Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 09 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012837666 Xl3.1-IMAGE:6637889.5.5 - 46 ESTs
                                                                       ........-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6637889.5.5                                                                                                             GAAGACGGGAGACATGTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAGGCTCGGGATGTGGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTTTGTACTCCAGCTGGTCTGACTACATCCATGTCTGTAATATATACGGAGATACTGACTCACACACTGCTCTGGATCTGAGACCCTCAGAACGTCGTTTTGCCGTTTTCTCCATCACTGTATCTTCTGATGGGCGGGAAGTTCTAGGAGGGGCCAATGATGGATGTGTATATGTGTACGACCGTGAGCAGAATGTTCGAACACTCAAGATTGCTTCCCATGAGGATGATGTGAATGCTGTCTCATTTGCTGATGACAGTTGCCATATAGTTTACTCTGGGGGTGATGATGCACTATGTAAAGTGTGGGACCGCCGAACAATGCGAGAAGATGATCCCAAACCAGTGGGGGTATTAGCTGGCCATCAAGATGGCATTACTTTCATACATAGCAAGGGGGATGCTCGTTACCTACTCTCTAACTCAAAGGATCAGAGTATAAAGCTCTGGGATATCCGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGCAAGGCAGTTACTCATCAAAACTGGGACTACAGATGGCAGCAAGTTCCCAAGAGAGCTCTCAGGAAGAAACGTCTAACAGGAGACACTTCCCTAATGACATACCGTGGACACGGTGTCCTACACACACTGATTCGTTGTCGCTTCTCCCCTGCATACAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTATTTCTGATCGCTTTTAAGGATTCTCTAATAAACCTTTCTCAAACAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012722264                                                                                                                   GGGAGACATGTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAGGCTCGGGATGTGGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTTTGTACTCCAGCTGGTCTGACTACATCCATGTCTGTAATATATACGGAGATACTGACTCACACACTGCTCTGGATCTGAGACCCTCAGAACGTCGTTTTGCCGTTTTCTCCATCACTGTATCTTCTGATGGGCGGGAAGTTCTAGGAGGGGCCAATGATGGATGTGTATATGTGTACGACCGTGAGCAGAATGTTCGAACACTCAAGATTGCTTCCCATGAGGATGATGTGAATGCTGTCTCATTTGCTGATGACAGTTGCCATATAGTTTACTCTGGGGGTGATGATGCACTATGTAAAGTGTGGGACCGCCGAACAATGCGAGAAGATGATCCCAAACCAGTGGGGGTATTAGCTGGCCATCAAGATGGCATTACTTTCATACATAGCAAGGGGGATGCTCGTTACCTACTCTCTAACTCAAAGGATCAGAGTATAAAGCTCTGGGATATCCGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGCAAGGCAGTTACTCATCAAAACTGGGACTACAGATGGCAGCAAGTTCCCAAGAGAGCTCTCAGGAAGAAACGTCTAACAGGAGACACTTCCCTAATGACATACCGTGGACACGGTGTCCTACACACACTGATTCGTTGTCGCTTCTCCCCTGCATACAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTATTTCTGATCGCTTTTAAGGATTCTCTAATAAACCTTTCTCAAACAAAAAAAAAA
                                                      consensus depths                                                                                                                  3     9     6    12    13    16    14    18    15    18    14    18    15    18    15    18    15    18    15    18    15    18    15    18    15    18    15    18    16    19    15    19    16    19    16    20    16    20    16    20    19    20    20    20    20    21    20    21    19    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    19    19    19    19    19    19    19    19    19    19    19    19    19    19    18    19    19    19    19    19    19    19    17    18    17    18    16    17    17    18    15    18    15    17    15    17    15    17    14    17    13    17    13    16    12    16    10    16     7    14     8    13     8    13     8    13     7    12     7    12     8    13     8    11     8    10     7    10     7    10     7    11     7    11     7    10     7    10     7    10     6    10     5     9     4     7     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     3     2     3     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     4     4     4     4     4     5     4     6     5     6     4     6     4     6     5     7     6     7     4     8     5     9     4    10     4    11     4    12     