Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6867981.5                     117 END     2           5        1                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:6879210.3                       3 END     2           5       66                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012837660 Xl3.1-IMAGE:8532635.5.5 - 39 ESTs
                                                                       .......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8532635.5.5                                                          ATTTACTTCCCAAGATGGCCGCTGAAAGCTGGATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGACCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGACCTTTGTAAATGACAGCTTGTGCACCACACTATCTCTGCAGTGGGAGCCAGAAATCATAGCTGTAGCGGTTATGTATCTTGCTGGAAGGCTGTGCAAGTTTGAGATACAGGAGTGGACATCAAAGCCACTTTACAGAAGATGGTGGGAACAGTTTGTTCAAGATGTGCCGGTTGATGTGCTTGAAGACATTTGCCATCAAATCCTTGACTTGTATTCTCAAGGAAAGCAACAGATGCCTCATCATGGAGCTCCGCAAACCTCCCCCCAGGTTCAGGCACAAATAGCTTCAGTGCAGCCTCAACAACAATCCCAAAATGCAGATCCCCAAACAGCTCCTCAAAAAGAACAACAACAACAGCAGCAGCCCCCATCCCAACAGTCCAAGAAGCCATCTCCTCAGTCAAGCCCTCCAAAGCCAGTGAAGCGACCTTTGCCTGCTTCACCTAAAGATGATAGTAAACCAGTAGAACCACTACCTAAAATATCGAAAGTTGAGACCTCACATCCTCCTTTACCTCCTGTTCTTCCTCCACCAGAGAGAAAACCTCTGGTCCCAAGTATTGCTGTGAGTGAAGGGGATCCTGCAGGTGGTTTAGAACCAGCAGAACATACAAAGATCCAGATTCCTCCTCCAGCCCATCCTGGCCCTGTTCACCAGCCTCCACCTATACCTCATCGGCCACCTCCTCCTCCACCAGCTAGCTATATTACGGGGATGTCTACAACCAATTCATACATGTCTGGAGAGGGTTACCAGAGTTTACAGTCCATGATGAAGACTGAAGGGCCATCTTATGGAAGTCTTCCTCCAAATTATGGGCCCCCTGCTCATTTGCCATATCATCCTCATGTTTTTCCACCTAATCCTCCACCCACTGTACCACCGCCACCACCTCCTTNTTCATTCCCACCTCCTAACATTCCTCCTCCTACACCTGTCTATCCACCACCTCCAACATACAACCCTAATTTCCCACCTCCTAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGAAAAACTCATTTTAATATAAACTTTATCGTATGGACACTCCTAAATCTTATCAATAAAGTTTTTTTCTAATATAAAAAAAA
                                                  Xl3.1-CHK-1012721805                                                                TTCCCAAGATGGCCGCTGAAAGCTGGATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGACCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGACCTTTGTAAATGACAGCTTGTGCACCACACTATCTCTGCAGTGGGAGCCAGAAATCATAGCTGTAGCGGTTATGTATCTTGCTGGAAGGCTGTGCAAGTTTGAGATACAGGAGTGGACATCAAAGCCACTTTACAGAAGATGGTGGGAACAGTTTGTTCAAGATGTGCCGGTTGATGTGCTTGAAGACATTTGCCATCAAATCCTTGACTTGTATTCTCAAGGAAAGCAACAGATGCCTCATCATGGAGCTCCGCAAACCTCCCCCCAGGTTCAGGCACAAATAGCTTCAGTGCAGCCTCAACAACAATCCCAAAATGCAGATCCCCAAACAGCTCCTCAAAAAGAACAACAACAACAGCAGCAGCCCCCATCCCAACAGTCCAAGAAGCCATCTCCTCAGTCAAGCCCTCCAAAGCCAGTGAAGCGACCTTTGCCTGCTTCACCTAAAGATGATAGTAAACCAGTAGAACCACTACCTAAAATATCGAAAGTTGAGACCTCACATCCTCCTTTACCTCCTGTTCTTCCTCCACCAGAGAGAAAACCTCTGGTCCCAAGTATTGCTGTGAGTGAAGGGGATCCTGCAGGTGGTTTAGAACCAGCAGAACATACAAAGATCCAGATTCCTCCTCCAGCCCATCCTGGCCCTGTTCACCAGCCTCCACCTATACCTCATCGGCCACCTCCTCCTCCACCAGCTAGCTATATTACGGGGATGTCTACAACCAATTCATACATGTCTGGAGAGGGTTACCAGAGTTTACAGTCCATGATGAAGACTGAAGGGCCATCTTATGGAAGTCTTCCTCCAAATTATGGGCCCCCTGCTCATTTGCCATATCATCCTCATGTTTTTCCACCTAATCCTCCACCCACTGTACCACCGCCACCACCTCCTTCTTCATTCCCACCTCCTAACATTCCTCCTCCTACACCTGTCTATCCACCACCTCCAACATACAACCCTAATTTCCCACCTCCTAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGAAAAACTCATTTTAATATAAACTTTATCGTATGGACACTCCTAAATCTTATCAATAAAGTTTTTTTCTAATATAAAAAAAAAAAAAA
