Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Jul 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012837649 Xl3.1-XL043h01.3.5 - 66 ESTs
                                                                       .....-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL043h01.3.5                                                                                      GACATTTTCACAGTCCGCCAGCCAAAAGGATTTGGGGGAAGACAAAAAGTAGTTTTTTTTTTCCTCCTCCTTTTTTTTTCTTTCTAAGCCCGCCATTCTAGTAAGAGGGAAAAAAGGGGAAATCTGTTTTGCCCCTTCTCCTCCTGCACATCCGGACAACACGCCAAATTGCTCTTCTTTTTCCCTCTCGCTTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGCCGCCCCCTTTACTCACTGCTCGGGCTCGTTTTCTTTTAGCCTTTTATTGGGTTTTTTTTTTATTTTTTACGATGAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAAGTCTCTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGTCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGTGGGAGGTACTGGACAGCCTATTAGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTTAACACTGATTCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTTGAGAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAATCACCATCCCAGCAGCTTCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGGTCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGTCAGAGGTTCCACTGAGGATGCTGGTGCCCACACAGTTTGTTGGGGCGATCATTGGAAAAGAGGGTGCCACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAAAATGCTGGTGCTGCAGAGAAACCGATTACGATTCACTCAACCCCTGAAGGCTGTTCAGCTGCATGCAAGATCATTATGGAGATCATGCAGAAGGAAGCTCAGGATACCAAGTTCACTGAAGAAATCCCCTTAAAAATATTAGCACATAACAACTTTGTTGGCCGTCTTATTGGGAAAGAAGGAAGGAACCTTAAGAAAATTGAGCAAGATACAGATACAAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCAGAACGGACCATTACAGTAAAAGGCAGCATTGAGCCATGTGCCAAAGCCGAGGAAGAAATCATGAAAAAAATTAGGGAGTCCTATGAAAATGATATTGCTGCTATGAATCTCCAGGCACATTTGATTCCTGGTTTGAACCTGAATGCATTGGGCCTTTTCCCATCATCCTCATCAGGAATGCCACCACCTTCTGTTGGAGTTCCCTCACCTACATCATCTACTTCTTATCCACCATTTGGGCAGCAGCCAGAGTCAGAGACCGTTCATCTCTTCATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGCGCATCCCCTGTTTGAGGACCAGGCAACCATTAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTAAAAATGGAAAAAAAAAGGCAAAAAAAGAAAATGAAAAAAAAAAATAAGGTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGTCTTTTTTTTATTGTTCTTATTCCCCCAACAATTTTAGAACTTTGTTTAATGAAGCTTTCTCTTATGAGT
                                                  Xl3.1-CHK-1012721349                                                                                            TTCACAGTCCGCCAGCCAAAAGGATTTGGGGGAAGACAAAAAGTAGTTTTTTTTTTCCTCCTCCTTTTTTTTTCTTTCTAAGCCCGCCATTCTAGTAAGAGGGAAAAAAxGGGxAATCTGTTTTGCCCCTTCTCCTCCTGCACATCCGGACAACACGCCAAATTGCTCTTCTTTTTCCCTCTCGCTTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGCCGCCCCCTTTACTCACTGCTCGGGCTCGTTTTCTTTTAGCCTTTTATTGGGTTTTTTTTTTATTTTTTACGATGAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAAGTCTCTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGTCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGTGGGAGGTACTGGACAGCCTATTAGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTTAACACTGATTCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTTGAGAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAATCACCATCCCAGCAGCTTCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGGTCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGTCAGAGGTTCCACTGAGGATGCTGGTGCCCACACAGTTTGTTGGGGCGATCATTGGAAAAGAGGGTGCCACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAAAATGCTGGTGCTGCAGAGAAACCGATTACGATTCACTCAACCCCTGAAGGCTGTTCAGCTGCATGCAAGATCATTATGGAGATCATGCAGAAGGAAGCTCAGGATACCAAGTTCACTGAAGAAATCCCCTTAAAAATATTAGCACATAACAACTTTGTTGGCCGTCTTATTGGGAAAGAAGGAAGGAACCTTAAGAAAATAGAGCAAGATACAGATACAAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCAGAACGGACCATTACAGTAAAAGGCAGCATTGAGCCATGTGCCAAAGCCGAGGAAGAAATCATGAAAAAAATTAGGGAGTCCTATGAAAATGATATTGCTGCTATGAATCTCCAGGCACATTTGATTCCTGGTTTGAACCTGAATGCATTGGGCCTTTTCCCATCATCCTCATCAGGAATGCCACCACCTTCTGTTGGAGTTCCCTCACCTACATCATCTACTTCTTATCCACCATTTGGGCAGCAGCCAGAGTCAGAGACCGTTCATCTCTTCATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGCGCATCCCCTGTTTGAGGACCAGGCAACCATTAAxxxxxTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTAAAAATGGAAAAAAAAAGGCAAAAAAAGAAAATGAAAAAAAAAAATAAGGTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGTCTTTTTTTTATTGTTCTTATTCCCCCAACAATTTTAGAACTTTGTTTAATGAAGCTTTCTCTTxxxxxxTTCTGG
                                                      consensus depths                                                                                           2     3     2     3     2     3     3     4     3     4     2     4     3     4     2     4     2     5     4     5     3     7     3     8     3     8     4     9     5    10     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     7    12     7    12    11    12     9    12    11    14    11    14    12    15    11    14    11    16    11    15    11    15    11    16    11    17    11    17    10    17    11    17    10    17     9    17    11    15    13    16    12    13    12    13    13    15    13    15    12    14    12    15    11    14    11    14    11    14    11    14    11    14    10    14    11    14    11    14    10    13    10    13    10    13     8    12     9    13     9    13     9    12     9    13     9    13     9    12     9    13     9    13    12    13    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     8     9     8     9     7     9     8     9     7     9     7    10     6     9     6     9     7    10     7    10     6     8     6     8     6     9     7     9     7     9     7     9     7     8     7     8     7     8     7     8     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     5     6     5     7     5     7     5     7     5     7     5     7     5     7     5     8     7     9     7     9     8    10     8    11     8    11     8    11     9    12    12    15    12    15    13    15    13    15    14    15    15    16    15    18    17    20    19    21    18    21    18    21    19    22    19    23    19    23    19    23    20    23    21    23    20    25    23    26    26    27    22    25    23    25    21    27    24    27    26    27    25    27    26    27    27    28    27    28    27    28    28    29    29    30    29    30    30    30    30    30    30    30    30    30    30    30    29    30    31    31    30    30    30    30    30    30    29    30    29    30    28    30    27    30    15    30    16    30    16    30    15    30    16    30    15    30    14    30    14    25    13    27    15    26    14    24    11    22     9    19    11    15     7    12    10    12    10    12    10    12     9    12     9    12     7    11     7    11     5     8     3     5     3     5
  5   1   2      ests                               Xl3.1-XL502p10ex.5              ATTTTATTTAGAGGCGGTGCCTACATTAACGTAGAGTGACATTTTCACAGTCTGCCTGCCAAAAGGATTTGGGGGAAGACAAAAAGTTGTTTTTTTTTTCCTCCTCCTTTTTTTTTTTTCTTTCTAAGCCCGCCATTCTAGTAAGAGGGAAAAAGGAATCTGTTTTGCCCCTTTTCCTCCTGCACATCCGGGACAACACGGCGAAATTGCTCTTCTTTCCCTCTCAGCTCTCGCTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGATCGCCGCCCCCTGATTCACTGCTCAAGCTGCTCGGGCTTTTCGGGCTCGTCTTCTTTTAGCTTTTATTATTTTTTTTTTATTTTCATTTTTTTTTACAATGAACAAGCTGTATATTGGAAACCTCAGCGAAAACGTGAGCCCCACGGATTTGGAAAGTCTCTTCAAGGAGTCTAAAATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGNGGATACGCGTTTGTGGACTGTCCGGATGAAACGTGGGCTATGAAGGCCATCGACACCCTATCAGGGAAAGNGGAGTTGCATGGCAAAG------------AACACTCGGNACCCAAAAGGCAAAGGAGTCNAAAGCTTCAAATACGAAACATACCGCCTCATCTACAGNGGGAGGNACTGGACAGCCTGTTGGCACAGNATGGGACAGNGGAAAACTGTGAGCAAGTGAACACTGAATCAAAAA------------ATGTAACATATGCCAATAAGGAGCACNCTAGACAAGGACTCGAAAAATTAAACGGCTATCACCTGGAAAACT