4    13     6    13     8    13     8    13     9    14     9    14    10    15    11    15    11    15    12    15    12    15    13    16    13    16    14    16    13    16    13    16    14    16    14    16    14    16    15    17    15    17    15    17    15    17    15    17    15    17    16    17    16    17    16    17    15    16    15    16    15    16    17    17    16    17    16    18    16    18    17    19    17    19    17    19    17    19    17    19    16    19    16    19    16    19    16    19    17    20    17    20    17    20    17    20    17    20    17    20    17    19    17    19    17    19    17    19    17    19    16    19    16    19    16    18    16    18    16    18    15    18    13    15    11    15     6    12     6    10     3     7     2     3
  5   1   2       e>1                            Xl3.1-IMAGE:6637889.5                                                                                                            GGAAGACGGGAGACATGTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAGGCTCGGGATGTGGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTTTGTACTCCAGCTGGTCTGACTACATCCATGTCTGTAATATATACGGAGATACTGACTCACACACTGCTCTGGATCTGAGACCCTCAGAACGTCGTTTTGCCGTTTTCTCCATCACTGTATCTTCTGATGGGCGGGAAGTTCTAGGAGGGGCCAATGATGGATGTGTATATGTGTACGACCGTGAGCAGAATGTTCGAACACTCAAGATTGCTTCCCATGAGGATGATGTGAATGCTGTCTCATTTGCTGATGACAGTTGCCATATAGTTTACTCTGGGGGTGATGATGCACTATGTAAAGTGTGGGACCGCCGAACAATGCGAGAAGATGATCCCAAACCAGTGGGGGTATTAGCTGGCCATCAAGATGGCATTACTTTCATACATAGCAAGGGGGATGCTCGTTACCTACTCTCTAACTCAAAGGATCAGAGTATAAAGCTCTGGGATATCCGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGCAAGGCAGTTACTCATCAAAACTGGGACTACAGATGGCAGCAAGTTCCCAAGAGAGCTCTCAGGAAGAAA
  5   1   2       e>1                            Xl3.1-IMAGE:8543002.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGGGCCAGAAGGACTTGAGGCCTCACGCAAGGCAGTTACTCATCAAAACTGGGACTACAGATGGCAGCAAGTTCCCAAGAGAGCTCTCAGGAAGAAACGTCTAACAGGAGACACTTCCCTAATGACATACCGTGGACACGGTGTCCTACACACACTGATTCGTTGTCGCTTCTCCCCTGCATACAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTATTTCTGATCGCTTTTAAGGATTCTCTAATAAACCTTTCTCAAAC
                                               BLH ATG      87    1287                                                                                                             
                                               BLH MIN      87     271                                                                                                             
                                               BLH OVR      87      58                                                                                                             
                                               CDS MIN      87      26                                                                                                             
                                               EST CLI      -3      26                                                                                                             
                                               ORF LNG      87       6                                                                                                             
  5   1   2       e>1                            Xl3.1-IMAGE:6637889.5                                                                                                            GGAAGACGGGAGACATGTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAGGCTCGGGATGTGGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTTTGTACTCCAGCTGGTCTGACTACATCCATGTCTGTAATATATACGGAGATACTGACTCACACACTGCTCTGGATCTGAGACCCTCAGAACGTCGTTTTGCCGTTTTCTCCATCACTGTATCTTCTGATGGGCGGGAAGTTCTAGGAGGGGCCAATGATGGATGTGTATATGTGTACGACCGTGAGCAGAATGTTCGAACACTCAAGATTGCTTCCCATGAGGATGATGTGAATGCTGTCTCATTTGCTGATGACAGTTGCCATATAGTTTACTCTGGGGGTGATGATGCACTATGTAAAGTGTGGGACCGCCGAACAATGCGAGAAGATGATCCCAAACCAGTGGGGGTATTAGCTGGCCATCAAGATGGCATTACTTTCATACATAGCAAGGGGGATGCTCGTTACCTACTCTCTAACTCAAAGGATCAGAGTATAAAGCTCTGGGATATCCGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGCAAGGCAGTTACTCATCAAAACTGGGACTACAGATGGCAGCAAGTTCCCAAGAGAGCTCTCAGGAAGAAA
