Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8462227.5.5                    18 PI      85        140     1247                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012837661 Xl3.1-IMAGE:4057411-IMAGp.5.5 - 42 ESTs
                                                                       .-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                         Xl3.1-IMAGE:4057411-IMAGp.5.5                                                    CGCTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTAAATATTGTACAGAAATTATTTTTATATATGAAAAGTTTATATTTTATATAAAAAGTGGAAAACAAGTAAAAAAA
                                                  Xl3.1-CHK-1012721806                                                          GATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTAAATATTGTACAGAAATTATTTTTATATATGAAAAGTTTATATTTTATATAAAAAGTGGAAAACAAGTAAAAAAAAAAATA
                                                      consensus depths                                                        10    12    13    14    17    18    18    19    18    20    19    20    19    20    19    20    19    20    21    21    21    21    21    21    21    21    21    21    21    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    19    21    19    21    18    21    18    20    17    19    17    19    17    19    17    19    17    19    17    19    17    19    17    19    17    19    17    19    17    19    17    21    18    22    18    22    18    22    18    22    17    22    17    22    16    22    14    22    14    22    13    23    13    23    12    22     9    19    10    19    10    20     9    22    11    20     9    19     9    18     9    17     9    16     8    16     8    15     8    15    10    15    11    15    11    15    11    15    12    16    10    16    11    17    11    14    12    14    10    13    11    13    14    14    14    14    14    14    14    15    15    15    16    16    16    16    15    16    16    16    14    15    14    15    15    16    16    16    16    16    16    16    16    17    14    17    15    17    15    17    15    17    16    18    16    20    16    20    16    20    16    20    18    20    18    20    16    20    18    19    18    18    17    18    17    18    17    18    17    18    16    18    14    18    12    18    13    17    12    16    11    15    10    15    10    14    10    14     8    13     8     9     6     7     6     7     3     5
  5   1   2       e50                      Xl3.1-IMAGE:4057411-IMAGp.5                                                 AGTCGCTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACA
  5   1   2       e50                            Xl3.1-IMAGE:6873471.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTAAATATTGTACAGAAATTATTTTTATATATGAAAAGTTTATATTTTATATAAAAAGTGGAAAACAAGTAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----TA-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --C---------
                                               BLH ATG     123     961                                                    
                                               BLH MIN     108     129                                                    
                                               BLH OVR     123      91                                                    
                                               EST CLI      -3      35                                                    
                                               ORF LNG     123       4                                                    
  5   1   2       e50                      Xl3.1-IMAGE:4057411-IMAGp.5                                                 AGTCGCTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACA
                                                  Xl3.1-CHK-1012689411                                                       TCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGA
  5   1   2       bld Spl  5g3  in                    IMAGE:8463912.5p AAANNNCTCTATCGCTAGNNNGNNGNTCCATCGATAGAATTCGTCCCCAGTCGCTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAAATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCC
  5   1   2       bld Spl  5g                         IMAGE:8461681.5p    AATTNNNCCTGCGTGAGNNGAAGATCATCAATTAAATTCGTCCCAAGTCGCTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCCTGCAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAACTACGACGGTCACACGTGTCTCCACTGGCATCGATCCAGGCTATCTGCTCTTGTGAAATCTGAATGCAACGGGCCGAGTAATGCCCG
  5   1   2       bld Spl  5g                         IMAGE:8461544.5p    TAATTGTNNCCTCATCANNNGAGAGCATCGATAGAAATCGTCCCCAGTCGCTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGNTAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATCTGATTGCAAGGGGCTGACGTAATGCACAGAGCCTTGCATGGCGCCTGCACTCAA
  5   1   2       bld Brn1 5x                         IMAGE:7018566.5p                       CTGGACCGGTCCGGATTCTCGGGATCAGTCGCTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAAGAAAGGACAAACTCCTGACAAGACGATCGCTTTTGACAGCGGCCTGGACTCCCCCTGGAAAGAGGACGAATACACGGCTATCATGATGAAGGAATAAAAACGAAGCTGAGAATCGACGTGCCGTCCGACACCCCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGAACACACGTTTCTTCATTTGGCCTTATCCCCTTGAAGAGAATACTCTGGTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGAGTATCACAGCACCANNNACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCNAGAAGGCGTTCTTACGGGGAGTTGGTGTCACATCACATGTAGAAAATGCAGCCTCGGCGCGGAAATGAGGGAATTTAAAAAAATGGGGCGGGCCCCCTGTTTTTCCCCACCCTTGGAATTCGATCCCGGGGGGTAATCTTGCTCTCTTGGGGGAAAATTCTTGAATTGCAAAggggggggCTGGAACTTAAAATGGCCCCAGGGGGACCTTTTTGCAAAGGGGGCCCCCCACCTGGGCCCCTTGGCAATTTAGGGCGTTGTTGTTAACCCTGCGCAAAAAAACATTTGAAACCCCGGGAGAGTGccccccttttctcccccc
  5   1   2       bld Tad2 5g3  in                    IMAGE:6873329.5p                                     AGATCGCTTCTACAAGTCGCTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTCGCAACCCGGATTTTTTACAGCGTGTTTTCAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACAGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTCCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCGGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGGCACACGGGCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGGAGTTGGTGTCATCTTTTCAACATTGTGAGAAACAGCTGCCGGGCACTGGCTGAAGGTCTGGTAAACTACGGACGGTCCACACGTGTTCTCCCCCCTGGGCATCCGATCCCAAGGGCTATCCTTGGCTCCTTGGGGGAAAATTTCCTGATTGGCAAAGGGGGGGCC
  5   1   2       bld Sp1  5g                         IMAGE:5506599.5p                                              CCCACGCGTCCGGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAATACTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCTTTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATTCTGATGCAANGGGGCTGACG
  5   1   2       bld Emb9 5g                         IMAGE:7977350.5p                                               CAAGTCGCTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAATACTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTACGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGAGCCTTGCAATGGCCGCACTGCACTGCATATGCTGTGACTGCAGAACTATGACCTGATGTCACTTCTCTTAACTTGGGAGCTGAATGTTAACAGAAG
  5   1   2       bld Emb9 5g3  in                    IMAGE:7976173.5p                                               CAAGTCGCTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAATACTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTACGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACACTGCCGGCACTGCTGAAGTTGTANCTACGACGGTCCACGTGTCTCCACTGGCATGATCCGGGCTACTTGCTCTGTGGAATCCGATGCAAGGGGCTGAGTAATGACAGACCTTGATGCCGCTGCCGCAATGTGTTACGCAAAATACCGATCCTCCCTACTTGACTAGTACAATCGACAGTATCCTCCTCC
  5   1   2       bld Panc 5g                         IMAGE:8736721.5p                                               CAAGTCGCTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGCTCGCTGCGGGAGTTGGTGTCATCATTCAACATTGTGAGAACAGCTGCGCACTGCTGAAGTCTGTAAACTACGACGTCACACGTGTTCTCCACCTGCATCGATTCAGCCTATCCTGCTCTTGTGAATTCGATGCAGGCTTGACTTATGCCCAGGACTGCATGCGACTGACTGCGTTGCCTGTGACTGCAACTTAGACTGAGTCCATCCCTA
  5   1   2      seed DMZ  5g3  in                         xl233b20.5p                                                  GTCGCTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAG
  5   1   2       bld DMZ  5g3  in                         xl235c18.5p                                                  GTCGCTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGAT
  5   1   2       bld Ga18      in                       xlk59h20ex.5p                                                   TCNCTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTCTTCATTTGGCCATTATCCATGAAGAGAATACTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTNNACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGNTGGTGTCATCTTTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGNTATCTTGCTCTTGTGGAAANTCTGATTNCNAAGGGGGCTGANGNAAATNCACAGGAGC
  5   1   2       bld DMZ  5g3  in                         xl340e24.5p                                                      CTCTGATCGTTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGAT
  5   1   2       bld Ga15 5g3  in                       XL405f24ex.5p                                                               TTTGGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAATACTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCTTTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATTCTGATTGCAAA
  5   1   2       bld Thy  5g                         IMAGE:8547757.5p                                                                  GGGATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAATACTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCTTTCAACATTGTGAGAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCCCTGCACTGCATA
  5   1   2       bld Lu1  5g                IMAGE:4057411-IMAGp.IMAGp                                                                    GATTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCGGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGGAAGAAATAACATGCTGATCCAACAAC
  5   1   2       bld Lu1  5g3  in                    IMAGE:4057411.5p                                                                      TTGATATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCGGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAAGAAGCGTTTCGC
  5   1   2       bld Ga12 5g3  in                         XL191d23.5p                                                                           ATAGAAGGGACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTC
  5   1   2       bld Brn1 5g                         IMAGE:6954371.5p                                                                                    ACAGCTGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAATACTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTAGGTGTCATCTTTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCCTTGCAATGGCCCGCACTGGCACTTGCATATGGGCTGTTTGACCCTGCAGAAACTATGAACCTGAATGGTCAACTTTCTCCCTTAACTTTTGGGAACCTGGATGCTTAACCAGAAGTTCCCGGTAACCCAGGGGTTTATTTCCCCCCGTTGGCCCAACCTTCACA
  5   1   2       bld Ga14 5g                            Ga14-p10e6.5p                                                                                         ATGCTACCACAGCAACTTGCTATCGCAACCCGGATTATTTACAGCGTGTTTTAAAAGCCTATTGTGAGGGAAAGTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGTCTGGT
  5   1   2       bld Spl  5g                         IMAGE:8461443.5p                                                                                                                                                             GAAAGTTCTGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCCAGGGATCTCAGGAAGGACAAACTCCTGCAAGACGATCGCTTTGACAGCGGCCTGGACTCCCTGAAAGAGGACGAATACACGGCTATCATGAAGGACATAAACGAGCTGAGAATCGACGTGCCGTCCGACACGCCGTACTGTGAGCCCGAACCGTGGAAGAAAGAGGTCAATGAAGATGGAGACACGTTTCTTCATTTGGCCATTATCCATGAAGAGAAGGCTCTGGTCAAGGAGGCTATCCGCCGTTCATACAAGGACCATTGCTACCTGAACAAACAGAATAATCTTCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCAACACGAAATCAGCCAGTTCCTTTTCGAGGCTGGTTGTGATCCAGAAATCCAAGACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCCTTGCATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGACTATGACTGATGTCACTCTCCTTACTTNGAGCTGATGTACAGAGTACGTACCAGGTATCTCGTGCACTCACTGGGAGAATACTGCTGATCACACGCTGTGAGTGACAAGATGCGTACTCGAATGAAAGAACGTCGATCATTAA
  5   1   2       bld Tad2      in                    IMAGE:6873471.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTTCCGAGGCAACACGGCCTTGCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAAACAAACATAGGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAAGCATGAAAGTGCTTGTGCTGTTCCTTGGGAGACCGATGTTCCACCTGGTACTTATGCAGTCCCCTGGAAGACCCAACCCTGGCCAAGAAAAGGGCTTAATTCTCTTGAGCaaaataaaaaaatggaatgcccccaaaaaaaGCACCCCAAATCCTC
  5   1   2       e50                            Xl3.1-IMAGE:6873471.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTAAATATTGTACAGAAATTATTTTTATATATGAAAAGTTTATATTTTATATAAAAAGTGGAAAACAAGTAAAAAAA