  5   1   2       e50                            Xl3.1-IMAGE:6862521.5                                                                                      GACATTTTCACAGTCCGCCAGCCAAAAGGATTTGGGGGAAGACAAAAAGTAGTTTTTTTTTTCCTCCTCCTTTTTTTTTCTTTCTAAGCCCGCCATTCTAGTAAGAGGGAAAAAAGGGGAAATCTGTTTTGCCCCTTCTCCTCCTGCACATCCGGACAACACGCCAAATTGCTCTTCTTTTTCCCTCTCGCTTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGCCGCCCCCTTTACTCACTGCTCGGGCTCGTTTTCTTTTAGCCTTTTATTGGGTTTTTTTTTTATTTTTTACGATGAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAAGTCTCTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGTCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGTGGGAGGTACTGGACAGCCTATTAGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTTAACACTGATTCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTTGAGAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAATCACCATCCCAGCAGCTTCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGGTCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGTCAGAGGTTCCACTGAGGATGCTGGTGCCCACACAGTTTGTTGGGGCGATCATTGGAAAAGAGGGTGCCACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAAAATGCTGGTGCTGCAGAGAAACCGATTACGATTCACTCAACCCCTGAAGGCTGTTCAGCTGCATGCAAGATCATTATGGAGATCATGCAGAAGGAAGCTCAGGATACCAAGTTCACTGAAGAAATCCCCTTAAAAATATTAGCACATAACAATTTTGTTGGCCGTCTTATTGGGAAAGAAGGAAGGAACCTTAAGAAAATAGAGCAAGACACAGATACCAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCTGAACGGACCATTACAGTAAAAGGCAGCATTGAGACATGTGCCAAAGCCGAGGAAGAAGTCATGAAAAAAATTAGGGAGTCCTATGAAAATGATATTGCTGCTATGAATCTAC
  5   1   2      ests                                 Xl3.1-XL043h01.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAAGTTCACTGAAGAAATCCCCTTAAAAATATTAGCACATAACAACTTTGTTGGCCGTCTTATTGGTAAAGAAGGAAGGAACCTTAAGAAAATTGAGCAAGATACAGATACAAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCAGAACGGACCATTACAGTAAAAGGCAGCATTGAGCCATGTGCCAAAGCCGAGGAAGAAATCATGAAAAAAATTAGGGAGTCCTATGAAAATGATATTGCTGCTATGAATCTCCAGGCACATTTGATTCCTGGTTTGAACCTGAATGCATTGGGCCTTTTCCCATCATCCTCATCAGGAATGCCACCACCTTCTGTTGGAGTTCCCTCACCTACATCATCTACTTCTTATCCACCATTTGGGCAGCAGCCAGAGTCAGAGACCGTTCATCTCTTCATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGCGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTAAAAATGGAAAAAAAAAGGCAAAAAAAGAAAATGAAAAAAAAAAATAAGGTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGTCTTTTTTTTATTGTTCTTATTCCCCCAACAATTTTAGAACTTTGTTTAATGAAGCTTTCTCTTTATGAGTTCTGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                          AGCTGTATATTGGAAACCTCAGCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACGGATTTGGAAAGTCTCTTCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCCTTTCACCGGGCAGTTTCTGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTGTCCGGATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAAGGCCATCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCATGGCAAAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCTGTTGGCAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCAAGTGAACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTAACATATGCCAATAAGGAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACTCGAAAAATTAAACGGCTATC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGACGTATATACCTGATGAAATGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACCATCCCAACAGCTTCAGCAGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  G-T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C--------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      A-------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---A--------
                                               BLH ATG     320    1274                                                                                      
                                               BLH MIN     320     284                                                                                      
                                               BLH MPR     320     284                                                                                      
                                               BLH OVR     320     214                                                                                      
                                               CDS MIN     320     284                                                                                      
                                               ORF LNG     320      30                                                                                      
  5   1   2      ests                               Xl3.1-XL502p10ex.5              ATTTTATTTAGAGGCGGTGCCTACATTAACGTAGAGTGACATTTTCACAGTCTGCCTGCCAAAAGGATTTGGGGGAAGACAAAAAGTTGTTTTTTTTTTCCTCCTCCTTTTTTTTTTTTCTTTCTAAGCCCGCCATTCTAGTAAGAGGGAAAAAGGAATCTGTTTTGCCCCTTTTCCTCCTGCACATCCGGGACAACACGGCGAAATTGCTCTTCTTTCCCTCTCAGCTCTCGCTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGATCGCCGCCCCCTGATTCACTGCTCAAGCTGCTCGGGCTTTTCGGGCTCGTCTTCTTTTAGCTTTTATTATTTTTTTTTTATTTTCATTTTTTTTTACAATGAACAAGCTGTATATTGGAAACCTCAGCGAAAACGTGAGCCCCACGGATTTGGAAAGTCTCTTCAAGGAGTCTAAAATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGNGGATACGCGTTTGTGGACTGTCCGGATGAAACGTGGGCTATGAAGGCCATCGACACCCTATCAGGGAAAGNGGAGTTGCATGGCAAAG------------AACACTCGGNACCCAAAAGGCAAAGGAGTCNAAAGCTTCAAATACGAAACATACCGCCTCATCTACAGNGGGAGGNACTGGACAGCCTGTTGGCACAGNATGGGACAGNGGAAAACTGTGAGCAAGTGAACACTGAATCAAAAA------------ATGTAACATATGCCAATAAGGAGCACNCTAGACAAGGACTCGAAAAATTAAACGGCTATCACCTGGAAAACT
                                                  Xl3.1-CHK-1012713820                    TTTAGAGGCGGTGCCTACATTAACGTAGAGTGACATTTTCACAGTCTGCCTGCCAAAAGGATTTGGGGGAAGACAAAAAGTTGTTTTTTTTTTCCTCCTCCTTTTTTTTTTTTCTTTCTAAGCCCGCCATTCTAGTAAGAGGGAAAAAGGAATCTGTTTTGCCCCTTTTCCTCCTGCACATCCGGGACAACACGGCGAAATTGCTCTTCTTTCCCTCTCAGCTCTCGCTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGATCGCCGCCCCCTGATTCACTGCTCAAGCTGCTCGGGCTTTTCGGGCTCGTCTTCTTTTAGCTTTTATTATTTTTTTTTTATTTTCATTTTTTTTTACAATGAACAAGCTGTATATTGGAAACCTCAGCGAAAACGTGAGCCCCACGGATTTGGAAAGTCTCTTCAAGGAGTCTAAAATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGNGGACTGTCCGGATGAAACGTGGGCTATGAAGGCCATCGACACCCTATCAGGGAAAGNGGAGTTGCATGGCAAAGGGATTGAAGTCNAACACTCGGNACCCAAAAGGCAAAGGAGTCNAAAGCTTCAAATACGAAACATACCGCCTCATCTAC------------TGGACAGCCTGTTGGCACAGNATGGGACAGNGGAAAACTGTGAGCAAGTGAACACTGAATCAAAAACTGCAG------------CATATGCCAATAAGGAGCACNCTAGACAAGGACTCGAAAAATTAAACGGCTATCACCTGG
  5   1   2       bld Emb1 5g3  in                    IMAGE:3401583.5p              ATTTTATTTAGAGGCGGTGCCTACATTAACGTAGAGTGACATTTTCACAGTCTGCCTGCCAAAAGGATTTGGGGGAAGACAAAAAGTTGttttttttttcctcctccttttttttttttCTTTCTAAGCCCGCCATTCTAGTAAGAGGGAAAAAGGAATCTGTTTTGCCCCTTTTCCTCCTGCACATCCGGGACAACACGGCGAAATTGCTCTTCTTTCCCTCTCAGCTCTCGCTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGATCGCCGCCCCCTGATTCACTGCTCAAGCTGCTCGGGCTTTTCGGGCTCGTCTTCttttagcttttattattttttttttattttcatttttttttACAATGAACAAGCTGTATATTGGAAACCTCAGCGAAAACGTGAGCCCCACGGATTTGGAAAGTCTCTTCAAGGAGTCTAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGTCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTATCAGGGAAAGTG
  5   1   2      seed Ga15 5g3  in                       XL502p10ex.5p                                                                                                                                                                                                            CGGACAACACGCGAAATTGCTCTTCTTTCCCTCTCAGCTCTCGCTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGATCGCCGCCCCCTGATTCACTGCTCAAGCTGCTCGGGCTTTTCGGGCTCGTCTTcttttagcttttattattttttttttattttcatttttttttACAATGAACAAGCTGTATATTGGAAACCTCAGCGAAAACGTGAGCCCCACGGATTTGGAAAGTCTCTTCAAGGAGTCTAAAATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGNGGATACNCGTTTGNGGACTGTCCGGATGAAACGTGGGCTATGAAGGCCATCGACACCCTATCAGGGAAAGNGGAGTTGCATGGCAAAGNGATTGAAGTCNAACACTCGGNACCCAAAAGGCAAAGGAGTCNAAAGCTTCAAATACGAAACATACCGCCTCATCTACAGNGGGAGGNACTGGACAGCCTGTTGGCACAGNATGGGACAGNGGAAAACTGTGAGCAAGTGAACACTGAATCAAAAACTGCAGNAGNGAATGTAACATATGCCAATAAGGAGCACNCTAGACAAGGACTCGAAAAATTAAACGGCTATCACCTGGAAAACTAT
  5   1   1       add Ga15      out                      XL468e01ex.5p                                                                                                                                                                                                                      CGCGAAATTGCTCTTCTTTCCCTCTCAGCTCTCGCTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGATCGCCGCCCCCTGATTTACTGCTCAAGCTGCTCGGGCTTTTCGGGCTCGTCTTCttttagcttttattatttttttttnattttcattttttttACAANGAACAAGCTGTATATTGGAAACCTCAGCGAAAACGNGAGCCCCACGGATTTGGAAAGTCTCTTCAAGGAGTCTAANATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGNGGATACGCGTTTGNGGACTGTCCGGATGAAACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGNGGAGTTGCATGGCAAAGGGATTGAAG
  5   1   2       e50                            Xl3.1-IMAGE:6862521.5                                                                                      GACATTTTCACAGTCCGCCAGCCAAAAGGATTTGGGGGAAGACAAAAAGTAGTTTTTTTTTTCCTCCTCCTTTTTTTTTCTTTCTAAGCCCGCCATTCTAGTAAGAGGGAAAAAAGGGGAAATCTGTTTTGCCCCTTCTCCTCCTGCACATCCGGACAACACGCCAAATTGCTCTTCTTTTTCCCTCTCGCTTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGCCGCCCCCTTTACTCACTGCTCGGGCTCGTTTTCTTTTAGCCTTTTATTGGGTTTTTTTTTTATTTTTTACGATGAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAAGTCTCTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGTCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGTGGGAGGTACTGGACAGCCTATTAGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTTAACACTGATTCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTTGAGAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAATCACCATCCCAGCAGCTTCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGGTCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGTCAGAGGTTCCACTGAGGATGCTGGTGCCCACACAGTTTGTTGGGGCGATCATTGGAAAAGAGGGTGCCACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAAAATGCTGGTGCTGCAGAGAAACCGATTACGATTCACTCAACCCCTGAAGGCTGTTCAGCTGCATGCAAGATCATTATGGAGATCATGCAGAAGGAAGCTCAGGATACCAAGTTCACTGAAGAAATCCCCTTAAAAATATTAGCACATAACAATTTTGTTGGCCGTCTTATTGGGAAAGAAGGAAGGAACCTTAAGAAAATAGAGCAAGACACAGATACCAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCTGAACGGACCATTACAGTAAAAGGCAGCATTGAGACATGTGCCAAAGCCGAGGAAGAAGTCATGAAAAAAATTAGGGAGTCCTATGAAAATGATATTGCTGCTATGAATCTAC
                                                  Xl3.1-CHK-1012689793                                                                                            TTCACAGTCCGCCAGCCAAAAGGATTTGGGGGAAGACAAAAAGTAGTTTTTTTTTTCCTCCTCCTTTTTTTTTCTTTCTAAGCCCGCCATTCTAGTAAGAGGGAAAAAAxGGGxAATCTGTTTTGCCCCTTCTCCTCCTGCACATCCGGACAACACGCCAAATTGCTCTTCTTTTTCCCTCTCGCTTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGCCGCCCCCTTTACTCACTGCTCGGGCTCGTTTTCTTTTAGCCTTTTATTGGGTTTTTTTTTTATTTTTTACGATGAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAAGTCTCTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGTCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGTGGGAGGTACTGGACAGCCTATTAGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTTAACACTGATTCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTTGAGAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAATCACCATCCCAGCAGCTTCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGGTCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGTCAGAGGTTCCACTGAGGATGCTGGTGCCCACACAGTTTGTTGGGGCGATCATTGGAAAAGAGGGTGCCACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAAAATGCTGGTGCTGCAGAGAAACCGATTACGATTCACTCAACCCCTGAAGGCTGTTCAGCTGCATGCAAGATCATTATGGAGATCATGCAGAAGGAAGCTCAGGATACCAAGTTCACTGAAGAAATCCCCTTAAAAATATTAGCACATAACAATTTTGTTGGCCGTCTTATTGGGAAAGAAGGAAGGAACCTTAAGAAAATAGAGCAAGACACAGATACCAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCTGAACGGACCATTACAGTAAAAGGCAGCATTGAGACATGTGCCAAAGCCGAGGAAGAAGTCATGAAAAAAATTAGGGAGTCCTATGAAAATGATATTGCTGCTATGA
  5   1   2       bld Emb4 5g                         IMAGE:4958982.5p GGCTCATTCAAAAAGCCGGAATATTAAAGTGATccccccccccTCTCGATTTTATTTAGAGGCGGCGCCTACATTAACGTAGAGTGACATTTTCACAGTCCGCCAGCCAAAAGGATTTGGGGGAAGACAAAAAGTAGttttttttttcctcctcctttttttttCTTTCTAAGCCCGCCATTCTAGTAAGAGGGAAAAAAGGGGAATCTGTTTTGCCCCTTCTCCTCCTGCACATCCGGACAACACGCCAAATTGCTCTTCTTTTTCCCTCTCGCTTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGCCGCCCCCTTTACTCACTGCTCGGGCTCGTTTTCTTTTAGCCTTTTATTGGGtttttttttttattttttACGATGAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAAGTCTCTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGTCCGGATGAGACGTGGGCT
  5   1   2       bld Oo1  5g                         IMAGE:6643805.5p                                                  AGGCTGGACCGGTCCGGATTCCCGGGATCGTAGAGTGACATTTTCACAGTCCGCCAGCCAAAAGGATTTGGGGGAAGACAAAAAGTAGttttttttttcctcctcctttttttttCTTTCTAAGCCCGCCATTCTAGTAAGAGGGAAAAAAGGGGAATCTGTTTTGCCCCTTCTCCTCCTGCACATCCGGACAACACGCCAAATTGCTCTTCTTTTTCCCTCTCGCTTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGCCGCCCCCTTTACTCACTGCTCGGGCTCGTTTTCTTTTAGCCTTTTATTGGGtttttttttttattttttACGATGAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAAGTCTCTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGTCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGTGGGAGGTACTGGACAGCCTATTAGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTTAACACTGATTCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTTGAGAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAATCACCATCCCAGCAGCTTCAGCAGCCGCAGCAGCAACACCCTTCAGGGAAGGCGGG
  5   1   2       bld Oo1       in                    IMAGE:5078500.5p                                                                                                                      TGGGGGAAGACAAAAAGTAGtttttttttttcctcctcctttttttttCTTTCTAAGCCCGCCATTCTAGTAAGAGGGAAAAAAGGGGAATCTGTTTTGCCCCTTCTCCTCCTGCACATCCGGACAACACGCCAAATTGCTCTTCTTTTTCCCTCTCGCTTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGCCGCCCCCTTTACTCACTGCTCGGGCTCGTTTTCTTTTAGCCTTTTATTGGGttttttttttattttttACGATGAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAAGTCTCTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGTCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4203359.5p                                                                                                                                                                                   CCATTCTAGTAAGAGGGAAAAAAGGGGAATCTGTTTTGCCCCTTCTCCTCCTGCACATCCGGACAACACGCCAAATTGCTCTTCTTTTTCCCTCTCGCTTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGCCGCCCCCTTTACTCACTGCTCGGGCTCGTTTTCTTTTAGCCTTTTATTGGGttttttttttattttttACGATGAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAAGTCTCTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGGCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGTGGGAGG
  5   1   2       bld Egg3 5g3  in                    IMAGE:3378200.5p                                                                                                                                                                                                    AAAAAAGGGGAATCTGTGTTGCCCCTTCTCCTCCTGCACATCCGGACAACACGCCAAATTGCTCTTCTTTTTCCCTCTCGCTTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGCCGCCCCCTTTACTCACTGCTCGGGCTCGttttcttttagccttttattggtttttttttttattttttACGATGAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAAGTCTCTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGTCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGGGGGAGGTACTGGACAGCCTATTATCACAGTATGGGACAGTGGAAAACTGTGAGCATGTTAACACTGATTCAGTAACTGCAGTAGTGAATGGTACATATGCCAATTAGGAGCACGCTGGACTAAGGACTCG