                                                      consensus depths                                                               2     4     4     6     6     8    10    11    11    12    11    12    13    15    14    15    14    15    14    15    15    15    15    15    15    15    15    15    15    15    16    16    16    16    16    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    18    18    18    18    18    18    19    19    19    20    20    20    20    20    20    19    19    19    19    18    19    19    19    19    19    19    19    19    19    20    20    19    19    19    19    17    17    16    17    13    16    13    16    11    16     9    14     9    14     9    14     9    14     9    14     8    13     9    13     7    12     7    10     7    10     7    10     7    10     5     9     5     9     5     7     5     7     5     6     5     6     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     4     2     4     2     5     2     5     2     5     2     5     5     5     5     5     5     6     6     6     9     9     9     9     9     9     9    10    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    10    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    13    13    13    13    13    13    14    14    14    14    14    14    13    13    14    14    15    15    15    16    14    16    13    14    12    14    12    14    11    13    10    13    10    13    10    12    10    11    10    11     9    10     8     9     7     8     7     8     7     8     4     6
  5   1   2      ests                            Xl3.1-IMAGE:8532635.5                                                          ATTTACTTCCCAAGATGGCCGCTGAAAGCTGGATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGACCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGACCTTTGTAAATGACAGCTTGTGCACCACACTATCTCTGCAGTGGGAGCCAGAAATCATAGCTGTAGCGGTTATGTATCTTGCTGGAAGGCTGTGCAAGTTTGAGATACAGGAGTGGACATCAAAGCCACTTTACAGAAGATGGTGGGAACAGTTTGTTCAAGATGTGCCGGTTGATGTGCTTGAAGACATTTGCCATCAAATCCTTGACTTGTATTCTCAAGGAAAGCAACAGATGCCTCATCATGGAGCTCCGCAAACCTCCCCCCAGGTTCAGGCACAAATAGCTTCAGTGCAGCCTCAACAACAATCCCAAAATGCAGATCCCCAAACAGCTCCTCAAAAAGAACAACAACAACAGCAGCAGCCCCCATCCCAACAGTCC
  5   1   2      ests                               Xl3.1-XL507o22ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAAGATCCAGATTCCTCCTCCAGCCCATCCTGGCCCTGTTCACCAGCCTCCACCTATACCTCATCGGCCACCTCCTCCTCCACCAGCTAGCTATATTACGGGGATGTCTACAACCAATTCATACATGTCTGGAGAGGGTTACCAGAGTTTACAGTCCATGATGAAGACTGAAGGGCCATCTTATGGAAGTCTTCCTCCAAATTATGGGCCCCCTGCTCATTTGCCATATCATCCTCATGTTTTTCCACCTAATCCTCCACCCACTGTACCACCGCCACCACCTCCTTNTTCATTCCCACCTCCTAACATTCCTCCTCCTACACCTGTCTATCCACCACCTCCAACATACAACCCTAATTTCCCACCTCCTAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGAAAAACTCATTTTAATATAAACTTTATCGTATGGACACTCCTAAATCTTATCAATAAAGTTTTTTTCTAATATAAAAAAAAA
                                                                   SNP                                                                                                                                  ----G-------
                                               BLH ATG     162    2089                                                          
                                               BLH MIN     162     275                                                          
                                               BLH MPR     162     275                                                          
                                               BLH OVR      96     162                                                          
                                               CDS MIN      96       7                                                          
                                               EST CLI      10       7                                                          
                                               ORF LNG      96     125                                                          
