Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl256g02.3                           19 END     1           1        5                hypothetical protein LOC100124833 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:7974082.5                       9 PI      88         92      317                MGC80861 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 90%

 1012837652 Xl3.1-xl310i08.5.5 - 54 ESTs
                                                                       ..-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xl310i08.5.5                                           AGACAGGGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCTCGTGCCACCAGGAAGGCCGTGTGGCCAGGAATCCCGACAAGTCCAAGACTGCACCTCTCTGCCCTTCTGCCCAGTTGCTGGAGGTTGGGGGGCC------------------------GTCACGTGCGGC------------AGAGAAAAGCGGCTCTGTGATTCCCCGGCCCCCAAATATGGTGGGAGACATTGTGAGGGATCCAACACCCGGCAATTTATGTGCAATACAAAGGTGGGCTGTCCAGTCGATGGGAAGTGGAGCCAGTGGCAGCCGTGGAGCCCGTGTGCCCGTCTGCAGGAGAATATAGCGTGCTCCACCAAAGTGGGGACCCAGAACAGGAAACGGGAGTGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACTTACTGTAATAAACATCTCATTTGCATT
                                                  Xl3.1-CHK-1012722716                                                 GGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCTCGTGCCACCAGGAAGGCCGTGTGGCCAGGAATCCCGACAAGTCCAAGACTGCACCTCTCTGCCCTTCTGCCCAGTTGCTGGAGGTTGG------------------------------------TGCGGCATTGGACGGATCAGAGAAAAGCGGCTCTGTGATTCCCCGGCCCCCAAATATGGTGGGAGACATTGTGAGGGATCCAACACCCGGCAATTTATGTGCAATACAAAGGTGGGCTGTCCAGTCGATGGGAAGTGGAGCCAGTGGCAGCCGTGGAGCCCGTGTGCCCGTCTGCAGGAGAATATAGCGTGCTCCACCAAAGTGGGGACCCAGAACAGGAAACGGGAGTGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACTTACTGTAATAAACATCTCATTTGCATTTTAAAA
                                                      consensus depths                                                4     8    14    21    16    22    17    24    19    24    21    25    22    25    21    25    23    25    22    25    23    25    22    25    20    26    22    26    24    26    24    26    23    26    25    27    25    27    26    27    26    27    27    27    27    27    27    28    27    28    27    27    25    27    25    27    26    27    26    27    26    27    25    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    25    26    26    26    25    26    25    26    25    26    21    25    22    25    20    25    21    25    19    23    19    23    18    23    18    24    16    23    16    23    14    23    12    22    12    22    13    22     8    21     3    16     3    16     3    14     3    13     3    12     3    12     2    11     0    10     0     8     2     7     0     6     2     6     2     5     3     6     3     7     4     7     3     8     4     8     5     9     5    11     5    11     5    14     7    15     6    14     8    15     9    15     9    15     8    15     9    15    10    15    10    15    10    16    12    16    13    17    13    17    15    18    15    18    15    18    14    18    16    18    16    17    16    17    16    17    17    18    16    18    18    18    18    18    18    18    18    18    19    19    20    20    21    21    21    21    21    21    21    21    21    21    21    21    19    21    20    21    20    21    20    21    22    23    21    23    21    23    21    23    21    23    21    22    21    22    21    22    21    22    21    22    21    22    22    23    22    23    22    23    22    23    22    23    21    22    20    22    20    22    20    22    20    22    19    22    18    21    15    19    11    15     7    11     6     8     5     6
  5   1   2      ests                                 Xl3.1-xl310i08.5                                                 GGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCTCGTGCCACCAGGAAGGCCGTGTGGCCAGGAATCCCGACAAGTCCAAGACTGCACCTCTCTGCCCTTCTGCCCAGTTGCTGGAGGTTGG
  5   1   2      ests                            Xl3.1-IMAGE:8070573.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGCCCCCAAATATGGTGGGAGACATTGTGAGGGATCCAACACCCGGCAATTTATGTGCAATACAAAGGTGGGCTGTCCAGTCGATGGGAAGTGGAGCCAGTGGCAGCCGTGGAGCCCGTGTGCCCGTCTGCAGGAGAATATAGCGTGCTCCACCAAAGTGGGGACCCAGAACAGGAAACGGGAGTGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACTTACTGTAATAAACATCTCATTTGCATT