                                                  Xl3.1-CHK-1012688683                                                                                                                  CGGGAGACATGTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAGGCTCGGGATGTGGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTTTGTACTCCAGCTGGTCTGACTACATCCATGTCTGTAATATATACGGAGATACTGACTCACACACTGCTCTGGATCTGAGACCCTCAGAACGTCGTTTTGCCGTTTTCTCCATCACTGTATCTTCTGATGGGCGGGAAGTTCTAGGAGGGGCCAATGATGGATGTGTATATGTGTACGACCGTGAGCAGAATGTTCGAACACTCAAGATTGCTTCCCATGAGGATGATGTGAATGCTGTCTCATTTGCTGATGACAGTTGCCATATAGTTTACTCTGGGGGTGATGATGCACTATGTAAAGTGTGGGACCGCCGAACAATGCGAGAAGATGATCCCAAACCAGTGGGGGTATTAGCTGGCCATCAAGATGGCATTACTTTCATACATAGCAAGGGGGATGCTCGTTACCTACTCTCTAACTCAAAGGATCAGAGTATAAAGCTCTGGGATATCCGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGCAAGGCAGTTACTCATCAAAACTGGGACTACAGATGGCAGCAAGTTCCCAAGAGAGCTCTCAGGAAGAAACGTCTA
  5   1   2       chi Tail      in                    IMAGE:8543002.5p GTGGAAGACGGGGGACATGTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGACCCTTCAATTCTACTGTCCTTCAACTTTTGCTTCCCTTCTGAACCCCAACCCCTTTCGACTGAGGCATTTTTTCCCTGACAAGTGGTGTCCTTTTCCATCTTAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAATCATGTATGTGCACAGACTCATACTCCCAGAAGCTTTCTGCGGGTGTATCCCCCATGGATCGTCTTATGTCACATGCCAGTCAAACATCGCTATTGATGTAGAATGTGCTTNAGAGTCGCACTGTAGTCGGATTGGCTGATGCTGATTGCT
  5   1   2       chi Tail                            IMAGE:8542159.5p                                                                         AANNTCCCTCCTTTTNNNNGCGGAGACATCGATATGAATTCGTCCCGTGTCACTGTATAGTCCAAGGGGGAAAGTATATTTCTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCCTTTAGAAGTTCCGCACTNGTNANGCTCGGGATGTGGGCTGAGTGTCTGGATGTGCATTTACCCNNGATGAGACATTTTTGACTCAGCTGTCTGACTCATCATGTTGTATATAAC
  5   1   2       bld Sp1  5g                         IMAGE:4964040.5p                                                                             TATTTGTGTTTGCTCGTGTCACTGTATAGTCCAAGGGGGAAAGTATATTTGTAGCTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAAGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCCTCCAAAT
  3  -1   2       bld Ga11                            IMAGE:3475227.3p                                                                              AGCTCAGAATAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGTGTAAACACTGTATGCGACAACGACGGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGCCCACCGCGATTAGGGCGGGGAGGGGGCCCTGCTAGCTTACACCT
  5   1   2       bld Eye1 5g                         IMAGE:7019680.5p                                                                                         AGGCTTGGTACCNGGTCCTGGAATTCCCNGGGATTGTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGTACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCNGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTTCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTTGTATTCCCCCCCATGGATCCGTCTTTATGGTCAGCATGCCCGGAATCAAAACATTTCGCCCTATTTTGATTGGTAAGAAATGGTGGCCTTTTTAAGAAGGTTTCCGCCACCTGGTTTAAGGCCTTCGGGGAATTTGGGGCCCTTGGAAATTGGCCCTGTGGAAATGTGGGGCAATTTTACCCCCCCGGGAAAGGGGAG
  5   1   2       chi Tail      in                    IMAGE:8542160.5p                                                                                              AAGAGTACTTATAAAAATTCGTCCCGTGTCACTGTATAGTCCAAGGGGGAAAGTATATTTCTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAGAAGTTCGCACTGTTAGGCTCGGATGTGGCTGGATGTCTGGATGTGCATTACCCGGATGGAGACTTTTTGACTCAGCTGTCGACACTCATGTCGTAAATACGG