                                                                                                                                                                                                                                                                                                                                                              PROTEIN -== Ce ==== 3e-044     NP_506615.2 F43D2.1 [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dm ==== 8e-104     NP_788083.1 CG15218-PB, isoform B [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Ag ==== 3e-110     XP_317464.4 AGAP008002-PA [Anopheles gambiae str. PEST] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Sp ==== 9e-130     XP_795740.2 PREDICTED: similar to Cyclin K [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PREDICTED = Dr ==== 9e-161     XP_697908.2 PREDICTED: cyclin K [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PREDICTED = Cf ==== 0          XP_855304.1 PREDICTED: similar to cyclin K [Canis familiaris] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PROTEIN === Mm ==== 0          NP_033962.2 cyclin K [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PREDICTED = ?? ==== 0          XP_609221.4 PREDICTED: similar to cyclin K [Bos taurus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PROTEIN === Hs ==== 0          NP_001092872.1 cyclin K isoform 1 [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PROTEIN === Gg ==== 0          NP_001026380.1 cyclin K [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PREDICTED = Xt ==== 0          NP_001072323.1 hypothetical protein LOC779776 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PREDICTED = Xl ==== 0          NP_001089373.1 hypothetical protein LOC734423 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                               Xl3.1-IMAGE:8532635.5.5                                                                                                                            TAG---------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------ATG---TAA---------------------------------------TAG------------------------------------------------------------------------TGA---------------------------TAA---------TAG---------------------------------------------------------TAA------TAG---------------------TAA------------ATG------------TAA---------------ATG---------------------TAA---------------TAA
                                                                   ORF                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2      ests                            Xl3.1-IMAGE:8532635.5                                                          ATTTACTTCCCAAGATGGCCGCTGAAAGCTGGATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGACCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGACCTTTGTAAATGACAGCTTGTGCACCACACTATCTCTGCAGTGGGAGCCAGAAATCATAGCTGTAGCGGTTATGTATCTTGCTGGAAGGCTGTGCAAGTTTGAGATACAGGAGTGGACATCAAAGCCACTTTACAGAAGATGGTGGGAACAGTTTGTTCAAGATGTGCCGGTTGATGTGCTTGAAGACATTTGCCATCAAATCCTTGACTTGTATTCTCAAGGAAAGCAACAGATGCCTCATCATGGAGCTCCGCAAACCTCCCCCCAGGTTCAGGCACAAATAGCTTCAGTGCAGCCTCAACAACAATCCCAAAATGCAGATCCCCAAACAGCTCCTCAAAAAGAACAACAACAACAGCAGCAGCCCCCATCCCAACAGTCC
                                                  Xl3.1-CHK-1012689702                                                                TTCCCAAGATGGCCGCTGAAAGCTGGATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGACCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGACCTTTGTAAATGACAGCTTGTGCACCACACTATCTCTGCAGTGGGAGCCAGAAATCATAGCTGTAGCGGTTATGTATCTTGCTGGAAGGCTGTGCAAGTTTGAGATACAGGAGTGGACATCAAAGCCACTTTACAGAAGATGGTGGGAACAGTTTGTTCAAGATGTGCCGGTTGATGTGCTTGAAGACATTTGCCATCAAATCCTTGACTTGTATTCTCAAGGAAAGCAACAGATGCCTCATCATGGAGCTCCGCAAACCTCCCCCCAGGTTCAGGCACAAATAGCTTCAGTGCAGCCTCAACAACAATCCCAAAATGCAGATCCCCAAACAGCTCCTCAAAAAGAACAACAACAACAGCAGCAGCCCCCATCCCAACAGTCCAAGAAG