                                                                   SNP                                                                                                                                                       --T---------
                                                                   SNP                                                                                                                                                                                           -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                               -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --------G---
                                               BLH ATG      33     263                                           
                                               BLH MIN      21     151                                           
                                               BLH OVR      33      59                                           
                                               EST CLI      -5      62                                           
                                               ORF LNG      33       8                                           
  5   1   2      ests                                 Xl3.1-xl310i08.5                                                 GGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCTCGTGCCACCAGGAAGGCCGTGTGGCCAGGAATCCCGACAAGTCCAAGACTGCACCTCTCTGCCCTTCTGCCCAGTTGCTGGAGGTTGG
                                                  Xl3.1-CHK-1012688280                                                       GTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCTCGTGCCACCAGGAAGGCCGTGTGGCCAGGAATCCCGACAAGTCCAAGACTGCACCTCTCTGCCCTTCTGCCCAGTTGCTGGAGGTTGGGGGGCC
  5   1   2       bld Panc 5g                         IMAGE:8737181.5p GGAGGGCTCTTCGGAGATGTCATCATATTCGAATTCGTCCCGAGACAGGGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAAGTTAATTGTAACACCCAGCAGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGTTCCGAATTTTCCCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCTCGTGCCACCAGGAAGCCGTGTGCAGATCCCGACAGTCAGACTGCACCTCTCTGCCTTCTGCCAGTGCTGAGTGGGGGCTGCCAGCAGACTCCTGATGTTCCGGTCACGTGCGCATGACCGATCAGAAACGACTTGCATCCGTTAATTGTGGAACTTGTAGGAT
  5   1   2       chi Eye1      in                    IMAGE:6948467.5p       gngngngggggggngggggAAGGTANGGAATTTTCCAGAGAGGGAATTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTTGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCACTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTTGCCCCACACACCGGGCCCTGGGGCCATTGGGGGTCCTGTGGGGGTCAAATGCCTTCTGAAATCCCTGCAACAAACGGAAAGGGTTTTCCGGAAATTTTTCCCGCTGGTTTCAAAACCTTCGCCCCGGGCGCCCCTGGTGGCAAACATACCCCCGTTCTACCCCCTCTCCCTTCGATGGCCCCACCTAGGAAAAAGGGCCCGTTGGTTGGGCTCCACGTGAAAATTCCCTGTACCCAAGGCTCCCAAAGGAACCTGGCCCACCCTCCTTCCTGGCCCCTTTTTCTTGCCCCCTATTTTTGTCTTTGGGAAGGGTTTGTGCggggggggTCTCTGGGGCCCAGTCCTCAAAAACCTCTTTGAAATATGGCTTTTCCGGTTCTCACCCGGTGGCCCGGGNCTATTATGTGGAACCGCGGATTCCTCCGTTAGTAAAAACGCGCCCCGGGTCCTCCTCTGGTTGTATATTTTCCCCCCGGGGGGCGGCCCCTCAATATAATATATCGGGGTGGTGCAGGAAACACAACTATTTTCGGTCGTGAGAGGGAGGATTTTCCAGAGAACCACGCGGTAGGGGAGCGACATTTTTCTTTGTGGGTCTGCGCAGTTTTCACCAGCTACGGG
  5   1   2       bld DMZ  5g3  in                         xl276g07.5p                            CTCATTGTGGGGCANAGACAGGGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCGTGTGTTACANTGACTTTGACGAGAGGTCNGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCANAGAANAGATANGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCANAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAA
  5   1   2       bld Emb4 5g                         IMAGE:5514744.5p                                 CCCACGCGTCCGCCCGGTACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTTGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCTCGTGCCACAGGAAGGGCGTGTGNGCAGGAATCCCGACAGTCCNAGACTGCACCTCTCTGCCCTTCTGCCAG
  5   1   2       bld Ga15 5g3  in                       XL427f16ex.5p                                   TGGGGCAGAGACAGGGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAATACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCANTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCANCANGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGC
  5   1   2       bld Em10 5g                         IMAGE:7979420.5p                                        GAGACAGGGAGTTGGTTCTCTGCGTTCGGCCCAGGCGCAGAGATGTCCGTGGTGCGTGTAGCGCTGGTGTGGGCTCTCGGGGCCCTCCGGCCATTCGCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCGCTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTNCATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAAACTCGCAGCGTCAGTGCAACACCCGTCACCCTCCTCGTGCCCACAGAAGGCGTGTGGCAGAATCCGACAGTCAAGATGCACTCTCTGCCTCTGCCAGTGCTGGAGTGGGGGCTGCNACAAATCTATGTCGTCCTGCGCATGGAGATCAAAAACGCCTTATCCGGCCCATTG
  5   1   2       bld Em10 5g                         IMAGE:7982761.5p                                          GAGACAGGGAGTTGGGTCTCTGCGTTCGGGCCACGCGAGGATGTCTGTGGTGCGTGTAGCGCTGGTGTGGGCTCGCGGGGCCCTCCGGCCGTTCGCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCGCTCATTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAAGTTCCGGAATTTTCCCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCTCGTGCAACCAGGAAAGCCGTGTGGCCAGGAATCCGACAGGTCAA
  5   1   2       bld Emb9 5x                         IMAGE:7975355.5p                                           CAGGGACTTGGTTCGCTCCGTTCCCCCCGGGCCAAAGTGTCCGTCGTGCGTGTAGCTGTGCTGTGGGCGCTCGGGGCGCTCCGTGCCGGTCGTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGAGGAGAGGTCGGGGGGCTGCACGCGGTACCTCGGGGAGGGGGTGAGTGAGGGCGACTGCTGCCGGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCGCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCGCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTAATTGTAACACCCAGCAGGTTTGCCCCACAACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCATTCTCTGATCCTGCACAAGGAAAGTCCGGATTTTCCTGTTCAATCCCAGCGCAGTGCACAACCCTCACCTTCCTCTGCCACAGAAGCCTGGGCCAGAATCCGACATCTATACTGACTTTTGTT
  5   1   2       bld Emb9 5g                         IMAGE:7975594.5p                                            CAGGGACTTGTTTCGCTCCGTGTCCCCCGAGGCCAAAGTGTCCGTCGTGCGTGTAGCTCGTGCTGTGGGCTCTCGGGGCGCTCCTGCCGTTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACCAGAGGTCGGGGGGCTGCACGCGGTACCTCGTGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAGGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCGCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAATCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAATGGAAAAGGGTAATTGTAACACCCAGCATGTTTGCCCCACACACGGTGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACTGAATGTCCCGAATTTTCTCTGTTCAACTCGCTTACGTCATTGCACACCCGTCACCTTCCTTCTGCCACATGAAGGCTTGTGGTCATATCCCGACAAGCAAAATTGtttttttccttttCCAATG
  5   1   2       bld Em10 5x                         IMAGE:8321593.5p                                            AGAACAGGGACTTGTTTCTCTCCGTTCCCCCCGGGCCAAAATGTCCGTCGTGCGGGTAGCTCTGCTGTTGGCTGGGGGGCCGTCCTGCCAGTCTCAGGGTCGGAGGAAGTCGTGTGTTACAGTTGACTTTGACGAGAGGTCGGGGGGGTGCACTCGTGACGTCGGGGAAGGGGTGAGTGAGGCGACTGCTGCCTGAATATCAAGTACAGCTTCGAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATGGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCGCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCATGTTTGCCCCACACACGGGGCCTGGGGCAATTTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCATAAACGGAAGGTTCCGGAATTTTCCCCTGTTCAA
  5   1   2       bld DMZ  5g3  in                         xl310i08.5p                                            GACAGGGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAANCTCGCCAGCGTCAGTGCAACAACCCGTCACCCTCCCTCGTGCCACNAGGAAGG
  5   1   2       bld Sp1  5g                         IMAGE:5511066.5p                                             ACAGGGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTTGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACACAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAACTCGCCAGCGCCAGTGCAATCACTCGTCACCCTCTCTCGTGCCACCAGGAAGGCCGTGTGGCCAGGAATCCCGACAAGTCAAGAC
  5   1   2       bld Emb4 5g                         IMAGE:5515043.5p                                             ACAGGGACTTGCTTTTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTATCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAATACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCNCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCTCGTGCCACCAGGAAGCCGTGTGGCCAGGAATCCCGACAAGTCCAAGACTGCACCTCTCTGCCCTTCTGCCAGTTGCTGGAGGTTGGGGGGCCTGCCAC
  5   1   2       bld Emb4 5g3  in                    IMAGE:4960306.5p                                              CAGGGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTTGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAATACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAAGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCC
  5   1   2       bld Sp1  5g                         IMAGE:5511244.5p                                              CAGGGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTTGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTNCAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCTCGTGCACCAGGAANGGCGTGTGGNCTAGAAATCCGACNAGTCCAAGACTGCACCTCTCTGCCCTTCTGTCCAGTTGCTGGNAGTTGGGGGGNCCTGCAGCAGACTCTGA
  5   1   2       bld Ga15      in                       XL418i05ex.5p                                              CAGGGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAATACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCANCANGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACNGAAGGTTCCGGAATTTTCCCTGTTCAAACTCNCCANCNCCANTGCAACAACCCNTCACCCTCCCTCNTGCCACCANGAANGC
  5   1   2       bld Spl  5g                         IMAGE:8460040.5p                                              CAGGGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAATACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAACTCGCCAGCGCCAGTGCAACACCCGTCACCCTCCTCGTGCCACAGGAAGGCGTGTGGGCAGAATCCGACAGTCAAGATGCACTCTCTGCCTCTGCCAGTGCTGGAGTGGGGGCTGCAGCAACTCGATGTCGTCCTGCGCATGACGA
  5   1   2       bld FaB  5g3  in                    IMAGE:8070573.5p                                               CAGGGACTTGTTTCTCTCCGTTCCCCCCGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCGTTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAATACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCTCGTGCCACCAGGAA
  5   1   2       bld FaB  5g                         IMAGE:8073193.5p                                                GGGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTTGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAATACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTTCAACTCGCCAGCGCCAGTGCAACAAACCGTCACCCTCCCTCGTGCCACCAGGAGGC
  5   1   2       bld DMZ  5g                              xl310d05.5p                                                GGACTTGTTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTTGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACACAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCTCGTGCCACCAGGAANGC
  5   1   2      seed DMZ  5g3  in                         xl272g02.5p                                                 GGACTTGTTTCTCTCCGTTCCCCCCAGGCCAAAATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTTGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACACAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCT
  5   1   2       bld Neu7 5g3  in                         XL001f15.5p                                                                 GGTTCCCCCCAGACCAAANGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTTGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACACAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGT
  5   1   2       bld Spl       in                    IMAGE:8463618.5p                                                                     AAATNGNNNCCTGCTTNCNNNGAAGACCATAAAATAAATTCGTCCCCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAATACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCTCGTGCCACCAGGAAGGCCGTGTGGCCCAGGATCCCGACAAGTCCAAGACTGCACCTCTCTGCCCTTCTGCCCAGTTGCTGGAGGTTGGGGGG
  5   1   2       bld Sp1                             IMAGE:4175755.5p                                                                              CACGCGTCCGGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAATACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTTATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTTAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACAC
  5   1   2       bld FaBN                            IMAGE:8076292.5p                                                                                                     CTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTCTTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCTATACCTCCGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGACCCTCTGGAGCCCTTGCACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCTAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCGGTGGAAAAGGTTAATTGTAACACACATCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTTGGGGTCTGTGGGGTCTATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAAACTCGCCAGCCCCAGTGCAACAACCCGTCACCCCTCCCTCGTGCCACAAGAAGGCCGTGTGGCCAGGAATCCCGACAAGGCGCAGGACTGCACCTCTCCGCCCTTCTCCCATCTGCTTGGAGGGTGGGGGAGCCTAGACACCAGACTTCTGATGTTCG