  5   1   2       bld Neu4 5g3  in                    IMAGE:4084375.5p                                                                                                                                                                                                                                           ATCCGGACAACACGCCAAATTGCTCTTCTTTTTCCCTCTCGCTTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGCCGCCCCCTTTACTCACTGCTCGGGCTCGTTTTCTTTTAGCCTTTTATTGGtttttttttttattttttACGATGAACACGCTGTATATTGGAAACCTAAGCGAAAACGTGAGCCCCCCGGATTTGGAAAGTCTCTTCAAGGAGTCGGAAGATCCTTTT
  5   1   2       bld Oo1  5g3  in                    IMAGE:3404748.5p                                                                                                                                                                                                                                                        GCCAAATTGCTCTTCTTTTTCCCTCTCGCTTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGCCGCCCCCTTTACTCACTGCTCGGGCTCGTTTTCTTTTAGCCTTTTATTGGGttttttttttattttttACGATGAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAAGTCTCTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGTCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGTGGGAGGTACTGGACAGCCTATTAGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTGAACACTGATTCAGAAACTGCAGTAGTGAATGTAA
  5   1   0       chi Neu7      in                         XL043h01.5p                                                                                                                                                                                                                                                                     TCCTCCCCTTTCCCTCATTCAATGTCCTAtaaaaaataaattaaaaaaTCAACCCTTAAAGAAATGACATTAAACTTCCCTTCTGCCGCGTCCTAAGGCTTTGGGCTACTCCAACAAGCTGCCCGGGGGTGTGCGAGGTGCATTGCTAGCTATACTGTATATTGGAAACCTCAGCGAAAACGTGAGCCCCACGGATTTGGAAAGTCTCTTCAAGGAGTCTAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGTCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGTGGAGTTGCATGGCAAAGTGATTGAAGTCGAACACTCGGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATACGAAACATACCGCCTCATCTACAGTGGGAGCAACCCAGTTTGGCATTTCCACAGCTATCTGATTGCTAGGGTGCAATTTACTCTAGCAGTCAAGGAGTGGTTTGAACAGAAGGAGAAGAGGGCCTGAATTAACCAATGGAAAGATAAATGGTACTGGACAGCCTGTTGGCACAGTATGGGGACAGTGGAAAACTGTGAGCAAGTGAACACTGAATCAGAA
  5   1   2       bld Neu7 5g3  in                         XL014c07.5p                                                                                                                                                                                                                                                                     GCTTTTTCCCTCTCGCTTTTTGAGTCGAGCAGCGACTACAGACCTGATTTACTGGTTCCTCCGAGCTCGCTCGCCGCCCCCTTTACTCACTGCTCGGGCTCGTTTTCTTTTAGCCTTTTATTGGGttttttttttattttttACGATGAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAAGTCTNTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACNCGTTTGTGGACTGTCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGNGGGAGGTACTGGACAGCCTATTAGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTTAACACTGATTCANAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTA
  5   1   2       chi Ga18 5g                           xlk137c12ex.5p                                                                                                                                                                                                                                                                                                                                                                      GCTCGTTTTCTTTTAGCCTTTTATTGGGttttttttttattttttACGATGAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAAGTCTCTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGTCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGNGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGNGGGAGGNACTGGACAGCCTATTAGCACAGNATGGGACAGTGGAAAACTGTGAGCAAGTGAACACTGATTCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAATAGATATTCACCGTAAAGAAAATGCTGGNGCTGCAGAGAAANCGATTACGATTCACTCAACCCCTGAAGGCTGTNCAGNTGCATGCAAGANCATTATGGAGATCATGCNGNAGGNNGCTCAGGNT
  5   1   2      seed Emb1 5g                         IMAGE:6862521.5p                                                                                                                                                                                                                                                                                                                                                                                                                     GATGAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAAGTCTCTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTCAAAAGTGGATACGCGTTTGTGGACTGTCCGGATGAGACGTGGGCTATGAAGGCCATCGACACCCTCTCAGGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGTGGGAGGTACTGGACAGCCTATTAGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTTAACACTGATTCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTTGAGAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAATCACCATCCCAGCAGCTTCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGGTCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGTCAGAGGTTCCACTGAGGATGCTGGTGCCCACACAGTTTGTTGGGGCGATCATTGGAAAAGAGGGTGCCACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAAAATGCTGGTGCTGCAGAGAAACCGATTACGATTCACTCAACCCCCTGAAAGGCTGTTCAGNCTGCATGCAAGATTCATTAAATGGAGATTCATGCAGAAAGGAAAAGCTCAAGGATA
  5   1   2       add Emb1      in                    IMAGE:3402632.5p                                                                                                                                                                                                                                                                                                                                                                                                                        GAACAAGCTGTATATTGGAAACCTAAGCGAAAACGTCAGCCCCCCGGATTTGGAAGGTCTCTTCAAGGAGTCGAAGATCCCTTTCACCGGGCAGTTTCTGGTAAAAAGTGGATACGCGTTTGTGGACTGTCCCGATGAGACGTGGCCTATAAAGGCCTTGACACCCTCTCAGGGAAAG
  5   1   2       bld Emb4                            IMAGE:5440259.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCACCTGAGAATAGGATCATTCCACCTTTCCCCAACAGGGACGGGCATTTTATCCCTCCTCCCCCTTTTTACCGATGTAGTGGTACCCCCCTGTCAAGGAGACATCCTCGACTCAGCCCTTGCTGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGTGGGAGGTACTGGACAGCCTATTAGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTTAACACTGATTCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTTGAGAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAATCACCATCCCAGCAGCTTCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGGTCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGTCAGAGGTTCCACTGAGGATGCTGGTGCCCACACAGTTTGTTGGGGCGATCATTGGAAAAGAGGGTGCCACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAANATGCTGGTGCTGCAGAGAAACCGATTACGATTCACTNCACCCCTGAA
