGATTCCCCCTGAAGCCAAAGAATCTATGGATAAGAACAAGATGGGATTGAAAGGACCTTTAAAGACACCCATCGCTGCTGGGCATCCGTCTATGAACTTGCTGCTCCGCAAAACATTCGATCTCTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTATACAGATGTAGACCTGGTCACAATCCGTGAGAACACAGAAGGAGAATATAGTGGAATAGAGCATGTGATTGTGGATGGTGTGGTGCAAAGTATTAAGCTTATTACAGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTAACTGCAGTGCACAAAGCTAATATCATGAGGATGTCTGATGGGCTGTTCCTGAAAAATTGTCGAGAAGTTGCAGAAAGCTTTAAAGACATTAAGTTTAATGAATGTACCTGGATACGTGTGTCTTATATGGTCAGGATCTACTGAGTTGATGGCTAGTATGCCAACTCATGTGACTATGAGGACTTNGGCAGTCTATGGAGCTGGATGAACAGTGGAATATCGGTATGGTACATCTGATCGTCTGCCACCAATTGTGAAGATGCAACCTGTTCCACCACTGAGTGCTGTCCCTAGGCAAAACGTGACATGAGTAAATGGAAGCATCATCAA
  5   1   2       bld Tbd7                                 XL094i03.5p                                                                                                                      GCCAGAATATGGCGCCAGGCGGCTTTCAAGTCATGTGCAGACTGTCACTCTCATACCAGGGGATGGAATTGGCCCAGAGATTTCAGCAGCTGTCATGAAGATTTTTGAGACTGCCAAAGCTCCTGTACAGTGGGAAGAGAGGAATGTTACAGCAATTAAAGGACCTGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAA
  5   1   2       bld Gas9                                 BG409638.5p                                                                                                                                                                                                                                                                                 CCCACGCGTCCGGTGGAAAGTGGATGATTCCCCCAGAAGCCAAAGAATCCATGCATAAGAACAAAATGGGCTTAAAAGGACCTTTAAAGACACCCATAGCTGCTGGACATCCATCCATGAACTTGTTGCTCCGCAAAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGAGGGATACAGGACCCCTTACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGAATTGAGCATGTGATTGTGGATGGTGTTGTACAAAGTATTAAGCTTATTACAGAAGAAGCAAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAGTTTAATGAAATGTATCTGGATACAGTGTGTCTTAATATGGTGCAGGATCCTATCCAGTTTGATGTGCTTGTCATGCCAAACCTCTACGGTGACATCTTGAGTGATCTTTGCGCAGGTCTAATTGGANGCCTGGGAGTGACACCTACTGGAAATATCGGTGCTTATGGGGTAGCAATCTTTGAATCGGTTCATGGCNCAGCCCCAGATNTTGNTGGAAAAG
  5   1   2       bld DMZ                                  xl240k22.5p                                                                                                                                                                                                                                                                                                                               ATCCATGCNTAANAACAAAATGGGCTTANAAGGACCTTTAANGACACCCATAGCCGCTGGACATCCATCCATGAACTTGCTGCTCCGCAGAACATTTGATCTGTATGCAAATGTGCGTCCATGTGTTTCCATTGANG