  5   1   2       bld Neu7      in                         XL027m09.5p                                                                                                                                                                                          GGGCTGCACTCAATACCTCGNGGAAGGGGTGAGTGAGGGCGACTGCTGNCTGANTATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGG
  5   1   2       bld Emb4                            IMAGE:5537429.5p                                                                                                                                                                                                                                                TATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAATGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGGGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCTCGTGCCACCAGGAACGCCGTGTGGCCACGAATCCCGACAAGTCCAAGACTGCACCTCTCTGCCCTTCTGCCCAGTTGCTGGAGGTTGGNGGGCCCTGccccccccgatcgtgatgcccccgccccggccgcccttccgccgccccccgccggcgcggcgtcccgggntcccccggcccccAACTATCGCGGGGCATCCCTCCCCATGGATCCCACCCCCCGGCCCTTTTTTCTCCCATCCCACGCCTGCGCCTCCTCCACCCCGATCGGAACCTGCAGCCCACCCGTCCTTCTTTGGACGCCCGCGTGGCCCTATCTCCCCCGAGAATAACCCCCCGTTCGCCCTTCCACGCGGCGCCACCCCCACCCTTCAACACCCCGCACGCGGTAAGCCACAACAAACCCTGCGCCGCACCAAtccccccttacctcccccccAGCATGAATAATCCCCCACTTCCCTTTGCCCACCAAGTCCTCTCCG
  5   1   2       chi Em10      in                    IMAGE:7983328.5p                                                                                                                                                                                                                                                                                                                      AGAGCCTCTGGAGCGGTTGTAGTGTGTGGGCGTCTGAGTGGTGTTCCAGGGAATATAGGGTCGGCACTTGTCAAGGGGAGTGCCATGGATAAGGCCGTGTGGGTCAAACCGTTTTCCGTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGCAATTGGGGTCTGTGGGGTCAATGCTCTGAATCCTGCACAACGGAAGGTTCCGGAATTTTCCCTGTTCAAACTCGCCAGCGCCAGTGCAACAACCCGTCACCCTCCCTCGTGCCACCAGGAAGGCCGTGTGGCCAGGAATCCCGACAAGTCCAAGACTGCACCTCTCTGCCCTTCTGCCCAGTTGCTGGAGGTTGGGGGGCCTGGCAGCCAGACTCTGAATGTTCGGTCACGTGCGGCATTGGACGGATCAGAGAAAAGCGGCTCTGTGATTCCCCGGCCCCCAAATATGGTGGGAGACATTGTGAGGGATCCAACACCCGGCAATTTATGTGCAATACAAAGGTGGGCTGTCCAGTCGATGGGAAGTGGAGCCAGTGGCAGCCGTGGAGCCCGTGTGCCCGT
  5   1   2      ests                            Xl3.1-IMAGE:8070573.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGCCCCCAAATATGGTGGGAGACATTGTGAGGGATCCAACACCCGGCAATTTATGTGCAATACAAAGGTGGGCTGTCCAGTCGATGGGAAGTGGAGCCAGTGGCAGCCGTGGAGCCCGTGTGCCCGTCTGCAGGAGAATATAGCGTGCTCCACCAAAGTGGGGACCCAGAACAGGAAACGGGAGTGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACTTACTGTAATAAACATCTCATTTGCATT
                                                  Xl3.1-CHK-1012688573                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCAAATATGGTGGGAGACATTGTGAGGGATCCAACACCCGGCAATTTATGTGCAATACAAAGGTGGGCTGTCCAGTCGATGGGAAGTGGAGCCAGTGGCAGCCGTGGAGCCCGTGTGCCCGTCTGCAGGAGAATATAGCGTGCTCCACCAAAGTGGGGACCCAGAACAGGAAACGGGAGTGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACTTACTGTAATAAACATCTCATTTGCATTTTAAAA
  3   1   2       chi Eye1      in                    IMAGE:6948467.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGTTTTGTCGGGGTTGTTACATTTGGTATTAGAGGGGACACATTTTGATGGACCGGTGGTATCTCTTAGGTAGGGAAAAAAGGTCGCTGGATTACTTGTGTAGAGATTTATTCCCCCCCGGTGGCTCCCCCCCCAAAAAAATTTTTGTGTTGGGGGTAGAGATCGCATTATTCGTGGGTGCGAAAGTTCCAAACACACCCCCCCCGGGGCCAAATTTGTTATTGGTGCCGCATTTCGTTCAATAGGGGTGTGGGGGCGTTGTCTCCCATTGTTAGAATGTGGGGAGAAAGGTGGGGAAGGCCCAATGTAGGCACAAGTCCTTTGGGAATGACTCCCCTCGTCGCCCCCCTTCTTGCCCAGGGAAGGAATTATAAGGGCGTTGGATTCCCACCCAAAAGTTGTGGGGACCCCAGAACCAGGGAAAACGGGGAGTTGCGAAAGGAGAGAAAATTACGGGGGGGAAAATGGTGGCGAGTCCCCACCACAAGGGAGAAGCGGCCAATTGTTACAACGTGGACGGGGTGTTCCTTGGAGGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTGGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGACCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTGTGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGTGGAAACAGGGACTATTATTAGCTTCATTTACTTGAAGCNGACGAAAAnnnnnnnnGGGGAAGGN