  5   1   2       bld Emb4                            IMAGE:4680436.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCTGCTACTTTGTTTCTCCCCTTTCTGCAATATATTAAACATTGTCCTTCCACCTCATATTCTCCAGTCCATTGCTCTTCTGTCACTATGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGTGGGAGGTACTGGACAGCCTATTAGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTTAACACTGATTCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTTGAGAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAATCACCATCCCAGCAGCTTCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGGTCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGTCAGAGGTTCCACTGAGGATGCTGGTGCCCACACAGTTTGTTGGGGCGATCATTGGAAAAGAGGGTGCCACC
  5   1   2       bld Int2                            IMAGE:8822510.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCGCTCGGTACAACTAGGAGCCGCCCAGACTCGAATTCGTCCCCCCTGTCAAGGAGACATCCTCGCCTCAGCCCTTGCTGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGTGGGAGGTACTGGACAGCCTATTAGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTTAACACTGATTCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTTGAGAACTATAGCCTGAAAGTGACCTATATACCTGATGAAATGGCAACACCGCAATCACCATCCCAGCAGCTTCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGGTCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGTCAGAGGTTCCACTGAGGATGCTGGTGCCCACACAGTTTGTTGGGGCGATCATTGGAAAAGAGGGTGCCACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAAAATGCTGGTGCTGCAGAGAAACCGATTACGATTCACTCAACCCCTGAAGGCTGTTCAGCTGCATGCAAGATCATTATGGAGATCATGCAGAAAGAAGCTCAGATACCAAGTTCACTGAAGAAATCCCCTTAAAATATTAGCACATAACAATTTTGTTGGCCGTCTTATTGGAAAGAGAAGAACCTTAAGAAAATAGAGCAGACCAGATACAATCACATATCTCACTACAGACTTGACACTGTACAATCCTGAACGGACCATTAACAGTTAAAAGGCAGCAA
  5   1   2       bld Emb9      in                    IMAGE:7976533.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCGGTCCGGATTCCCGGGATCAGCCCTTGCTGGAAAGTGGAGTTGCATGGCAAAGTGATAGAAGTTGAACACTCAGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATAAGGAACATACCACCTCATCTACAGTGGGAGGTACTGGACAGCCTATTAGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTTAACACTGATTCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTTGAGAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAATCACCATCCCAGCAGCTTCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGGTCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGTCAGAGGTTCCACTGAGGATGCTGGTGCCCACACAGTTTGTTGGGGCGATCATTGGAAAAGAGGGTGCCACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAAAATGCTGGTGCTGCAGAGAAACCGATTACGATTCACTCAACCCCTGAAGGCTGTTCAGCTGCATGCAAGATCTTTATGGAGATCATGCAGAATGAAGCTCTAGATACCAGTTCACTGAAGAATTCCCCTTAAAATATTAGCACATAACATTTTTGTTGGCCGTCCTATG
  5   1   2       bld Ga15      in                       XL464o21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTACAGTGGGAGGTACTGGACAGCCTATTAGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTTAACACTGATTCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTTGAGAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAATCACCATCCCAGCAGCTTCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGGTCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGTCAGAGGTTCCACTGAGGATGCTGGTGCCCACACAGTTTGTTGGGGCGATCATTGGAAAAGAGGGTGCCACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAAAATGCTGGTGCTGCAGAGAAACCGATTACGATTCACTCAACCCCTGAAGGCTGTTCAGCTGCATGCAAGATCATTATGGAGATCATGCAGAAGGAAGCTCAGGATACCAAGTTCACTCGAAGNAATCCCCTTAAAAATATTAGCACATAACAATTTTGTTGGCCGTCTTATTGGGAAAGAAGGAAGGAACCTTAAGAAAATAGAGCAAGACACAGATACCAAAATCACAATATCTC
  5   1   2       bld Ga15                               XL402c24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTTGAGAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAATCACCATCCCAGCAGCTTCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGGTCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGTCAGAGGTTCCACTGAGGATGCTGGTGCCCACACAGTTTGTTGGGGCGATCATTGGAAAAGAGGGTGCCACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAAAATGCTGGTGCTGCAGAGAAACCGATTACGATTCACTCAACCCCTGAAGGCTGTTCAGCTGCATGCAAGATCATTATGGAGATCATGCAGAAGGAAGCTCAGGATACCAAGTTCACTGAAGAAATCCCCTTAAAAATATTAGCACATAACAATTTTGTTGGCCGTCTTATTGGGAAAGAAGGAAGGAACCTTAAGAAAATAGAGCAAGACACAGATACCAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCTGAACGGACCATTACAGTAAAAGGCAGCATTGAGACATGTGCCAAAGCCGAGGAAGAAGTCATGAAAAAAATTANGGAGTCCTATGAAAATGATATTGCTGCTATGAATCTACAGG
  5   1   2       bld Oo1                             IMAGE:5084981.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACTCGAAAAATTAAACGGCTATCAGCTTGAGAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAATCACCATCCCAGCAGCTTCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGGTCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGTCAGAGGTTCCACTGAGGATGCTGGTGCCCACACAGTTTGTTGGGGCGATCATTGGAAAAGAGGGTGCCACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAAAATGCTGGTGCTGCAGAGAAACCGATTACGATTCACTCAACCCCTGAAGGCTGTTCAGCTGCATGCAAGATCATTATGGAGATCATGCAGAAGGAAGCTCAGGATACCAAGTTCACTGAAGAAATCCCCTTAAAAATATTAGCACATAACAATTTTGTTGGCCGTCTTATTGGGAAAGAAGGAAGGAACCTTAAGAAAATAGAGCAAGACACAGATACCAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCTGAACGGACCATTACAGTAAAAGGCAGCATTGAGACATGTGCCCAAGCCGGAGGAAGAAGTCATGGAAAAAATTAGGGAAGCCCTATGAAAAATGAAAATTTGCTGCTATGAAATTCTACCGGCAACAATTTGGATTTCCCTGGGTTTAAACCCTGAAAATGCATTTGGGGCCCTTTTTTTCCCACCCAATCCCTCGGTTTAAGGGAAATGTGCCACCCCCACCAATTTCTTGGCCATGGGAAGACTCTCTCCTCCTCTTCCCCCGaaaaaaaaaCATTTCCGGGGCCTTTTTCCTTGTATATTCCCCCACCCTTAttttttttggggggggACCCAAACAA
  5   1   2       bld DMZ                                  xl222f19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCTGCCAGGCAGGGGTCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGTCAGAGGTTCCACTGAGGATGCTGGTGCCCACACAGTTTGTTGGGGCGATCATTGGAAAAGAGGGTGCCACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAAAATGCTGGTGCTGCAGAGAAACCGATTACGATTCACTCAACCCCTGAAGGCTGTTCAGCTGCATGCAAGATCATTATGGAGATCATGCAGAAGGAAGCTCAGGATACCAAGTTCACTGAAGAAATCCCCTTAAAAATATTAGCACATAACAATTTTGTTGGCCGTCTTATTGGGAAAGAAGGAAGGAACCTTAAGAAAATAGAGCAAGACACAGATACCAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCTGAACGGACCATTACAGTAAAAGGCAGCATTGAGACATGTGCCAAAGCCGAGGAAGAAGTCATGAAAAAAATTAGGGAGTCCTATGAAAATGATATTGCTGCTATGAATCTACAGGCACATTTGATTCCTGGTTTAAACCTGAATGCATTGGGCCTTTTCCCACCATCCTCGTCAGGAATGCCACCACCATCTGCTGGAGTTTCCTCTCCGACAACATCTGCTTCTTATCCACCATTTGGGCAGCAGCCAGA
  5   1   2      ests                                 Xl3.1-XL043h01.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAAGTTCACTGAAGAAATCCCCTTAAAAATATTAGCACATAACAACTTTGTTGGCCGTCTTATTGGTAAAGAAGGAAGGAACCTTAAGAAAATTGAGCAAGATACAGATACAAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCAGAACGGACCATTACAGTAAAAGGCAGCATTGAGCCATGTGCCAAAGCCGAGGAAGAAATCATGAAAAAAATTAGGGAGTCCTATGAAAATGATATTGCTGCTATGAATCTCCAGGCACATTTGATTCCTGGTTTGAACCTGAATGCATTGGGCCTTTTCCCATCATCCTCATCAGGAATGCCACCACCTTCTGTTGGAGTTCCCTCACCTACATCATCTACTTCTTATCCACCATTTGGGCAGCAGCCAGAGTCAGAGACCGTTCATCTCTTCATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGCGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTAAAAATGGAAAAAAAAAGGCAAAAAAAGAAAATGAAAAAAAAAAATAAGGTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGTCTTTTTTTTATTGTTCTTATTCCCCCAACAATTTTAGAACTTTGTTTAATGAAGCTTTCTCTTTATGAGTTCTGG
                                                  Xl3.1-CHK-1012686992                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCACTGAAGAAATCCCCTTAAAAATATTAGCACATAACAACTTTGTTGGCCGTCTTATTGGTAAAGAAGGAAGGAACCTTAAGAAAATTGAGCAAGATACAGATACAAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCAGAACGGACCATTACAGTAAAAGGCAGCATTGAGCCATGTGCCAAAGCCGAGGAAGAAATCATGAAAAAAATTAGGGAGTCCTATGAAAATGATATTGCTGCTATGAATCTCCAGGCACATTTGATTCCTGGTTTGAACCTGAATGCATTGGGCCTTTTCCCATCATCCTCATCAGGAATGCCACCACCTTCTGTTGGAGTTCCCTCACCTACATCATCTACTTCTTATCCACCATTTGGGCAGCAGCCAGAGTCAGAGACCGTTCATCTCTTCATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGCGCATCCCCTGTTTGAGGACCAGGCAACCATTAAxxxxxTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTAAAAATGGAAAAAAAAAGGCAAAAAAAGAAAATGAAAAAAAAAAATAAGGTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGTCTTTTTTTTATTGTTCTTATTCCCCCAACAATTTTAGAACTTTGTTTAATGAAGCTTTCTCTTxxxxxx