  5   1   2       bld Li1  5g                         IMAGE:3398260.5p                                                                                                         AGTGGAAGACGGGAGACATGTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTTCTGTTGATTCAGCCGCAGACACCACATTACTCGATCAAAATCAGATCAGAACA
  5   1   2      seed Neu7 5g3  in                         XL045p17.5p                                                                                                          GTGGAAGACGGGAGACATGTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGA
  5   1   2       bld Oo1  5g                         IMAGE:6637889.5p                                                                                                           GCATAGACGGGGGACATGTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAGGCTCGGGATGTGGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTTTGTACTCCAGCTGGTCTGACTACATCCATGTCTGTAATATATACGGAGATACTGACTCACACACTGGCTCTGGATCTGAGACCCTCCANAACGTCCGGTTTTGCCGGTTTTCTCCATCACTGTNATCTTCTGNAANGGGGCGGGNAAAGTTTCTAGGGAGGGGGCCCAAG
  5   1   2       bld Ooc3 5g3  in                    IMAGE:3437809.5p                                                                                                              AAGACGGGAGACATGTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACA
  5   1   2       bld Oo1  5g                IMAGE:6637889-IMAGp.IMAGp                                                                                                                GACGGGGGACATGTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAGGCTCG
  5   1   2       bld Emb4 5g                         IMAGE:5543299.5p                                                                                                                 CCACGCGTCCGGTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAGGCTCGGGGATGTTGGGCTGGAGTGTCCTTGGATGTGGCATTTACCCCGGATGGAGGACCTTTTTTGGACTTCCAGCTGGGCCTGACTACACCCCATGGCTTGGAAATATAAACCGGACAATTCTGACCTTCCCCACCCTGGCTTTTGGATTTTGGCAAACCCTTTCTCAATCGTCCCGCTCTTGGGACGCCTTTTATCTCTTCTCCT
  5   1   2       bld FaBN 5g                         IMAGE:8076424.5p                                                                                                                           ATTTGTAGCTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAAGCTCGGGATGTGGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGGATGAA
  5   1   2       bld Lmb1 5g                         IMAGE:8536294.5p                                                                                                                           TGTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGAATACCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGGGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCTAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCATATATGATTGTAGAAATGGTGCCTTCAGAAGTTCGCACTGTTANGCTCGGATGTGGCTGGATGTCTTGATGTGCGTTTACCCGATGGAGACTTTTGTACTCACTGTCGACTACTCTGTCGTAATTACGAGAACGATCACCTGTCTGATGAACTCGACGCGTTGCGTTTCTCCGTCTCTAGCGGATCAGAGCAGAGTGTTATTCAA
  5   1   2       bld FaB  5g                         IMAGE:8073685.5p                                                                                                                            GTAAACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCTAAACTTTCGCCTATTTGATTGTAGAATTGGTGCCTTTAAGAAGTTCCCCCTGTTAAGGCTCGGGATGTGGGC
  5   1   2       bld Te2N 5g                         IMAGE:7203881.5p                                                                                                                                ACACTGTATGCGACAACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAGGCTCGAGATGTGGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTTTGTACTCCCGCGGGTCTGACTACTTCCATGTCTGTAATATATAACGGAGAAACTGAACTCAACACTGCTTCTGGATTTGAGACCCCTCAAAACGTcgttttttgccgtttttccccacacttgttttctttttGAAGGGGCGGGGAAGGTTTCTGG