  3   1   2       bld Ga18                              rxlk78j11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CNGNANTTNCTGNNNNNNGGGGGNCTGGCAGCNANNNCNGAATGTTNGGTNACGTGCGGCATNGGACGGNTCAGAGAAAAGNGGCTCTGTGATNCCCCGGCCCCCAAATATGNTGGGAGACATTGTGAGGGNNCCAACACCNGGCAATTTATGTGCAATACAAAGGTGGGCTGTCCAGTCGATGGGAAGTGGANCNAGTGGCAGCCGTGGAGCCCGTGTNNCCGTCTGCAGGAGAATATANCGTGCTCCACCAAAGTGGGGNCCCAGANNAGNNAACGGGAGTGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGANNCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGNNCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGNCTACCCGGAGNCCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCANCNCCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGNTCACAACTATATGAGAANTC
  5   1   2       bld Brn3                            IMAGE:8538174.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGATTCCCCGGCCCCCAAATATGGTGGGAGACATTGTGAGGGATCCAACACCCGGCAATTTATGTGCAATACAAAGGTGGGCTGTCCAGTCGATGGGAAGTGGAGCCAGTGGCAGCCGTGGAGCCCGTGTGCCCGTCTGCAGGAGAATATAGCGTGCTCCACCAAAGTGGGGACCCAGAACAGGAAACGGGAGTGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGAC
  5   1   2       bld Emb4                            IMAGE:4960125.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACGCGTCCGATGGTGGGAGACATTGTGAGGGATCCAACACCCGGCAATTTATGTGCAATACAAAGGTGGGCTGTCCAGTCGATGGGAAGTGGAGCCAGTGGCAGCCTTGGAGCCCGTGTGCCCGTCTGCAGGAGAATATAGCGTGCTCCACCAAAGTGGGGACCCAGAACAGGAAACGGGAGTGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGA
  3   1   2       bld Spl       in                    IMAGE:8463618.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTAAAAAGGTTTGTCCCGGCCAATGGGGAGCATGGGGACAACCCGGCATTATGCAATAAAGTGGCGTCATGAAGGAATGAGCAGTGCACCGGGAGCCCGTTGCCGTCGCAGGAGATAAGCGTGCTCACCCAAGTGGGACCAGACAGGAAACGGAGTGCGAGGAGAGAATACGGGGGAAATGGTGCGATCCCACCACAGGGAGAGCTGCAATTGTTACAACGTGGACGTGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATAGAAATCACTACTGATAACACCTCT
  5   1   2       bld Skin                            IMAGE:8643285.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATTTATGTGCAATACAAAGGTGGGCTGTCCAGTCGATGGGAAGTGGAGCCAGTGGCAGCCGTGGAGCCCGTGTGCCCGTCTGCAGGAGAATATAGCGTGCTCCACCAAAGTGGGGACCCAGAACAGGAAACGGGAGTGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCA
  3   1   2       chi Ga15      in                       XL418i05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACCCAGAACAGGAAACGGGAGTGNGAAGGAGAGAAATACGGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGTAAGTACCGCCCCACTAGCCATGAGTGTGAGTATTAGTGAGCTCCAACTGCCGCCTCTTGGCTGCCACACCACTGTCTCTACTCTCTCCCTAGGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACTA
  5  -1   2       bld Emb4                            IMAGE:4970976.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGCATACAAGTGGGCGTCAGTCGATGGAAGTGAGCCAGTGCCGCCGTGAGCCGTGTGCCGTCTGCAGAGATATAGCGTGTCCACCAAAGTGGGACCCAGACAGGGAAACGGAGTNGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACTTACGTAACAACATC
  3   1   2       bld Em10      in                    IMAGE:7983328.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGATGGAAGTGGAGCCAGTGGCAGCGTGGAGCCAGTTGCCCGTCTGCAAGAGAATATAGCGTGCTCCACCAAAGTGGGGACCCAGAACAGAAAACGGGAGTGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCAGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTGTGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTG
  3   1   2       bld Ga15 5g3  in                       XL427f16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTGGAAGCCAGTGGCAGCCGTGGAGGCCCGTGTGCCCGTCTTGCAGGGAGAATATAGCGTGCTCCACCAAAGTGGGGACCCAGAACAGGAAACGGGAGTGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACT
  3   1   2      seed FaB  5g3  in                    IMAGE:8070573.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCCAGTGGCAGCCGTGGAGCCCGTGTGCCCGTCTGCAGGAGAATATAGCGTGCTCCACCAAAGTGGGGACCCAGAACAGGAAACGGGAGTGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACTTACTGTATTAAACCTTTTTC
  3   1   2       bld DMZ  5g3  in                         xl310i08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGTGGCAGCCTTGGAGCCCGTGTGCCCGTCTGCAGGAGAATATAGCGTGCTCCACCAAAGTGGGGACCCAGAACAGGAAACGGGAGTGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGTGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGACCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTGTGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGA
  3   1   2       bld FaBN                            IMAGE:8074454.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCAGGAGAATATAGCGTGCTCCACCAAAGTGGGGACCCAGAACAGGAAACGGGAGTGCGAAGGAGAGAAATACGGGGGGAAATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTGGTCACAACTATATGAGAAATCACTACGATTAACTTCTCTCT