  5   1   0       add Neu7      in                         XL006m10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAAAGTGGAGTTGCATGGCAAAGTGATTGAAGTCGAACACTCGGTACCCAAAAGGCAAAGGAGTCGAAAGCTTCAGATACGAAACATACCGCCTCATCTACAGTGGGAGGTACTGGACAGCCTGTTGGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTGAACACTGAATCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTGGAAAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAAGCACCATCCCAACAGCTTCAGCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGATCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGACAGAGGTTCCGCTGAGAATGCTGGTTCCCACACAGTTTGTAGGGGCGATCATTGGGAAAGAGGGTGCTACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAAAATGCAGGTGCTGCAGAGAAACCGATTACAATTCACTCAACCCCTGAAGGCTGCTCAGCTGCATGTAAGATCATTATGGAGATCATGCAGAAGGAAGCTCAG
  5   1   2       bld DMZ       in                         xl265c20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAAGTCGAAAGCTTCAGATACGAAACATACCGCCTCATCTACAGTGGGAGGTAAGGTACTGGACAGCCTGTTGGCACAGTATGGGACAGTGGAAAACTGTGAGCAAGTGAACACTGAATCAGAAACTGCAGTAGTGAATGTAACATATGCCAATAAGGAGCACGCTAGACAAGGACTCGAAAAATTAAACGGCTATCAGCTGGAAAACTATAGCCTGAAAGTGACGTATATACCTGATGAAATGGCAACACCGCAAGCACCATCCCAACAGCTTCAGCAGCAGCCGCAGCAGCAACACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGATCCCCTGGTGCTGCTGCAAGACCTAAGCCTCAGACAGAGGTTCCGCTGAGAATGCTGGTTCCCACACAGTTTGTAGGGGCGATCATTGGGAAAGAGGGTGCTACCATCAGGAACATCACTAAACAGACCCAGTCAAAAATAGATATTCACCGTAAAGAAAATGCAGGTGCTGCAGAGAAACCGATTACAATTCACTCAACCCCTGAAGGCTGCTCAGCTGCATGTAAGATCATTATGGAGATCATGCAGAAGGAAGCTCAGGATACCAAGTTCACTGAAGAAATCCCCTTAAAAATATTAGCACATAACAACTTTGTTGGCCGTCTTATT
  5   1   0       add Ga14                              Ga14-p14d11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGGNTCACGCTAGACATGGACTCGATTNATTAAACGGCTATCAGCTGTGCAAATATCAGCCTTNAAAGTGACGTATATACCTGATGAAATGGCAACACCGCANGCACCATCCCAACAGCTTCAGCAGCAGCCGCAGCAGCATCACCCTCAAGGGAGGCGTGGGTTTGGGCAAAGGGGACCTGCCAGGCAGGGATCCCCT
  5   1   2       bld DMZ       in                         xl228j14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCAGGATACCAAGTTCACTGAAGAAATCCCCTTAAAAATATTAGCACATAACAACTTTGTTGGCCGTCTTATTGGTAAAGAAGGAAGGAACCTTAAGAAAATTGAGCAAGATACAGATACAAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCAGAACGGACCATTACAGTAAAAGGCAGCATTGAGCCATGTGCCAAAGCCGAGGAAGAAATCATGAAAAAAATTAGGGAGTCCTATGAAAATGATATTGCTGCTATGAATCTCCAGGCACATTTGATTCCTGGTTTGAACCTGAATGCATTGGGCCTTTTCCCATCATCCTCATCAGGAATGCCACCACCTTCTGTTGGAGTTCCCTCACCTACATCATCTACTTCTTATCCACCATTTGGGCAGCAGCCAGAGTCAGAGACCGTTCATCTCTTCATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGG
  5   1   2       bld DMZ       in                         xl250n17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCAGGATACCAAGTTCACTGAAGAAATCCCCTTAAAAATATTAGCACATAACAACTTTGTTGGCCGTCTTATTGGTAAAGAAGGAAGGAACCTTAAGAAAATTGAGCAAGATACAGATACAAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCAGAACGGACCATTACAGTAAAAGGCAGCATTGAGCCATGTGCCAAAGCCGAGGAAGAAATCATGAAAAAAATTAGGGAGTCCTATGAAAATGATATTGCTGCTATGAATCTCCAGGCACATTTGATTCCTGGTTTGAACCTGAATGCATTGGGCCTTTTCCCATCATCCTCATCAGGAATGCCACCACCTTCTGTTGGAGTTCCCTCACCTACATCATCTACTTCTTATCCACCATTTGGGCAGCAGCCAGAGTCAGAGACCGTTCATCTCTTCATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGG
  5   1   2       bld Neu7      in                         XL013n20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCACGAGGAGCACATAACAACTTTGTTGGCCGTCTTATTGGTAAAGAAGGAAGGAACCTTAAGAAAATTGAGCAAGATACAGATACAAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCAGAACGGACCATTACAGTAAAAGGCAGCATTGAGCCATGTGCCAAAGCCGAGGAAGAAATCATGAAAAAAATTAGGGAGTCCTATGAAAATGATATTGCTGCTATGAATCTCCAGGCACATTTGATTCCTGGTTTGAACCTGAATGCATTGGGCCTTTTCCCATCATCCTCATCAGGAATGCCACCACCTTCTGTTGGAGTTCCCTCACCTACATCATCTACTTCTTATCCACCATTTGGGCAGCAGCCAGAGTCAGAGACCGTTCATCTCTTCATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAG
  5   1   2       bld Tbd7      in                         XL055i04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGGAAGGAACCTTAAGNAAAATTGAGCAAGATACAGATACAAAAATCACAATATCTCCACTACAGGACTTGACACTGTACAATCCAGAACGGACCATTACAGTAAAAGGCAGCATTGAGCCATGTGCCAAAGCCGAGGAAGAAATCATGAAAAAAATTAGGGAGTCCTATGAAAATGATATTGCTGCTATGAATCTCCAGGCACATTTGATTCCTGGTTTGAACCTGAATGCATTGGGCCTTTTCCCATCATCCTCATCAGGAATGCCACCACCTTCTGTTGGAGTTCCCTCACCTACATCATCTACTTCTTATCCACCATTTGGGCAGCAGCCAGAGTCAGAGACCGTCCATCTCTTCATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCT
  3   1   2       bld Emb9      in                    IMAGE:7976533.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTATGTTTTATTTTTTTTTACGGAAGTTGAAATAGACTGAAAAATGGTAGATACGGAATGTGCAGTAACCAAACTGGCTTTCCCATCTATTGAAGCACACATTGTGGGTTCTTCGAAACATTGTTTTTTCACATTGGAGCAGCCAGGTCAGGGAGTTATTTTTAATCCAGCTTAGCTGTGGGAGCAATTTTGTAAGAAGGACAAACATCAACAACTGTGGCGTTTTGCAGAGCATCTTTTAAGATGCACCCGCAGAGGACCGATTGCCAACTAAGAATGGTGATCATCACTGGACATCGTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTTAAAGAAGAAAACTTCTTTGGACCTAAAGAAGAAGTGAAACTTGAGGCCCACATTAAAGTGCCGTCATATGCTGCTGGACGTGTTATTGGCAAAGGAGGCAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAAGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATCAAGTGGTTGTTAAGATAACGGGTCACTTCTATGCTAGCCAGCTTGCACAAAGGAAAATTCAGGAAATACTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAGACAGCGCAAAGTGGACAACCCCAACCAAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATAAAGACAGGTTCCACCTCTGTCTGTGCTACGTGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTC
  3   1   2       bld DMZ       in                         xl228j14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGGAGTTCCNTCACCTACATCATCTACTTCTTATCCACCATTTGGGCAGCAGCCAGAGTCAGAGACCGTTCATCTCTTCATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGCGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTCTCTGAGAATTATAT
  3   1   2      seed DMZ       in                         xl250n17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCACCTACATCATCTACTTCTTATCCACCATTTGGGCAGCAGCCAGAGTCAGAGACCGTTCATCTCTTCATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGCGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTCTCTGAGAAT
  3   1   2       bld DMZ                                 rxl234b09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCACCATTTGGGGCAGCAGCCAGAGTCAGAGACCGTTCATCTCTTCATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGCGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTCTCTGAGAATGTATTATTTAGGCTTCAAAACTT
  3   1   2       bld Neu7      in                         XL013n20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGCAGCAGCCAGAGTCAGAGACCGTTCATCTCTTCATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACCATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGAGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTCTCTGAGAATGTATTATTTAGGCTTTCAAAACTTTTGAAACCCAGNCTTTAAAAAGGnAAAAAAAGGCAAAAAAA
  3   1   2       bld Neu7      in                         XL043h01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGGGCAGCAGCCAGAGTCAGAGACCGTTCATCTCTTCATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGAGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTNCTCTGCAGAATGTATTATTTAGGCTTTCAAAACTTTTGAAACCCAGNCTTTAAAAAnGnAAAAAAAGGCAAAAAAA
  3   1   2       bld DMZ       in                         xl265c20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATCCCAGCTTTAGCTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGCGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTCTCTGAGAATGTATTATTTAGGCTTTCAAAACTTT