  5   1   2      ests                            Xl3.1-IMAGE:6324220.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGAGTATGGACGCAAAATAGAAAGTGCCTGCTTTGAGACCATAAAATCTGGCAAGGTTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGCCGCAGAATACAGGACAGTGATTAGCATTGTAGCTCTTCAGTAACTTCTGTCAGAACGGTGAACTGACTTGACAAGCACATAACTTCCTGCTGTCTTTATCATGCTTCAGTGCTTCATCTTCTTCACAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACTCTGTGTGTATAGGCTTCTCTGGCAGTGAAAGATTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTAAATTGCAACCTATCAAATTGCTGCATTCATTTCCTACTTGCAGCAGACATTAAAAAGCTAATCACTGATTAGTTGCTATAGGTAACTGCCCATGAGCAAATTTGCCCAGTGTTGATAAATGAGCCCCACTGAATCTGCTGTATTTAAGAGACTTTAGTTTTGGCACAAGATAGGAATGAATATCCAGGGATATTAATTTGTATAACCAAACAAGTCCTACCATTGTATAACATTACTACTGTGCCAATAGATGGTTTGTATCACTACTGCAGTTATAATATTGGCTGCTTACAGCTCCGCTCTCTTTATATGAGGTCTTTCATTGGTTGCTCATTAACTGATCCACCTGCAGAAGGTGCTGCTACAGCAGTATGCCAGAGTCTGAAATAATTGTTATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAATTTGTATTTATTTATAACTTCACTCCATTCTTCCAGTGTTTGGAGGTACTATTCTTTTTTTTTTTTTTTTTTTCTTTCTGATTATGCACTTTTTTGTTTTGCATTTTCATTAAATGTGTGTTCAAAGAGACATTTGGATGTCAAAAACCTGGTGCAGATAAAATGTTTTGTTATGGTAAAAATTATTGTTTGGTGACAGC
                                                  Xl3.1-CHK-1012691342                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGGACGCAAAATAGAAAGTGCCTGCTTTGAGACCATAAAATCTGGCAAGGTTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGCCGCAGAATACAGGACAGTGATTAGCATTGTAGCTCTTCAGTAACTTCTGTCAGAACGGTGAACTGACTTGACAAGCACATAACTTCCTGCTGTCTTTATCATGCTTCAGTGCTTCATCTTCTTCACAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACTCTGTGTGTATAGGCTTCTCTGGCAGTGAAAGATTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTAAATTGCAACCTATCAAATTGCTGCATTCATTTCCTACTTGCAGCAGACATTAAAAAGCTAATCACTGATTAGTTGCTATAGGTAACTGCCCATGAGCAAATTTGCCCAGTGTTGATAAATGAGCCCCACTGAATCTGCTGTATTTAAGAGACTTTAGTTTTGGCACAAGATAGGAATGAATATCCAGGGATATTAATTTGTATAACCAAACAAGTCCTACCATTGTATAACATTACTACTGTGCCAATAGATGGTTTGTATCACTACTGCAGTTATAATATTGGCTGCTTACAGCTCCGCTCTCTTTATATGAGGTCTTTCATTGGTTGCTCATTAACTGATCCACCTGCAGAAGGTGCTGCTACAGCAGTATGCCAGAGTCTGAAATAATTGTTATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAATTTGTATTTATTTATAACTTCACTCCATTCTTCCAGTGTTTGGAGGTACTATTCTTTTTTTTTTTTTTTTTTTCTTTCTGATTATGCACTTTTTTGTTTTGCATTTTCATTAAATGTGTGTTCAAAGAGACATTTGGATGTCAAAAACCTGGTGCAGATAAAATGTTTTGTTATGGTAAAAATTATTGTTTGGTxACAGCCCATAA