  5   1   2       bld Sp1  5g3  in                    IMAGE:4174218.5p                                                                                                                                               ACGTTTGGCACGCAAATAAAGAACCTTTCGGAGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATGGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTTAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATATACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCG
  5   1   2       bld Neu7 5g3  in                         XL043n05.5p                                                                                                                                                 GCACGAGGCGCAAATAAAGAACCTTTCGGNGGATAGCCCAGTGATGGAGCATGGGAACACGCAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCAGGAGATTCTCCAGAGGACTCCCAAAATAGTCTAGGGTCTCATGGTCTTCAGAATGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGGTGTATTCCCCCAATGG
  5   1   2       bld Emb4                            IMAGE:5515110.5p                                                                                                                                                                                                                                                                                    TCTCATGGTCTTCCCTTTGATGATGATGAGGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAGGCTCGGGATGTGGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTTTGTACTCCAGCTGGTCTGACTACATCCATGTCTGTAATATATACGGAGATACTGACTCACACACTGCTCTGGATCTGAGACCCCCAGAACGTCGTTTTGCCTGTTTCTCCATTACTGTATCTTCTGATGGCCGGGAAGTTCAGGAGGGCCAATGATGATGTGATTTTGTCCACCGTGACAGAAGTCAACCTCAA
  5   1   2       bld Em10      in                    IMAGE:7981568.5p                                                                                                                                                                                                                                                                                                                         GGCATTTTTTCCCTGAAAGTGGTGTCCTTTTCCATCTTAGGGGGCAAGTGCGATTAGTGCAGGGAGGGGGCCCTGCTAGCTTACACCTGGTGCAATCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAGGCTCGGGATGTGGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTTTGTACTCCAGCTGGTCTGACTACATCCATGTCTGTAATATATACGGAGATACTGACTCACACACTGCTCTGGATCTGAGACCCTCAGAACGTCGTTTTGCCGTTTTCTCCATCACTGTATCTTCTGATGGGCGGGAAGTTCTAGGAGGGGCCAATGATGGATGTGTATA
  5   1   2       bld Kid                             IMAGE:4032386.5p                                                                                                                                                                                                                                                                                                                                                                                    CCTGCGAATCGGCGACCACGCGTCCGCTTCGCGTCCGCTATGTCTGACTCAGATGATGACAATGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTATATTCCTCCTGTTGATTCAGCCCCAGACACCACATTACTCGATCAAAATCAGATCAGAACACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAAAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAGGCTCGGGATGTGGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTTTGTACTCCAGCTGGTCTGACTACATCCATGTCTGTAATATATACGGAGATACTGACTCACACACTGCTCTGGATCTGAGACCCTCAGAACGTCGTTTTGCCGTTTTCTCCATCACTGTATCTTCTGGTGGGCGGGGAAATTCTAGGAGGGGGCCATGAAGGGATGGGGATATGTGGAACGACCGGGGAGCAGAAAGGTTCGGAAACACTCAAAGAGTGGCCTTCCCCCTGGAGGGGTGGATGGTGGAAAGGCCTGTCCCACAATTTGGCCTGAATGGAACACGATTGCCCCAAAAATAGGTTTTTAAACTCCCTGGGGGGA