  5   1   2       bld Ga18 5g                            xlk61p17ex.5p CNCCTTTCATAGACATGCGGGAGGAGTAAAGGGGGGNGAGTCGTAACGTGATGCGGCCCATTTACTTCCCAAGATGGCCGCTGNNNNNNGATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGGCCCTGTGCNGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGNTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGNGCTTGNTGTCTTTTTCTGGCTGGNAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTNAGGAGGAAGTCATGGTCCTTGAGCGAATTCNTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGNACCCTTACC
  5   1   2       bld Em10 5g                         IMAGE:7982722.5p                                              GTGATGCGGCCCATTTACTTCCCAAGATGGCCGCTGAAAGCTGGATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGACCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATNAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGTCAAACAATTAAAAGGTGACCAGAACTAAATACAGAAATTGGTCAAATGGCATGGACCTTTGTAATGAACACTTGTGCACCAACTATCTCTGCAGTGGGAGCAAAATCATTACTGTACGGTTTG
  5   1   2       bld Oo1  5g                         IMAGE:5083872.5p                                                   GCGGCCCATTTACTTCCCAAGATGGCCGCTGAAAGCTGGATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGACCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTTAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTNAAAGGTGACAAGAACAAAATACAGAAAATTGGTTCCAATGGCATGGGACCTTTGTTANNATGACAGCTTGTGCACCACACTAATCTCTGCAGTGGNGAGCCCAGAAAATCATAGCTTGTAGCGGGTTATGTATTCTTTGCCTGGAAAGCCTGTTGCAAGTTTGGAGAATACAGGGAATGGGGACATTCAAAAGCCCACTTTTTACAGGAAAGAATGGNTGGG
  5   1   2       bld Lmb1 5g                         IMAGE:8532635.5p                                                     TCTGCAGTATCGCAGAGTACTCGATTCGTATTCGTCCATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGACCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGACCTTTGTAAATGACAGCTTGTGCACCACACTATCTCTGCAGTGGGAGCCAGAAATCATAGCTGTAGCGGTTATGTATCTTGCTGGAAGGCTGTGCAAGTTTGAGAT
  5   1   2       bld Oo1  5g                         IMAGE:6642162.5p                                                              TACTTCCCAGATGGCCGCTGAAAGCTGGATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGACCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAGATACAGAAATTGGTTCAAATGGCATGGACCTTTGTAAATGACAGCTTGTGCACCACACTATCTCTGCAGTGGGAGCCAGAAATCTAANCTGTAGCGGNTATGTATCTTTGCTGGAAGGCTGTGGCAGTTTGAGAAACAGGAGTGGACATCAAAGCCCCTTTACAGAAAATGGTGGGGGACAGTTTTGCTCCAAGATGGGGCCGGTTGAATGTGCTTTGAAGACATTTTGCCTCAAATCCCTTGACTTGAATTCT
  5   1   2       bld FaBN 5g                         IMAGE:8076471.5p                                                                    CCAGATGGCCGCTGAAAGCTGGATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGACCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAATGGCATGGACCTTTGTAATGACAGCTTGTGCACACACTATCTCTGCAGTGGGAGCCAGAATCATAGCTGTAACGGTATGTATCTGCTGAAGGCTGT
  5   1   2       bld Eye1 5g                         IMAGE:6946831.5p                                                                       CTCCGGATCTGAAAGCTGGATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGACCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGAACCTTTGTAAATGACCAGCTTGTGCACCACACCTATCTTCTGCCAGTGGGGAGCCAGGAAATCATAAGCTGTTAGACCGGTTAATGGTATCTTTGCCTGGAAAAGCCTGGTGCCAAGGTTTGGGAGAAATACCAGGGAATGGGGAACAATTTCAAAAACCCCCACCTTTTTAT
  5   1   2       bld Tbd7 5g3  in                         XL056a07.5p                                                                                GGAAAGCTGGATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGGCCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTT
  5   1   2       bld Emb1 5x3  out                   IMAGE:3402357.5p                                                                                   CACGCGTCCGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGGCCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAANGGAGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAAGTGACAAGAACAAATACCGAAATTGTTCAAATGCATGGACCTTTGTA