  5   1   2       bld Egg3                            IMAGE:6324220.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCGGGAAGGAACACCATACAACACGGTGACTGCAGTGCACAAAGCAAATATCATGAGAATGTCTGATGGGCTATTCCTGAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAGTTTAATGAAATGTATCTGGATACAGTGTGTCTTAATATGGTGCAGGATCCTATCCAGTTTGATGTGCTTGTCATGCCAAACCTCTACGGTGACATCTTGAGTGATCTTTGCGCAGGTCTAATTGGAGGCCTGGGAGTGACACCTAGTGGAAATATCGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTTATGGCACAGCCCCAGATATTGCTGGAAAAGACTTTGCCAACCCCACTGCTCTTCTTCTAAGTGCAGTCATGATGCTGCGGCACATGGGTCTCCACGAGTATGGACGCAAAATAGAAAGTGCCTGCTTTGAGACCATAAAATCTGGCAAGGTTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGCCGCAGAATACAGGACAGTGATTAGCATTGTAGCTCTTCAGTAACTTCTGTCAGAACGGTGAACTGACTTGACAAGCACATAACTTCCTGCTGTCTTTATCATGCTTCAGTGCTTCATCTTCTTCACAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACTCTGTGTGTATAGGCTTCTCTGGCAGTGAAAGATTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTAAATTGCAACCTATCAAATTGCTGCATTCATTTTCTACTTGCAGCAGACATTAAAAAGCTAATCACTGATTTAGTTGCTATAGGTAACTGCCCATGAGCCAATTTGCCCAGTG
  3   1   2       bld Neu7      in                         XL001b10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGAGTATGGACGCAAAATAGAAAGTGCCTGCTTTGAGACCATAAAATCTGGCAAGGTTNTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGCCGCAGAATACAGGACAGTGATTAGCATTGTAGCTCTTCAGTAACTTCTGTCAGAACGGTGAACTGACTTGACAAGCACATAACTTCCTGCTGTCTTTATCATGCTTCAGTGCTTCATNTTCTTCACAGCAAACCAAAAGCCCTGCTANGCATGGCATGNTACTCTTTGTGTATAGGCTTCTCTGGCAGTGAAAGATTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTAAATTGCAGTTATAATATTGGCTGCTTACAGCTCCGCTCTCTTTATATGCAGGTCTTTCATTGGTTGCTCATTAACTGACCCACCTGCAGAAGGTGCTGCTACAGCAGTATGCCAGAGTTCTGAAATAATTGT
  5   1   2       bld Ga18      in                      xlk138c13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACANCCAGATATTGCTGGAAAAGACTTTGCCAACCCCACTGCTCTTCTTCTAAGTGCAGTCATGATGCTGCGNNNATGGGTCTCCACGAGTATGGACGCAAAATAGAAAGTGCCTGCTTTGAGACCATAAAATCTGGCAAGGTTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGCCGCAGAATACAGGACAGTGATTAGCATTGTAGCTCTTCAGTAACTTCTGTCAGAACGGTGAACTGACTTGACAAGCACATAACTTCCTGCTGTCTTTATCATGCTTCAGTGCTTCATCTTCTTCACAGCAAACCAAAAGCCCTGCTATGCATGGNATGCTACTCTGTGTGTGTATAGGCTTCTCTGGCAGTGAAAGANTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTAAATTGCAGTTATAATATTGGCTGCTTACAGCTCCGCTCTCTTTATATGAGGNCTTTCATTGGTTGCTCATTAACTGATCCACCTGCAGAAGGTGCTGCTACAGCAGTATGNCAGAGTCTGAAATAATTGTNATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAATTTGTATTTATTTATAACTTCACTCCATTCTTCCAGTGTTTGGAGGNNCTATTCttttttttctttttttttttttCTTTCTGATTATGCACTTTTTTGTTTTNCATTTTCATNAAATGTNTGNTCAAAGAGACATTTGNNNNTCAAAAACCTNG
  3   1   2       add Ga18      in                      