  3   1   2       bld Neu7      in                         XL006m10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGAGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTCTCTGAGAATGTATTATTTAGGCTTTCAAAACTTTTAAACCCAGNCTTTAAAAAnGAAAAAAAGG
  3   1   2       bld Tbd7                                 XL070f24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGGGAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAAAGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGAGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTCTCTGAGAATGTATTATTTAGGCTTTCAAAACTTTTAAACCCAGNCTTTAAAAAnGAAAAAAAG
  3   1   2       bld Tbd7      in                         XL055i04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GNAGCGATTATTGGAAAGCAAGGACAACACATCAAACAACTATCACGTTTTGCAGGAGCATCTATTAAGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGAGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTCTCTGAGAATGTATTATTTAGGCTTTCAAAACTTTTGAAACCCAGCTTTAAAAAnGAAAAAAAGGCAAAAAAA
  3   1   2       bld Ga15                               XL516j11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTGCAGGAGCATCTATTAAGATTGCACNTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTNGACCTCCTGAAGCCCNATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGAGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTCTCTGAGAATGTATTATTTAGGCTTTCAAAACTTTGAAACCCAG
  5   1   2       bld Ga15                               XL507c17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCTATTAAGATTGCACCCGCAGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTTAAAGAAGAAAACTTCTTTGGACCTAAAGAAGAAGTGAAACTTGAGGCCCACATTAAAGTGCCGTCATATGCTGCTGGACGTGTTATTGGCAAAGGAGGCAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAAGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATCAAGTGGTTGTTAAGATAACGGGTCACTTCTATGCTAGCCAGCTTGCACAAAGGAAAATTCAGGAAATACTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAGACAGCGCAAAGTGGACAACCCCAACCAAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATAAAGACAGGTTCCACCTCTGTCTGTGCTACGTGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTaaaaatggaaaaaaaaggcaaaaaaagaaaatgaaaaaaaaaa
  5   1   2       bld Gas5                            IMAGE:3749258.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGATTGCACCTGCGGAGGGACCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCA
  3   1   2       bld Emb1 5g3  in                    IMAGE:3401583.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAGATTGCACTGCGGACGCAACCTCATCCCAACTAGGAATGGTGTCATCCTGGACTTCGTGAAGCCCATTNAAGGCTCAACGAAGGGATCTATGGTAAACTAAAAAAGAAAACTTTTTGGGCCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGANAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGNTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGCGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTCTCTGAGAATGTATTATTTAGGCTTTCAAAACTTTTGAAACCCAGCTTT
  5   1   2       bld Ga18      in                       xlk56j12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCCGCAGAGGGNCCTGATGCCAAACTAAGAATGGTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTTAAAGAAGAAAACTTCTTTGGACCTAAAGAAGAAGTGAAANTTGAGGCCCACATTAAAGTGCCGTCATATGCTGCTGGACGTGTTATTGGCAAAGGAGGCAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAAGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATCAAGTGGTTGTTAAGATAACGGGTCACTTCTATGCTAGCCAGCTTGCACAAAGGAAAATTCAGGAAATACTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAGACAGCGCAAAGTGGACAACCCCAACCAAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATAAAGACAGGTTCCACCTCTGTCTGTGCTACGTGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTaaaaatggaaaaaaaaaggcaaaaaaagaaaatgaaaaaaaaaa
  3   1   2       bld Ga18      in                       xlk56j12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCNGCAGAGGGNCCTGATGCCAAACTANNNATNNTGATCATCACTGGACCTCCTGAAGCCCAATTTAAGGCTCAAGNNAGGATCTATGGTAAACTTAAAGAAGAAACTTCTTTGGACCTAAAGAAGAAGTGAAACTTGANNNNCACATTAAAGTGCCGTCATATGCTGCTGGACGTGTTATTGGCAAAGGAGGCAAAACAGTAAATGANCTTCAGAATTTAACAAGTGCAGAAGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATCAAGTGGTTGTTAAGATAACGGGTCACTTCTATGCTAGCCAGCTTGCACAAAGGAAAATTCAGGAAATACTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAGACAGCGCAAAGTGGACAACCCCAACCAAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATAAAGACAGNTTCCACCTCTGTCTGTGCTACGTGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTAAAAATGGAAAAAAAAAGGCAAAAAAAGAAAATGAAAAAAAAAAAATAANTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGTCTTTTTTTTATTGTTCNNNNNNCCCAACAATTTTAG
  3   1   2       bld Ga15 5g3  in                       XL502p10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACTAAGAATGGTGATCATCNCTGGGCCTCNTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGNCGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGCGCATCCCCTGTTTGAGGACCAGGCAACCGATTAAACTGTCTCTGA
  3   1   2       bld Emb1                            IMAGE:3401078.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCACTGACCTCCTGAGCCAATTTAAGGCTCAAGGAGGATGTATGGTAACCTAAAGAGAAACTTCTTGGACCTAAAGAAGAAGTAAACTTTAAGGCNCACATTCGAGTGCCGTCATATGCTGCTGGACGTGTTATGGCAAAAGAAGGCAAAACAGTAAATAACTTCAGAATTTAACAAGTGCAGAAGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATCAAGTGGTTGTTAAGATAACGGGTCACTTCTATGCTAGCCAGCTTGCACAAAGGAAAATTCAGGAAATACTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAGACAGGGCAAAGTGGCCAACCCCAACCAAGAAGAAAATAAAGGTTCAGGAAAATGGCCTTTCCCAGAAGCAGAATGCCAGACCAAAGACAGACTGAGATAAAGACAGGTTCCACCTCTGTCTGTGCTACGTGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTAAAAATGGAAAAAAAAAGGCAAAAAAAGAAAATG
  5   1   2       bld Ga15      in                       XL416c19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGAAGCCCAATTTAAGGCTCAAGGAAGGATCTATGGTAAACTGAAAGAAGAAAACTTCTTCGGACCTAAAGAAGAAGTGAAACTTGAGACCCACATTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCAAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGCGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTCTCTGAGAATGTATTATTTAGGCTTTCAAAACTTTTGAAACCCAGCTTTaaaaatggaaaaaaaggcaaaaaaagaaaaaaaaaa
  3   1   2       bld Emb1      in                    IMAGE:3402632.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCCCAATTAAGGCTCAGGAAGGGATCTATGGTGGACTTAAAGAAGAAAACTTCTTGGGCCCAAATACAAAGTAAACTTGAGCCCACAATTAAAGTGCCGTCATATGCTGCTGAACGTGTTATTGGCAAAGGAGGCAAACCAGTAAATGAACTTCAGAATTTAACAAGTGCAGAAGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATCAAGTGGTTGTTAAGATAACGGGTCACTTCTATGCTAGCCAGCTTGCACAAAGGAAAATTCAGGAAATACTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAGACAGCGCAAAGTGGACAACCCCAACCAAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATAAAGACAGGTTCCACCTCTGTCTGTGCTACGTGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTAAAAATGGAAAAAAAAAGGCAAAAAAAGAAAATGA
  3   1   2       bld Ga15      in                       XL416c19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGAAGANGGTGATNCTTGANACCCNCANTAAAGTGCCGTCATATGCTGCTGGACGGGTTATTGGCNAAGGAGGAAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAGGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATGAAGTGGTCGTTAAGATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGNTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGCGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTCTCTGAGAA
  5   1   2       bld Ga15      in                       XL488o11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGAAGTGAAACTTGAGGCCCACATTAAAGTGCCGTCATATGCTGCTGGACGTGTTATTGGCAAAGGAGGCAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAAGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATCAAGTGGTTGTTAAGATAACGGGTCACTTCTATGCTAGCCAGCTTGCACAAAGGAAAATTCAGGAAATACTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAGACAGCGCAAAGTGGACAACCCCAACCAAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATAAAGACAGGTTCCACCTCTGTCTGTGCTACGTGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTaaaaatggaaaaaaaaggcaaaaaaaagaaaatgaaaaaaaaaa
  3   1   2       bld Oo1  5g3  in                    IMAGE:3404748.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCCACATTAAAGTGCCGTCATATGCTGCTGGACGTGTTATTGGCAAAGGAGGCAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAAGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATCAAGTGGTTGTTAAGATAACGGGTCACTTCTATGCAAGCCAGCTTGCACAAAGGAAAATTCAGGAAATACTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAGACAGCGCAAAGTGGACAACCCCAACCAAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGAATGAGATAAAGACAGGTTCCACCTCTGTCTGTGCTACGTGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTAAAAATGGAAAAAAAAAGGCAAAAAAAGAAAATGA
  3   1   2       bld Neu4 5g3  in                    IMAGE:4084375.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGCCGTCATATGCTGCTGGACGTGTTATTGGCAAAGGAGGCAAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAAGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATCAAGTGGTTGTTAAGATAACGGGTCACTTCTATGCTAGCCAGCTTGCACAAAGGAAAATTCAGGAAATACTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAGACAGCGCAAAGTGGACAACCCCAACCAAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGGCCAAAGACAAACTGAGATAAAGACAGGTTCCCCCTCTGTCTGTGCTACGAGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTAAAAATGGAAAAAAAAAGGCAAAAAAAGAAAATGAAAAAAAAAAAATAAGGTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAGACCATGTTAGTCTTTTTTTTATTGTTCTTATTCCCCCAACAATTTTAGAACTTTGTTTAATGAAGCTTTCTCTTATGAGTTCTGGTTCAAA
  3   1   2       bld Ga18      in                      xlk105c12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACGTGTTATTGGCAAAGGAGGCAAAACAGTAAATGANCTTCAGAATTTAACAAGTGCAGAAGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATCAAGTGGTTGTTAAGATAACGGGTCACTTCTNNNNAGCCAGCTTGCACAAAGGAAAATTCAGGAAATACTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAGACAGCGCAAAGTGGACAACCCCAACCAAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATAAAGACAGNTTCCACCTCTGTCTGTGCTACGTGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTAAAAATGGAAAAAAAAAAAGGCAAAAAAAGAAAATGAAAAAAAAAAAAGNTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGTCTTTTTTTTATTGTTCNNNNCNCCCANNAATTTTAGANC
  5   1   2       bld Ga18      in                      xlk105c12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTATTGGCAAAGGNGGNAAACAGTAAATGAACTTCAGAATTTAACAAGTGCAGAAGTTGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATCAAGTGGTTGTTAAGATAACGGGTCACTTCTATGCAAGCCAGCTTNNACAAAGGAAAATTCAGGAAATACTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAGACAGCGCAAAGTGGACAACCCCAACCAAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATAAAGACAGGTTCCACCTCTGTCTGTGCTACGTGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTaaaaatggaaaaaaaaaaaggcaaaaaaagaaaatgaaaaaaaaaaaaGGTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGNCttttttttATTGTTCTTATTCCCCCAACAATTTTAGAACTTTGTTTAATGAAGCTTTCTCTTATGAGTNCTGGNTCaaaaaaaaaa
  3   1   2       bld Egg3 5g3  in                    IMAGE:3378200.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGGCAAACCAGTAAATGACTTCAAGAATTTACCAAGTGCAGAAGTGGTTGTGCCCCGTGATCAAACACCAGATGAAAATGATCAAGTGGTTGTTAAGATAACGGGTCACTTCTATGCTAGCCAGCTTGCACAAAGGAAAATTCAGGAAATACTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAGACAGCGCAAAGTGGACAACCCCAACCAAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATAAAGACAGGTTCCACCTCTGTCTGTGCTACGTGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTAAAAATGGAAAAAAAAAGGCAAAAAAAGAAAATGAAAAAAAAAAATAAGGTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGTCTTTTTTTTATTGTTCTTATTCCCCCAACAATTTTAGAACTTTGTTTAATGAAG
  3   1   2       bld Oo1       in                    IMAGE:5078500.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGTGATCAAACACCAGATGAAAATGATCAAGTGGTTGTTAAGATAACGGGTCACTTCTATGCAAGCCAGCTTGCACAAAGGAAAATTCAGGAAATACTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAGACAGCGCAAAGTGGACAACCCCAACCAAGAAGAA
  3   1   2       bld Emb4 5g3  in                    IMAGE:4203359.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTAAGATACCGGGTCACTTCTATGCTAGCCAGCTTGCACAAAGGAAAATTCAGGAAATACTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAGACAGCGCAAAGTGGACAACCCCAACCAAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATAAAGACAGGTTCCACCTCTGTCTGTGCTACGTGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTAAAAATGGAAAAAAAAAGGCAAAAAAAGAAAATGAAAAAAAAAAATAAGGTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGTCTTTTTTTTATTGTTCTTATTCCCCCAACAATTTTAGAACTTTGTTTAATGAAGCTTTCTCTTATGAGTTCTGGTTCAA
  3   1   2       bld Ga15      out                      XL491i18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATAACGGGTCACTTCTATGCAAGTCAGCTTGCACAAAGGAAAATTCAGGAAATATTGGCTCAGGTAAGAAGACAGCAGCAGCAACAGCAGAAAACAGTGCAAAGTGGACAACCCCAACCGAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATGAAGACAAATTCCACTTCTTGTCCCTGCTATGTGGGAAGAATACCACCTAGAGCATCCCCTGTTTGAGGACCAGGCAACCATTAAACTGTCTCTGAGAATGT
  5   1   2       bld Ga15                               XL424k20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCAAAGTGGACAACCCCAACCAAGAAGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATAAAGACAGGTTCCACCTCTGTCTGTGCTACGTGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTaaaaatggaaaaaaaaggcaaaaaaagaaaatgaaaaaaaaaaaaTAAGGNCCCCTTCNCTTCCCTTTTGATCTATTCTCNCAAGTTAACNTAANCCTNGTTAGNCttttttttATNGTTCTTATTCCCCCAACAATTTTAAAACTTTGTTTAATGAAGCTTTCTCTTATGAGTTCNGGTTCaaaaaaaaaa
  5   1   2       bld Tad2                            IMAGE:6871716.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAAAATAAAGGTTCAGGAAAATGGCCCTTCACAGAGACAGATGCCAGACCAAAGACAGACTGAGATAAAGACAGGTTCCACCTCTGTCTGTGCTACGTGGGAGGAAAACCACCTAGTACATCCCCTGTTTGAGGACCAGGCAACCATTGAACTGTCTCTGAGAATGTATTATTTAGGCTCTCAAAACTTTTGAAACCCAGCTTTaaaaatggaaaaaaaaaggcaaaaaaagaaaatgaaaaaaaaaaaaTAAGGTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGTCttttttttATTGTTCTTATTCCCCCAACAATTTTAGAACTTTGTTTAATGAAGCTTTCTCTTATGAGTTCTGGTCCN
  3   1   2       add Neu7 5g3  in                         XL014c07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GNATTATTTNGGCNCTCNAAACTTTTNAAACCCNGCNTTTAAAAnGGAAAAAAAAAGGCnAAAAAAAGAAAATGAAAAAAAAAAAATAAGGTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGTCTTTTTTTTATTGTTCTTATTCCCCCAACAATTTTAGAACTTTG
  3   1   2       add Ga12                                 XL150l23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GNATTATTTAGGNTCTCNAAACTTTTNNAACCCNGCTTTTAAAATGGNAAAAAAAGGCnAAAAAAGAAAATTAAAAAAAAAAAATAAGGTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGTCTTTTTTTGA
  3   1   2       add Ga15      in                       XL488o11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGNTTTCNAAACTTTTGGAACCCNGNTTTNAAAATGGnAAAAAAAGGCnAAAAAAAGnAAATGAAAAAAAAAAAATAAGGTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGTCTTTTTTTTATTGTTCTTATTCCCCCAACAATTTTAGAACTTTGTTAA
  3   1   2       add Ga15      in                       XL464o21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TNNAAACTTTTGNAACCCNGNTTTNAAAATGGGAAAAAAAGGCnAAAAAAGnAAATGnAAAAAAAAAAATAAGGTCCCCTTCACTTCCCTTTTGATCTATTCTCACAAGTTAACATAAACCTTGTTAGTCTTTTTTTTATTGTTCTTATTCCCCCAACAATTTTAGAACTTGTTAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)