  5   1   2      seed DMZ  5g3  in                         xl323c04.5p                                                                                     GCTGGATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGGCCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGACC
  5   1   2       bld DMZ  5g3  in                         xl324g12.5p                                                                                     GCTGGATGTGTTGTTAGTGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGGCCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATA
  5   1   2       bld Egg1 5g                            PBX0136C04.5p                                                                                                CACGAGGGTCCTGGCTCCTGAGGGGAAGTAGCGTGTAGGCCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGAC
  5   1   2       bld Oo1  5g                         IMAGE:5079548.5p                                                                                                                         AAGTAGCGTGTAGGCCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGACCTTTGTAAATGACAGCTTGTGCACCACACTATCTCTGCAGTGGGAGCCAGAAATCATAGCTGTAGCGGTTATGTATCTTGCTGGAAAGCTGTGCAAGTTTGAGATACAGGAGTGGACATCAAAGCCACTTTACAGAAGATGGTGGGGAACAGTTTTGGTTCAAGATGGTGCCGGGTTGATGTGGCTTGAAGAACATTTGCC
  5   1   2       bld Neu7 5g                              XL044f14.5p                                                                                                                           AGCGTGTAGGCCCTGTGCCTGGTGAATGTATGGNACTTCTTGCTGGGGGAAGNAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAA
  5   1   2       bld FaB  5g                         IMAGE:8072646.5p                                                                                                                           GTAGCGTGTAGACCCTGTGCCTGGTGAATGTATGGACTTCTTGCTGGGGGAAGAGTCATTCCCACCGCTGAGGTATTTCAAAGGTAAAACTGCACCAATGAAAGAGAATAAAGAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGTTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACATATACAGAAATTGGTTCAATGGCATGGACCTTTGTAATGACAGCTGTGCACCACACTATCTCTGCATGGGACCAGAATCAAGCTGTACGGTATGTATCTGCTGAGGCTGTCATTTGAGAACAGAGTGACTCAA
  5   1   2       bld Em10                            IMAGE:8318785.5p                                                                                                                                                                                                                                           GAGAATTCTAGCCCTTCCACTGCCCCTGCAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGACCTTTGTAAATGACAGCTTGTGCACCACACTATCTCTGCAGTGGGAGCCAGAAATCATAGCTGTAGCGGTTATGTATCTTGCTGGAAGGCTGNTGCAGTTTGAGATACAGGAGTGGACATCAAAGCCACTTTACAGAAGATGGTGGGAAC
  5   1   2       bld DMZ       in                         xl326p02.5p                                                                                                                                                                                                                                                                      CAAGCCTGGACCATGGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGACCTTTGTAAATGACAGCTTGTGCACCACACTATCTCTGCAGTGGGAGCCAGAAATCATAGCTGTAGCGGTTATGTATCTTGCTGGAAGGCTGTGCAAGTTTGAGATACAGGAGTGGACATCAAAGCCACTTTACAGAANATGGTGGGAACAGTTTGTTCAAGATGTGCCGGTTGATGTGCTTGAAGACATTTGCCATCAANTCCNTGACTTGTAT