                                                  Xl3.1-CHK-1012689912                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTAAATATTGTACAGAAATTATTTTTATATATGAAAAGTTTATATTTTATATAAAAAGTGGAAAACAAGTAAAAAAAAAAATA
  3   1   2       bld Tad2 5g3  in                    IMAGE:6873329.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGGCCTTGCCACATTGCCCTGCAAAACAGGGCCTCGTTGCCGGGGGAGTTTGGTTTTCATCTTTTCAACCATTGGGGAGAAACACGTCTGCCGGGCAATTGTTGAAGTTCTGTAAAACTAACGACGGGTCACACCGTGTTTCCACCTGGGCATCGTATCCAGGGCTATCTTGCTTCTTGTGGAAAATGCTGTTTGCAAAGGGGGGCTGACGTAAATGCACAGGAGCTTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCAGTGCNGAGGACCAG
  5   1   2       bld Ga18      in                       xlk58e23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAAANCCAAGACTTCCGAGGCAACACGGCCTTCACATTGCCTGCAAACAGGGCTCGCTGCGGGGAGTTGGTGTCATCATTCAACATTGTGAGAAACAGCTGCCGGCACTGCTGAAGTCTGTAAACTACGACGGTCACACGTGTCTCCACCTGGCATCGATCCAGGGCTATCTTGCTCTTGTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGNNATGAAGGTNCTTGTNNTGTTCCTTGGAGANCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGNTTNTTCTCTGAGCAGATGAAGAGNGGATGCCNCAGAAAGNACNCTAATCTTTT
  3   1   2       bld Emb9 5g3  in                    IMAGE:7976173.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGCCTGAAGGTCTGTAAACTACGACGGTCACACCGGTGTCTCCACCTGGCATCGATCCAGGGCTATCTGCTCTGTGAAATTCTGATGCAAAGGGGGCTGACGTAAATGCACAGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTGACTGCAGAACTATGACGTGATGTCACTTCTCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTAAATATTGTACAGAAATTATTTTTATATATGAAAAGTTTATATTTTATATAAAAAGTGGAAAACAAGTAAAAAAAAAATTAAAAGGTAAATTTG
  3   1   2      seed Tad2      in                    IMAGE:6873471.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGGTTTTTCAACCGGGCATCGATCCAGGGGTATTCTTGCTCTTGTGGAAATTCTGATGCAAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTAAATATTGTACAGAAATTATTTTTATATATGAAAAGTTTATATTTTATATAAAAAGTGGAAAACAAGTAAAAAAAAAATAAAAGGAAATAA
  3   1   2       bld DMZ  5g3  in                         xl233b20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGTGGAAATTCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAG
  3   1   2       bld Ga15 5g3  in                       XL405f24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCTGANTTGCAAAGGGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAATACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACAAAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGCAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTAAATATTGTACAGAAATTATT
  3   1   2       bld DMZ  5g3  in                         xl235c18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTGATTGCAAAGGGGGCTGACGTAAATGCACAGGAGCCTTGCAATGGCCGCACTGCACTGCATATGGCTGTTGACCTGCAGAACTATGACCTGATGTCACTTCTCCTTAACTTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGAC
  3   1   2       bld Spl  5g3  in                    IMAGE:8463912.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGGTATTGTTTGGGAATCGATGAAAGGGCTGAGTATGCACAGAGCTTGCATGCCGCATGCACGCATAGGCTGTGACTGCAGAACTATGACTGATGTCATTCTCTTTAACTTGGAGCTGATGTTAACAGAGTCACGTACCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTAAATATTGTACAGAAATTATTTTTATATATGAAAAGTTT
  3   1   2       bld Ga18      in                       xlk59h20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CNNCACTGCNCTGNANNNTGGCNNNTTGACCTGNANNANNNNNGNCCTGATGTCNNCTTCNCNTTANNTTNGNAGCTGATGTTAANANNAGTCACGTNCNAAGGTTATNNTCCGTNNNAGCTCACATGGGGAAGAANNNNCATNCTGNNCCAACNNCAGCTGGTGGAGGTGACACAAAAGANTTNGNAATNNNTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATNNCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACAAAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACANCCTGGCAGCAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAANNNNNGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTAAATATTGTACAGAAATTATTTTTATATANGAAA
  3   1   2       bld DMZ  5g3  in                         xl340e24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCTGATGTTAACAGAGTCACGTNCCAAGGTTATTCTCCGTGCCAGCTCACATGGGGAAGAAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTNGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGNTGCATTAGACTGCTGTGTATGTGAACTAAAANCAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGNTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACNACACATTGTATATGGTGTAAATATTGTACAGAAATTATTTTATNTAGAAAAGT