  3   1   2       bld DMZ  5g3  in                         xl276g07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGGTGCGAGTCCCACCACAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGTGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGANTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGACCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTGTGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAAC
  3   1   2       bld DMZ  5g3  in                         xl272g02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGGGAGAGCCGCAATTGTTACAACGTGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGACCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTGTGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACT
  3   1   2       bld Neu7                                 XL050g16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGACGGGTGTTCCTTGGATGAAAAGTGGTCAGAGTGGGGCGAGTGGGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGACCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTGTGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACT
  3   1   2       bld Neu7 5g3  in                         XL001f15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCTGTGCTCCCCTCCTTGTGGCAAATCAGAGAGAACAAGAGAAAGGGTGTGCCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGACCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTGTGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTNCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACTACTGTAA
  5   1   2       bld Tbd2                            IMAGE:3200973.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGCCGGTGTACCCCGACTACCCGGAGACCACCCTCACTCAGACGGGCAAGTTAGTGGACGTGTTTTTCTCTGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGACCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTGTGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGCACAACTATATGA
  3   1   2       bld Ga15                               XL438p08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGGGACCCCCCGAGTGNGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAANAATGTGATTGAGTGCTAACTGGCCCGGGNCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTAGTGTTAGCTGGGGAAGGGGTCAGCTGATTTGGTCA
  3   1   2       bld Emb4 5g3  in                    IMAGE:4960306.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGGACCCCCCGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACTTACTGTAATAAACATCTCATTTGCATTTTAAAA
  3   1   2       bld Neu7      in                         XL027m09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCNGAGTGCGATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGGCCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTGCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCC
  3   1   2       bld Tbd2 5x3  out                   IMAGE:3200971.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGTGACCCCATCAACAAGCAGACCAAGAAGGTGGAGGAGAAGGAGGAGTGTAAGAATGTGATTGAGTGCTAACTGGCCCGGGACCACCCTTGCACCCTGCCCTCACCCAGCAAGAGGAGAAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTGTGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACTTACTGTAATAAACATCTCATTTGCATTTTATACTTGAAAA
  5   1   2       bld Ga15      in                       XL488o15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACTTACTGTAATAAACATCTCATTTGCATTTTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL488o15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAATATGGTGGGGGACAATGGACTCTGGGATATTGAACTCTTTTTGCCCCCCACCCTGGCACTGTTAATAAATCCCCCCAGCTGCTGATTGGTGCTTATGAGTGCAGAGCAGTAGGAAAGAGAATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCAC
  3   1   2       bld Neu4      in                    IMAGE:3556997.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATGCCATGACTTCATAGGTTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACTTACTGTAATAAACATCTCATTTGCATTTTAAAAAAAA
  5   1   2       bld Neu4      in                    IMAGE:3556997.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTATGTGACATCATAATGTGGGTGGGGAGAGTATGACCTCACATCTTTGTTCCATCTCATCACCATGAAGCTACCTATTGCCTGGGGTGGGGGGAGCAACTGTTCAGCACCCCTCAATTGCTCTATGTTACTGGGGAAGGGGTCACTGATTTGGTCACAACTATATGAGAAATCACTTACTGTAATAAACATCTCATTTGCATTTTaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)