xlk138c13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ANCCCCNGATANTGCTNNAAAAGNCTTTNCCNACCCCNCTGCTCTTCTTCTAAGTGNAGTCATGATGCTGCGGCACATGGNNCTCCACGAGTATGGACGCAAAATAGAAAGTGCCTGCTTTGAGACCATAAANTCTGGCAAGGTTCTGACTAAAGNCTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGCCGCAGAATACAGGACAGTGATTAGCATTGTAGCTCTTCAGTAACTTCTGTCAGAACGGTGAACTGACTTGACAAGCACATAACTTCCTGCTGTCTTTATCATGCTTCAGTGCTTCATCTTCTTCACAGCAAACCAAAANNCTNCTATGCATGGCATGCTACTCTGTGTGTGTATAGGCTTCTCTGGCAGTGAAAGATTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTAAATTGCAGTTATAATATTGGCTGCTTNNNNNNGCTCTCTTTATATGAGGTCTTTCATTGGTTGCTCATTAACTGATCCACCTGCAGAAGGTGCTGCTACAGCAGTATGCCAGAGTCTGAAATAATTGTTATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAATTTGTATTTATTTATAACTTCACTCCATTCTTCCAGTGTTTGGAGGTACTATTCTTTTTTTTCTTTTTTTTTTTTCTTTCTGATTATGCACTTTTTTGTTTTGCATTTTCATTAAATGTGTGTTCAAAGAGACATTTGGATGTCAAAAACCTGGTGCAGATAAAATGTTTTGTTATGGTAAAAATTATTNTTTGGTGNCA
  5   1   2       bld Emb1                            IMAGE:3401753.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACGCGTCCGCACATAACTTCCTGCTTTCTTTATCATGCTTCAGTGCTTCATCTTCTTCACAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACTCTGTGTGTATAGGCTTCTCTGGCAGTGAAAGATTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTAAATTGCAACCTATCAAATTGCTGCATTCATTTCCTACTTGCAGCAGACATTAAAAAGCTAATCACTGATTAGTTGCTATAGGTAACTGCCCATGAGCAAATTTGCCCAGTGTTGATAAATGAGCCCCACTGAATCTGCTGTATTTAAGAGACTTTAGTTTTGGCACAAGATAGGAATGAATATCCAGGGATATTAATTTGTATAACCAAACAAGTCCTACCATTGTATAACATTACTACTGTGCCAATAGATGGTTTGTATCACTACTGCAGTTATAATATTGGCTG
  5   1   2      seed Emb1                   IMAGE:3401753-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACATAACTTCCTGCTTTCTTTATCATGCTTCAGTGCTTCATCTTCTTCACAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACTCTGTGTGTATAGGCTTCTCTGGCAGTGAAAGATTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTAAATTGCAACCTATCAAATTGCTGCATTCATTTCCTACTTGCAGCAGACATTAAAAAGCTAATCACTGATTAGTTGCTATAGGTAACTGCCCATGAGCAAATTTGCCCAGTGTTGATAAATGAGCCCCACTGAATCTGCTGTATTTAAGAGACTTTAGTTTTGGCACAAGATAGGAATGAATATCCAGGGATATTAATTTGTATAACCAAACAAGTCCTACCATTGTATAACATTACTACTGTGCCAATAGATGGTTTGTATCACTACTGCAGTTATAATATTGGCTGCTTACAGCTCCGCTCTCTTTATATGAGGTCTTTCATTGGTTGCTCATTAACTGATCCACCTGCAGAAGGTGCTGCTACAGCAGTATGCCAGAGTCTGAAATAATTGTTATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAATTTGTATTTATTTATAACTTCACTCCATTCTTCCAGTGTTTGGAGGTACTATTCtttttttttttttttttttctttctgattatgcacttttttgttttgcattttCATTAAATGTGCGTTCAAAGAGACATTTGAATGTCAAAAACCTGTTGCAGATAAAATGTTTTGTTATGGTAAAAATTATTGTTTGGTGACAGCCC
  3   1   2       bld FaB       in                    IMAGE:8070323.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCTTCTTCTAAGTGCAGTCATGATGCTGCGGCACATGGGTCTCCACGAGTATGGACGCAAAATAGAAAGTGCGTGCTTTGAGACCATAAAATCTGGCAAGGTTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGCCGCAGAATACAGGACAGTGATTAGCATTGTAGCTCTTCAGTAACTTCTGTCAGAACGGTGAACTGACTTGACAAGCACATAACTTCCTGCTGTCTTTATCATGCTTCAGTGCTTCATCTTCTTCACAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACTCTGTGTGTATAGGCTTCTCTGGCAGTGAAAGATTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTAAATTGCAGTTATAATATTGGCTGCTTACAGCTCCGCTCTCTTTATATGAGGTCTTTCATTGGTTGCTCATTAACTGATCCACCTGCAGAAGGTGCTGCTACAGCAGTATGCCAGAGTCTGAAATAATTGTTATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAATTTGTATTTATTTATAACTTCACTCCATTCTTCCAGTGTTTGGAGGTACTATTCTTTTTTTTTTTTTTTCTTTCTTTCTGATTATGCACTTTTTTGTTTTGCATTTTCATTAAATGTGTGTTCAAAGAGACATTTGGATGTCAAAAACCTGGTGCAGATAAAATGTTTTGTTATGGTAAAAATTATTGTTTGGGACAGCCCATACACATTTTGAC
  5   1   2       bld Egg1                               PBX0122D10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGCCTGGTTAGACTTAAATTGCAACCTATCAAATTGCTGCATTCATTTCCTACTTGCAGCAGACATTAAAAAGCTAATCACTGATTAGTTGCTATAGGTAACTGCCCATGAGCAAATTTGCCCAGTGTTGATAAATGAGCCCCACTGAATCTGCTGTATTTAAGAGACTTTAGTTTTGGCACAAGATAGGAATGAATATCCAGGGATATTAATTTGTATAACCAAACAAGTCCTACCATTGTATAACATTACTACTGTGCCAATAGATGGTTTGTATCACTACTGCAGTTATAATATTGGCTGCTTACAGCTCCGCTCTCTTTATATGAGGTCTTTCATTGGTTGCTCATTAACTGATCCACCTGCAGAAGGTGCTGCTACAGCAGTATGCCAGAGTCTGAAATAATTGTTATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAATTTGTATTTATTTATAAC
  5  -1   2       bld Egg3      in                    IMAGE:3377262.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTAATTAGAATCAACACAGCAGTGNTGGTTAGANTTAAATTGCAACGTATCAAATTGNTGCATTCATTTCNTACTTGCAGCAGACATTAAAAAGCTAATCACTGATTAGTTGCTATAGGTAACTGCCCATGAGCAAATTTGCCCAGTGTTGATAAATGAGCCCCACTGAATCTGCTGTATTTAAGAGACTTTAGTTTTGGCACAAGATAGGAATGAATATCCAGGGATATTAATTTGTATAACCAAACAAGTCCTACCATTGTATAACATTACTACTGTGCCAATAGATGGTTTGTATCACTACTGCAGTTATAATATTGGCTGCTTACAGCTCCGCTCTCTTTATATGAGGTCTTTCATTGGTTGCTCATTAACTGATCCACCTGCAGAAGGTGCTGCTACAGCAGTATGCCAGAGTCTGAAATAATTGTTATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAATTTGTATTTATTTATAACTTCACTCCATTCTTCCAGTGTTTGGAGGTACTATTCCCGG
  3  -1   2       bld Egg3      in                    IMAGE:3377262.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACACAGCAGTGCTGGTTAGACTTAAATTGCAACCTATCAAATTGCTGCATTCATTTCCTACTTGCAGCAGACATTAAAAAGCTAATCACTGATTAGTTGCTATAGGTAACTGCCCATGAGCAAATTTGCCCAGTGTTGATAAATGAGCCCCACTGAATCTGCTGTATTTAAGAGACTTTAGTTTTGGCACAAGATAGGAATGAATATCCAGGGATATTAATTTGTATAACCAAACAAGTCCTACCATTGTATAACATTACTACTGTGCCAATAGATGGTTTGTATCACTACTGCAGTTATAATATTGGCTGCTTACAGCTCCGCTCTCTTTATATGAGGTCTTTCATTGGTTGCTCATTAACTGATCCACCTGCAGAAGGTGCTGCTACAGCAGTATGCCAGAGTCTGAAATAATTGTTATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAAT
  5   1   2       bld Emb1                            IMAGE:6636662.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGAATCTGCCGCAGAATACAGGACAGTGATTAGCATTGTAGCTCTTCAGTAACTTCTGTCAGAACGGTGAACTGACTTGACAAGCACATAACTTCCTGCTGTCTTTATCATGCTTCAGTGCTTCATCTTCTTCACAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACTCTGTGTGTGTATAGGCTTCTCTGGCAGTGAAAGATTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTAAATTGCAGTTATAATATTGGCTGCTTACAGCTCCGCTCTCTTTATATGAGGTCTTTCATTGGTTGCTCATTAACTGATCCACCTGCAGAAGGTGCTGCTACAGCAGTATGCCAGAGTCTGAAATAATTGTTATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAATTTGTATTTATTTATAACTTCACTCCATTCTTCCAGTGTTTGGAGGTACTATTCttttttttcttttttttttttctttctgattatgcacttttttgttttgcattttCATTAAATGTGTGCTCAAAGAGACATTTGGATGTCAAAAACCTGGCGCAGATAAAATGCTTTGTCATGGTAAAAATTATTGTTTGGTGACAGCCCATAAAGCATTTATTTTTAAACCTGGAAACCCAACGAAGCCCCACATAACAAG
  3   1   2       bld Egg2                            IMAGE:5162163.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAAAAGCCCTGCTATGCATGGCATGCTGCTCTGTGTGTATAGGCTTCTCTGGCAGTGAAAGATTTCAGTGGAAACTCAGATTTTTAATGCAGCAACCTGTAATTAGAATCAACACAGCAGTGCTGGTTAGACTTAAATTGCAGTTATAATATTGGCTGCTTACAGCTCCGCTCTCTTTATATGAGGTCTTTCATTGGTTGCTCATTAACTGATCCACCTGCAGAAGGTGCTGATACAGCAGTATGCCAGAGTCTGAAATAATTGTTATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAATTTGTATTTATTTATAACTTCACTCCATTTTTCCAGTGTTTGGAGGTACTATTCTTTTTTTTTTTTTTTCTTTCTTTCAGATTGTGCACTTTTTTGTTTTGCATTTTCATTAAATGTGTGTTCAAAGAGACATTTGGATGTCAAAAACCTGGTGCAGATAAAATGTTTTGTTATGGTAAACATTATTGTTTGGTGACAGC
  3   1   2       add Neu7      in                         XL022h08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCAAAGTTTTAAANAATTNTTANAAANNTCANGNTCNAGCTTTNAACNTTNNGNCTTCANAATTTGNATTTNTTTANAACTTCCCCCCNTTNTTCCAGNGNTTGGAGGGACCAATCCTTTTTTTCCTTTTTTTTTTTTTTCTTTCTGATTATGCACTTTTTTGTTTTGCATTTTCATTAAATGTGTGTTCAAAGAGACATTTGGATGTCAAAAACCTGGTGCAGATAAAATGTTTTGTTATGGTAAAAATTATTGTTTGGTNACAGCCCATAAAGNCATTTATTTTTAA
  3   1   2       bld Sp1       in                    IMAGE:4174806.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGAAATAATTGTTATAAATGTCATGTTCAAGCTTTAAACATTGTGACTTCAGAATTTGTATTTATTTATAACTTCACTCCATTCTTCCAGTGTTTGGAGGGACTATTCCTTTTTTTTTTTTTTTCTTTCTGATTATGCACTTTTTTGTTTTGCATTTTCATTAAATGTGCGTTCAAAGAGACATTTGAATGTCAAAAACCTGTTGCAGATAAAATGTTTTGTTATGGTAAAAATTATTGTTTGGTGACAGCCCATAAAGCATTTATTTTTAAACCTGAAAAAAAAAAA
  3   1   2       add DMZ       in                         xl304o08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAANTTGNATTTNTTTANAANTTCNCNCCCTTTTTCCNGGGNTTGGGGGGACTATTCNTTTTTTTCTTTTTTTTTTTTTTCTTTCTGATTATGCACTTTTTTGTTTTGCATTTTCATTAAATGTGTGTTCAAAGAGACATTTGGATGTCAAAAACCTGGTGCAGATAAAATGTTTTGTTATGGTAAAAATTA
  3   1   2       add Neu7      in                         XL026e24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TANAACTTCCCCCCNTTNTTCCAGGGNTTGGAGGGACCANTCCTTTTTTTCnTTTTTTTTTTTTTCTTTCAGATTATGCACTTTTTTGNTTTGCATTTTCATTAAATGTGTGTTCAAAGAGACATTTGGATGTCAAAAACCTGGTGCAGATAAAATGTTTTGTTATGGTAAAAATTATTGTTNGGGCACAGCCCATAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)