  5   1   2       bld Lmb1      in                    IMAGE:8533112.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACAGATTCTTCTGGCCACAGCGAGACAAAGCACACTAAGGCAACGTAGCATTACACGTCTGCTATTGCAGAGAGAGCGGGCAGGATGCGGATTTACTGTGGGAGAACGATGTCGTGTAACATCTCATTTCCTCCCAAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAGGCTCGGGATGTGGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTTTGTACTCCAGCTGGTCTGACTACATCCATGTCTGTAATATATACGGAGATACTGACTCACACACTGCTCTGGATCTGAGACCCTCAGAACGTCGTTTTGCCGTTTTCTCCATCACTGTATCTTCTGATGGGCGGGAAGTTCTAGGAGGGGCCAATGATGGATGTGTATATGTGTACGACCGTGAGCAGAATGTTCGAACACTCAAGATTGCTTCCCATGAGGATGATGTGAATGCTGTCTCATTTGCTGATGACAGTTGCCATATAGTTTACTCTGGGGGTGATGATGCACTATGTAAAGTGTGGGACCGCCGAACATGCGAGAGATGATCCCAACCAGTGGGGGTATAGCTGGCATCAGATGGCATACTTTCTACTAGCAGGGGGAGCTCGTACTACTCTCTACTCAAGGATCAATATAGCTCTGATTCNGAATTTCAGGCGANGATGAGCTCGCAGCATA
  5   1   2       bld Brn1                            IMAGE:6954687.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGAAGGCTTTCTGCGGGGTGTATTCCCCCAATGGATCCGTCTTTATGTCAGCATGCCAGGATCAAAACATTCGCCTATATGATTGTAGAAATGGTGCCTTTAAGAAGTTCCGCACTGTTAAGGCTCGGGATGTGGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTTTGTACTCCAGCTGGTCTGACTACATCCATGTCTGTAATATATACGGAGATACTGACTCACACACTGCTCTGGATCTGAGACCCTCAGAACGTCGTTTTGCCGTTTTCTCCATCACTGTATCTTCTGATGGGCGGGAAGTTCTAGGAGGGGCCAATGATGGATGTGTATATGTGTACGACCGTGAGCAGAATGTTCGAACACTCAAGATTGCTTCCCATGAGGATGATGTGAATGCTGTCTCATTTGCTGATGACAGTTGCCATATAGTTTACTCTGGGGGTGATGATGCACTATGTAAAGTGTGGGACCGCCGAACAATGCGAGAAGATGATCCCAAACCAGTGGGGGTATTAGCTGGCCATCAAGATGGCATTACTTTCATACATAGCAAGGGGGATGCTCGTTACCTACTCTCTAACTCANAGGATCAGAGTATAAAGCTCTGGGATATCCGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGCAAGGCAGTTACTCATCAAAACTGGGACTACAGATGGCAGCAAGTTCCCAAGAGAGCTCTCAGGAAGAAACGTCNTACANGAGACACTTCCCCTAATGACATACCCGTGGACACGGTGTTCCTACACACACTGATTTCGTTTGTCGCTTCTCCCCTGCATACAGCACTTGCCCAGCAGTTTTGTGTACAGTGGGCTGTTCCCACAGGTCAAGTTTGTAATTTAAGGATTTTGTTAACGGGGTCCAGATAGGTGGAGGAAACTGGACCAATTCCCCAAAGCCAGGTTGTAAAT
  5   1   2       bld Bone                            IMAGE:8742109.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCTGGTCTGACTACATCCATGTCTGTAATATATACGGAGATACTGACTCACACACTGCTCTGGATCTGAGACCCTCAGAACGTCGTTTTGCCGTTTTCTCCATCACTGTATCTTCTGATGGGCGGGAAGTTCTAGGAGGGGCCAATGATGGATGTGTATATGTGTACGACCGTGAGCAGAATGTTCGAACACTCAAGATTGCTTCCCATGAGGATGATGTGAATGCTGTCTCATTTGCTGATGACAGTTGCCATATAGTTTACTCTGGGGGTGATGATGCACTATGTAAAGTGTGGGACCGCCGAACAATGCGAGAAGATGATCCCAAACCAGTGGGGGTATTAGCTGGCCATCAAGATGGCATTACTTTCATACATAGCAAGGGGGATGCTCGTTACCTACTCTCTAACTCAAAGGATCAGAGTATAAAGCTCTGGGATATCCGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGCAAGGCAGTTACTCATCAAAACTGGGACTACAGATGGCAGCAAGTTCCCAAGAGAGCTCTCAGGAAGAAACGTCTAACAGGAGACACTTCCCTAATGACATACCGTGGACACGGTGTCCTACACACACTGATTCGTTGTCGCTTCTCCCCTGCATACAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACACAAGCTTGTGAGCAGCTCTGGGACGTAACCTCCGTGTCTGGGAATATCGCAAGCTGAGTTTTACCTGGAGACTGCGTTACCCTCCATGGGATCTAGCTGAATATGTGTGCCATTGACACGAGAGAAGGCAAAATGTGTC
  5   1   2       bld Brn2                             Brn2-za63g11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACACACTGCTCTGGATCTGAGACCCTCAGAACGTCGTTTTGCCGTTTTCTCCATCACTGTATCTTCTGATGGGCGGGAAGTTCTAGGAGGGGCCAATGATGGAT
  5   1   2       e>1                            Xl3.1-IMAGE:8543002.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGGGCCAGAAGGACTTGAGGCCTCACGCAAGGCAGTTACTCATCAAAACTGGGACTACAGATGGCAGCAAGTTCCCAAGAGAGCTCTCAGGAAGAAACGTCTAACAGGAGACACTTCCCTAATGACATACCGTGGACACGGTGTCCTACACACACTGATTCGTTGTCGCTTCTCCCCTGCATACAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTATTTCTGATCGCTTTTAAGGATTCTCTAATAAACCTTTCTCAAAC
                                                  Xl3.1-CHK-1012689495                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGAAGGACTTGAGGCCTCACGCAAGGCAGTTACTCATCAAAACTGGGACTACAGATGGCAGCAAGTTCCCAAGAGAGCTCTCAGGAAGAAACGTCTAACAGGAGACACTTCCCTAATGACATACCGTGGACACGGTGTCCTACACACACTGATTCGTTGTCGCTTCTCCCCTGCATACAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTATTTCTGATCGCTTTTAAGGATTCTCTAATAAACCTTTCTCAAACAAAAAA