  3   1   2       chi Ga18      in                       xlk58e23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGCCNGNNNACATGGGGAAGNAAnnnnnnTGCTGnnnnnAnCAACAGCnnnnnnnGGTGACNCAAANGANTTTGCAGTNNNNNCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATNCCGCTGCATTAGACTGCTGTGTATGTGANCTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAANTCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAANNNNNGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTAAATATTGTACAGAAATTNNNNNNTATANGAAAAG
  5   1   2       bld Emb4      in                    IMAGE:4959639.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATAACATGCTGATCCAACAACAGCTGGTGGAGGTGACACAAAAGAATTTGCAATACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTA
  3   1   2       bld Emb4      in                    IMAGE:4959639.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGATTATGAATACAATGATGATGAGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACAAAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGCAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTAAATATTGTACAGAAATTATTTTTATATATGAAAAGTTTATATTTTATATAAAAAGTGGAAAACAAGT
  3   1   2       bld Ga18      in                      xlk166a16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GNCCNNNNTNCGNCCACGCGTCCGAGCTTATGTATGACGACTGCATCATTGGGGGAATNCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAANNNNNGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTAAATATTGTACAGAAATTANNNTATATANNAAAA
  5   1   2       bld Ga18      in                      xlk166a16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCTTATGTATGACGACTGCATCATTGGGGGAATGCCGCTGCATTAGACTGCTGTGTATGTGAACTAAAAACAAAACATAAGGACAGACTCTCATTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGNATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGNNNAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGNTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGtgtaaatattgtacagaaattatttttatatatgaaaagnttatattttatataaaaagtggaaaacaagtaaaaaaaaaa
  5   1   2       bld Ov1                             IMAGE:8331521.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAATGAGAGTCTGTCCTTACTAAAAGACAGTAACGGGGCCAGTGACAAAAATCCTCGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGATGTTCTACGTGTTACTTATGCAGTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTaaaaaaaaaaaaaaaaaaG
  3   1   2       bld Lu1  5g3  in                    IMAGE:4057411.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGAAAAGCTGAGGCATGAAGGTGCTTGTGCTGTTCCTTGGAGACCGAATGTTCTACGTGTTACTTATGCAGTTCACCTTGAGACCACAGCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGAATGAAGAAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCACCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGTGTAAATATTGTACAGAAATTATTTTTATATATGAAAAGTTTATATTTTATATAAAAAGTGGAAAACAAGTAA
  3   1   2       bld Ga15      in                       XL419p18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTNTACGTGTTACTTATGCAGTCNCCTTGAGACCNCAGCCTGGCAGTAAAGGGCTTATTNTNTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCNCGCTAATNTTTTATAACCNCCATTATGAGGCAGGGNGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATNTCATAAATACGCTGNGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACNCATTGTATATGGNGTAAATATTGTACAGAAATTATTTTTATATATGAAAAGTTTATATTTTATATAAAAAGGnGGAAAACCAAGTAAAAAAAA
  5   1   2       bld Ga15      in                       XL419p18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTATGCAGTCACCCTTGAGACCACAGCCCTGGCAGTAAAGGGCTTATTCTCTGAGCAGATGAAGAGTGGATGCCGCAGAAAGCACGCTAATCTTTTATAACCNCCATTATGAGGCAGGGCGAACAATACCATGATACTGACAATGCCCTTCAGTGCCAACATTTAAATAAATATCTCATAAATACGCTGTGCTGAGGACCTGACTTATTGTAGTCAGAGAGCAGACTATTATAATAAACTACACATTGTATATGGtgtaaatattgtacagaaattatttttatatatgaaaagtttatattttatataaaaagtggaaaacaagtaaaaaaaaaaataaaaggaaataatgaattgtttacaaaaaaaaaa
  3   1   2       bld Ga12 5g3  in                         XL191d23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGTCACCTTGAGNCCACANCCTGGCAGTAAAGGGNTTATTNTTTGAGCAGATGAAGAGTGGANGCCGCAGAAANCNCGGTAATNTTTTATAACCNCCATTATGAGGCAGGGCGAACAATACCATGATACTGNCAATGCCCTTCAGTGCCAACATTTAAATAAATATNTNATAAATACGCTGTGNTGAGGACCTGACTTATTGTAGTCAGAGAGCAGANTATTATAATAAACTACNCATTGTATATGGnGTAAATATTGTACAGAAATTATTTTTATATATGAAAAGTTTATATTTTATAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)