  5   1   2       bld DMZ       in                         xl330k04.5p                                                                                                                                                                                                                                                                       CAAGCCTGGACCATGTAAAGCCATGCTGGTATTGGGATAAGAAAGACCTAGCCCATACTCCATCACAGCTGGAGGGGCTTGATCCTGCTACAGAGGCAAGATACCGGAGAGAAGGGGCCAGGTTCATATTTGATGTTGGAACCCGACTAGGGCTACATTATGATACTCTAGCAACTGGAATCATTTATTTTCACCGGTTCTACATGTTCCATTCCTTCAAACAATTTCCCAGATATGTGACTGGTGCTTGCTGTCTTTTTCTGGCTGGTAAAGTTGAAGAAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGACCTTTGTAAATGACAGCTTGTGCACCACACTATCTCTGCAGTGGGAGCCAGAAATCATAGCTGTAGCGGTTATGTATCTTGCTGGAAGGCTGTGCAAGTTTGAGATACAGGAGTGGACATCAAAGCCACTTTACAGAAGATGGTGGGAACAGTTTGTTCAAGATGTGCCGGTTGATGTGCTTGAAGACATTTGCCATCAAATCCTTGACTTGTAT
  5   1   2       bld Em10                            IMAGE:8320663.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTGAAGAACACCCAAGAAATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGACCTTTGTAAATGACAGCTTGTGCACCACACTATCTCTGCAGTGGGAGCCAGAAATCATAGCTGTAGCGGTTATGTATCTTGCTGGAAGGCTGTGCAAGTTTGAGATACAGGAGTGGACATCAAAGCCACTTTACAGAAGATGGTGGGAACAGTTTGTTCAAGATGTGCCGGTTGATGTGCTTGAAGACATTTGCCATCAAATCCTTGACTTGTATTCTCAAGGAAAGCAACAGATGCCTCATCATGGAGCTCCGCAAACCTCCCCCCAGGTTCAGGCACAAATAGCTTCAGTGCAGCCTCAACAACAATCCCAAAATGCAGATCCCCAAACAGCTCCTCAAAAAGAACAACAACAACAGCAGCAGCCCCCATCCCAACAGTCCAAGAACCATCTCCTCAGTCAGCCCTCCAAAGCAGTGAGCGACTTTGCTGCTTCACTAAATGATGTAACCATAGACACTACTAAATATCGAGTGAACTCCATCTCTTACTCTGTCTCTCACAAAGAACTCGTCAGATGTGTATGAGGATCGCGTGTAACACAATAAAATAATCCTCGCACTGCGTCACTCCTACTTGCTCCCCATAT
  5   1   2       bld Oo1       in                    IMAGE:5077934.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGTAAGGATATTATCAAAACTGCCCGTAGCTTACTAAATGATGTACAGTTTGGCCAGTTTGGGGATGATCCTAAGGAGGAAGTCATGGTCCTTGAGCGAATTCTTCTTCAGACAATAAAGTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGACCTTTGTAAATGACAGCTTGTGCACCACACTATCTCTGCAGTGGGAGCCAGAAATCATAGCTGTAGCGGTTATGTATCTTGCTGGAAGGCTGTGCAAGTTTGAGATACAGGAGTGGACATCAAAGCCACTTTACAGAAGATGGTGGGAACAGTTTGTTCAAGATGTGCCGGTTGATGTGCTTGAAGACATTTGCCATCAAATCCTTGACTTGTATTCTCAAGGAAAGCAACAGATGCCTCATCATGGAGCTCCGCAAACCTCCCCCCAGGTTCAGGCACAAATAGCTTCAGTGCAGCCTCAACAACAATCCCAAAATGCAGATCCCCAAACAGCTCCTCAAAAAGAACAACAACAACAGCAGCAG
  5   1   2       bld DMZ       in                         xl223d15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTGATCTCCAAGTTGAGCACCCTTACCAGTTTCTTCTTCGATATGCAAAACAATTAAAAGGTGACAAGAACAAAATACAGAAATTGGTTCAAATGGCATGGACCTTTGTAAATGACAGCTTGTGCACCACACTATCTCTGCAGTGGGAGCCAGAAATCATAGCTGTAGCGGTTATGTATCTTGCTGGAAGGCTGTGCAAGTTTGAGATACAGGAGTGGACATCAAAGCCACTTTACAGAAGATGGTGGGAACAGTTTGTTCAAGATGTGCCGGTTGATGTGCTTGAAGACATTTGCCATCAAATCCTTGACTTGTATTCTCAAGGAAAGCAACAGATGCCTCATCATGGAGCTCCGCAAACCTCCCCCCAGGTTCAGGCACAAATAGCTTCAGTGCAGCCTCAACAACAATCCCAAAATGCAGATCCCCAAACAGCTCCTCAAAAAGAACAACAACAACAGCAGCAGCCCCCATCCCAACAGTCCAAGAAGCCATCTCCTCAGTCAAGCCCTCCAAAGCCAGTGAAGCGACCTTTGCCTGCTTCACCTAAAGATGATAGTAAACCAGTAGAACCACTACCTAAAATATCGAAAGTTGAGACCTCACATCCTCCTTTACCTCCTGTTCTTCCTCCACCAGAGAGAAAACCTCTGGTCCCAAGTATTGCTGTGAGTGAAGGGGATCCTGCAGGTGGTTTAGAA
  5   1   2      ests                               Xl3.1-XL507o22ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAAGATCCAGATTCCTCCTCCAGCCCATCCTGGCCCTGTTCACCAGCCTCCACCTATACCTCATCGGCCACCTCCTCCTCCACCAGCTAGCTATATTACGGGGATGTCTACAACCAATTCATACATGTCTGGAGAGGGTTACCAGAGTTTACAGTCCATGATGAAGACTGAAGGGCCATCTTATGGAAGTCTTCCTCCAAATTATGGGCCCCCTGCTCATTTGCCATATCATCCTCATGTTTTTCCACCTAATCCTCCACCCACTGTACCACCGCCACCACCTCCTTNTTCATTCCCACCTCCTAACATTCCTCCTCCTACACCTGTCTATCCACCACCTCCAACATACAACCCTAATTTCCCACCTCCTAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGAAAAACTCATTTTAATATAAACTTTATCGTATGGACACTCCTAAATCTTATCAATAAAGTTTTTTTCTAATATAAAAAAAAA
                                                  Xl3.1-CHK-1012690433                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCAGATTCCTCCTCCAGCCCATCCTGGCCCTGTTCACCAGCCTCCACCTATACCTCATCGGCCACCTCCTCCTCCACCAGCTAGCTATATTACGGGGATGTCTACAACCAATTCATACATGTCTGGAGAGGGTTACCAGAGTTTACAGTCCATGATGAAGACTGAAGGGCCATCTTATGGAAGTCTTCCTCCAAATTATGGGCCCCCTGCTCATTTGCCATATCATCCTCATGTTTTTCCACCTAATCCTCCACCCACTGTACCACCGCCACCACCTCCTTCTTCATTCCCACCTCCTAACATTCCTCCTCCTACACCTGTCTATCCACCACCTCCAACATACAACCCTAATTTCCCACCTCCTAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGAAAAACTCATTTTAATATAAACTTTATCGTATGGACACTCCTAAATCTTATCAATAAAGTTTTTTTCTAATATAAAAAAAAAAAAAAA
  5   1   2       bld Ga12      out                        XL215f08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATCCTCCTTTACCTCCTGTTCTTCCTCCACCAGAGAGAAAACCTCTGGTCCCAAGTATTGCTGTGAGTGAAGGGGATCCTGCAGGTGGTTTAGAACCAGCAGAACATACAAAGATCCAGATTCCTCCTCCAGCCCATCCTGGCCCTGTTCACCAGCCTCCACCTATACCTCATCGGCCACCTCCTCCTCCACCAGCTAGCTATATTACGGGGATGTCTACAACCAATTCATACATGTCTGGAGAGGGTTACCAGAGTTTACAGTCCATGATGAAGACTGAAGGGCCATCTTATGGAAGTCTTCCTCCAAATTATGGGCCCCCTGCTCATTTGCCATATCATCCTCATGTTTttccacctaatcctccacccactgtaccaccgccaccacctccttcttcattcccacctcctAACATTCCTCCTCCTACACCTGTCTATCCACCACCTCCAACATACAACCCTAATTTCCCACCTCCTAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAA
  5   1   2       bld Ga15      in                       XL453n17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAAGATCCAGATTCCTCCTCCAGCCCATCCTGGCCCTGTTCACCAGCCTCCACCTATACCTCATCGGCCACCTCCTCCTCCACCAGCTAGCTATATTACGGGGATGTCTACAACCAATTCATACATGTCTGGAGAGGGTTACCAGAGTTTACAGTCCATGATGAAGACTGAAGGGCCATCTTATGGAAGTCTTCCTCCAAATTATGGGCCCCCTGCTCATTTGCCATATCATCCTCATGTTTTTCCACCTAATCCTCCACCCACTGTACCACCGCCACCACCTCCTTCTTCATTCCCACCTCCTAACATTCCTCCTCCTACACCTGTCTATCCACCACCTCCAACATACAACCCTAATTTCCCACCTCCTAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTAtttttttttatttttttGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAAGCAAGTGTTTAAATCTCTTGAAACTGTT
  3   1   2       bld DMZ  5g3  in                         xl323c04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GNAGGNNCNTNNNNNGGNNGTNTTCNTNNAAANNNNGGGCCCCNNGNTCATNNGCCANATCATCNTCANGTTTTTNCACNTAATCNTNCANNCANNGTACCACCGCCACCACCTCCTTNTTCATTCCCACCTCNTAACATTCCTCCTCCTACACCTGTCTATCCACCACCTCCAACATACAACCCTAATTTCCCACCTCCTAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAAGCTGTTAGCNTAACATNTNTAGCTTAACNGGAATTTGTNCAAGTTAATGGGGAGT
  3   1   2       bld DMZ  5g3  in                         xl324g12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCNTNCAANNTNNGGGCCCCNNGNTCATNNGNCANATCATCNNCANGNTNTTNCACNTAATCNTCCANCCNNNGTACCACCGCCACCACCTCNTTNTTCATTCCCACCTCCTAACATTCCTCCTCCTACACCTGTCTATCCACCACCTCCAACATACAACCCTAATTTCCCACCTCCTAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCGTAACATNTNTAGCTTNACNGGNATTNGTG
  3   1   2      seed Ga15                               XL507o22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ANANNATCNNCANGTNNNTNCACNTAATCNTNCNNNCANTGTACCNCCGCCACCACCTCCTTNTTCATTCCCACCTCCTAACATTCCTCCTCCTACACCTGTCTATCCACCACCTCCAACATACAACCCTAATTTCCCACCTCCTAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGAAAAACTCATTCTA
  3   1   2       bld DMZ       in                         xl223d15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TNCCACCTCGTAACATTCCTCCTCCTACACCTGTCTATCCACCACCTCCAACATACAACCCTAATTTCCCACCTCCTAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGAAAAACTCATTCTAATATAAAC
  3   1   2       bld DMZ       in                         xl326p02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTACACCTGTCTATCCNCCACCTCCAACATACAACCCTAATTTCCCACCTNCTAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCNTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGNTAGTTGATACCCAGTTAAAGTAGCGTCCCAAAAGTAAAAGAACCTGTAGNTGATATATTTTCC
  3   1   2       bld DMZ       in                         xl330k04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTACACCTGTCTATCCACCACCTCCAACATACAACCCTAATTTCCCACCTCCTAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGNTGNTATATTTTC
  3   1   2       bld Tbd7 5g3  in                         XL056a07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACACCTGTCTATCCACCACCTCCAACATACAACCCTAATTTCCCACCTCNTAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCANTGTGGGCATCATCAGAAGCGCTAGT
  3   1   2       bld Ga15      in                       XL453n17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAATTTCCCACCTCNTAGANTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGAAAAACTCATTTTAATATAAACTTTATCGTATGGACACTCC
  3   1   2       bld Ooc2                            IMAGE:3745678.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGACTGCCACCCACTCATGCAGTTCCCAGTCATCCCCCTCCAGGAATTGCAATGCCACCAACCTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCATCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGAAAAACTCATTTTAATATAAACTTTATCGTATGGACACTCCTAAATCTTATCAATAAAGTTTTTTTCTAATATAAAGTAAAAAAAAAAAAAAAA
  3   1   2       bld Oo1       in                    IMAGE:5077934.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTATCCTCCTCCTGCTGTGCCCCCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCTCCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGAAAAACTCATTTTAATATAAACTTTATCGTATGGACACTCCTAAATCTTATCAATAAAGTTTTTTTCTAATAT
  3   1   2       bld Emb1      out                   IMAGE:3402355.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGTGCTGCTTGGATGAGATAACCACGCTTTCTTGCCGTCATATATCAAAGGTTTTCATTGTAGGGGGAGAATTTGAAGTCCTGTTTATTTTTTTTTATTTTTTTGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGAAAAACTCATTTTAATATAAACTTTATCGTATGGACACTCCTAAATCTTATCAATAAAGTTTTTTTCTAATATAAAAAAAAA
  5   1   2       bld Tad1      out                   IMAGE:6879210.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGTAGGGGGAGAATTTGAAGTCCTGTTTAtttttttttatttttttGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGAAAAACTCATTTTAATATAAACTTTATCGTATGGACACTCCTAAATCTTATCAATAAAGTTTTTTTCTAATATAAAGTAACTCTTCAATGTCCTACTCTCTGCCATCTGTGCCAAACCAGTGGTGATGTCCATATGCATTGTGCAAGCTGCATTTAGAGATTGCTGAGAGAAGGATAGTGAGTAAATTGATAGGGAGTCATTTCAAATGAAGTTCCTTATTTTCCTAGGATGAAGCTTGTAGCAAATGTTTGTTTTTAGAATATCTCCCTTTTAAGAAGGTATGCTTAAAAACAAGATCCCTTCCAACATATTGTATGGCTGTATATAAATGATTCCAGATATCTCTCTAGCAACCTCATAAGGGGATTCCAGTAAAAGAGCACCTGTGGGGACCCCTGTAGCAGCTTTAGATTCTTACTGAGTAAAATCTTTGATGGTCTTNCCACATTTTATNATTTCTGGTCTATGGCATATGGCCTAAGCCCACCANGCTACGGAGACCCAGAAGCGCTTTGAGGGTTTTCCCCCTAAATTTACCCCCAGAAGGG
  5   1   2       bld Ga18                               xlk53i03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTAtttttttttatttttttGCTCATTGTGGGCATCATCAGAAGCGCTAGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGAAAAACTCATTTTAATATAAACTTTATCGTATGGACACTCCTAAATCTTATCAATAAAGTTTTTTTCTAATaaaaaaaaaa
  5   1   2       bld Neu4                            IMAGE:3475551.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTGATACCCAGTTAAAGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTATCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGAAAAACTCATTTTAATATAAACTTTATCGTATGGACACTCCTAAATCTTATCAATAAAGTTTTTTTCTAATATaaaaaaaaaaaaaaa
  5   1   2       bld Neu4                            IMAGE:3557516.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTAGCTTCCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACAAGCAAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTGACCATGTAAAAACTCATTTTAATATAAACTTTATCGTATGGACACTCCTAAATCTTATCAATAAAGTTTTTTTCTAATATaaaaaaaaaaaaaa
  5   1   2       bld Neu4                            IMAGE:3557261.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCAAAAGTAAAAGAACCTGTAGCTGCTATATTTTCCTTTCCACTACTTCTAGTGTTTAATCTCTTGAAACTGTTAGCCTAACATCTTTAGCTTACTGGAATTTGTACAAGTTAATGGGGAGTAGACCATGAAAAACTCATTTTAATATAAACTTTATCGTATGGACACTCCTAAATCTTATCAATAAAGTTTTTTTCTAATATaaaaaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)