  5   1   2       bld Ov1       in                    IMAGE:5074292.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGCGTCCGTAGCTGGCCATCAAGATGGCATTACTTTCATACATAGCAAGGGGGATGCTCGTTACCTACTCTCTAACTCAAAGGATCAGAGTATAAAGCTCTGGGATATCCGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGCAAGGCAGTTACTCATCAAAACTGGGACTACAGATGGCAGCAAGTTCCCAAGAGAGCTCTCAGGAAGAAACGTCTAACAGGAGACACTTCCCTAATGACATACCGTGGACACGGTGTCCTACACACACTGATTCGTTGTCGCTTCTCCCCTGCATACAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAAT
  5   1   2       bld Lmb1      in                    IMAGE:8532753.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCAGAGTATAAAGCTCTGGGATATCACGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGCAAGGCAGTTACTCATCAAAACTGGGACTACAGATGGCAGCAAGTTCCCAAGAGAGCTCTCAGGAAGAAACGTCTAACAGGAGACACTTCCCTAATGACATACCGTGGACACGGTGTCCTACACACACTGATTCGTTGTCGCTTCTCCCCTGCATACAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCtatatatatatataCACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGTATGTACATTTTCAGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTAAT
  3   1   2       bld Tail      in                    IMAGE:8543002.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCGGAGGATTTCCAGGCAGAAGACTGAGGCTCCAGGCAGGCAGTATTCATCAACTGGACTACAGATGGCAGCAAGTCCCAGAGAGCTTCAGAGAAACGTCTAACAGGAGACACTCCCTAATGACATACGTGACACGGTGTCCTACACACACTGATTCGTGTCGCTCTCCCCTGCATACAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTATTTCTGATCGCTTTAAAGGATCTCTTAAATAA
  3   1   2       bld Tail      in                    IMAGE:8542160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCAAGGCAAGGCAGGTTATTCATCAAAATCTGGGAACTACAGATGGCAGCAAGTTCCAAGAGAGCTTTCAGAAGAAACGTCTACAGGAGGACACTCCTAATGACATACGTGGACACGGTGTCCTACACACACTGATTCGTTGTCGCTTCTCCCTGCATACAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTATTTCTGATCGCTTTTAAAGGAATCTCATAATAAAAAATTTTTTTTA
  5   1   2       chi Te2N                            IMAGE:7203912.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAAGAGAGCTCTCAGGAAGAAACGTCTAACAGGAGACACTTCCCTAATGACATACCGTGGACACGGTGTCCTACACACACTGATTCGTTGTCGCTTCTCCCCTGCATACAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCtatatatatatatatataCACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAAGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGATTAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCATGCCCGTACATGATAGAAAGAAggggggggagtaaataatagtgataaaaataggggggggtggggggATTTTGTGAATAAAAAAGATCGAAGCTAGGGGCTTTNANTNTN
  3   1   2       bld Eye1      out                   IMAGE:6957623.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCCTTAAATGACATACCCGGGGAACAGGGGTGTCCCTAACACAACAATGATTTTGGTTGTCGGGTTTTTCCCCCTGGCATACAGGCACTGGCCAAGCAGTTTGTGTAACAGTGGCTGTTCCACAGGTTGGAGTTGTTAGTTAATGATTTGTTACGGGTTCAGATTAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGAGGGGCTTGCTGTATTCTGATTTTGAAAGGAT
  3   1   2       bld Lmb1      in                    IMAGE:8533112.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAGGAGACACTCCCTAATGACATACCGTGGACACGGTGTCCTACACACACTGATTCGTGTCGCTCTCCCTGCATACAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTATTTCTGATCGCTTTAAGGATCTCTAAAAACACCTCCA
  3   1   2       bld Lmb1      in                    IMAGE:8532753.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTAATGACATACCGTGGACACGGTGTCCTACACACACTGATTCGTTGTCGCTTCTCCCTGCATACAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTATTTCTGATCGCTTTAAGGATCTCTAATAAC
  3   1   2       bld Em10      in                    IMAGE:7981568.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGTGTCCTAACACACACTGATTTCGTTGTCGCTTCTCCCCTGCAATACAAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTTC
  5   1   2       bld Brn3                            IMAGE:8537694.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGAGTCCTACACACACTGATTCGTTGTCGCTTCTCCCCTGCATCAGCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACTGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCtatatatatatatataCACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTGGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAACAAAAAGGTGACACTGTTGATATACTACAGGTGATATTGATGCANGGCCGTACATGTTGGGAGATGGGGGATGTNATATATGTGATACTATGGGGGTGGGGCTGCTGTATCTGACCTTTNAGATCTCATAACTTCTCACATTaaaaaaaaaaaaaaaGGCGCCAGCTGATCCAACCGTCGCT
  5  -1   2       bld Bla2                            IMAGE:7300426.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   NGCTAGATGGTGAGGCCCGTCTAGTAGGCATCAGTCGAGATACGACTCTATCTCGGCAGTCTCCCAGATGTTGTTCTGATAACATGCACAGTGTTCAGGTGTCACAGTGAGTGTATTTATTGTACGGTCGATAGGAGAATGACAATCCAAAGCTGTTAGAGAGTAGTGGCTCCATGGCACAAGCTTGGAGCAGCTCTTGGACGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCtatatatatatataCACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGaaaaaaaaGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATgggggtggggggCTTGCTGTATTTCTGATCGCTTTTAAGGATTCTCTAATAAACCTTTCTCAAACaaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCAATCGCCCAAGAGGG
  5   1   2       bld Ga15      in                       XL497k24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCtatatatatatataCACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGaaaaaaaaGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTATATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACNTAATGGGGGNGGGG
  3   1   2       bld Ga15      in                       XL497k24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTNGAGTTGTAGTTTATGATTTGTTANCGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTATATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTATTTCTGATCGCTTTAAG
  3   1   2      seed Neu7 5g3  in                         XL043n05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCATGTGTAAGAGATGTAAGCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTTGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCT
  3   1   2       bld Neu7 5g3  in                         XL045p17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTGGCATCCATGTGACAACAAGCTTGTGAGCAGCTCTAGGGACGGTAACCTCCGTGTCTGGGAATATCGCCAGGCTGAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTACCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGCATATTGAATGCAGGGCCGTTACATGTTAGGAA
  3   1   2       bld Ov1       in                    IMAGE:5074292.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGTTTTACCCTGAAGACCTGCGTACCCCTCCAATGGAATCTAGCTGATATGTGCCATGACAGAGATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTATTTCTGATCGCTTTTAAGGATTCTCTAGTAAACATTTCTCAAACAAAC
  3   1   2       bld Ooc3 5g3  in                    IMAGE:3437809.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGTATATGTGTACACTAGAGGGGAAAGGACGGCATAGAATTGTATAAAATGTGAGGTGCTAAATCTCTGATTGTGTGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGCCAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAACCAGCATGAAAAAAAAGGTGACCCTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTATTTCTGATCGCTTTTAAGGATTCTCTAATAAACCTTCTCCAACCATTAAAAAAAAAAAAAAC
  3   1   2       bld Sp1  5g3  in                    IMAGE:4174218.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAACAAATCTATATATATATATACACACTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTATTTCTGATCGCTTTTAAGGATTCTCTAATAAACCTTTCTCAAACAAAA
  3   1   2       bld Li1                             IMAGE:5129490.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCAAAGTTAAAAACAAAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTATTTCTGATCGCTTTTAAGGATTCTCTAATAAACCTTTCTCAACCAAAAAAAA
  5  -1   2       bld Brn2                             Brn2-za63g09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATACATAATGGACAGCATTTTGATTCTACCTATTTTGCCACAATATATGCAAATCTTTGACTTCTAATTTCAGGATTTACTTTAAATGTATGTTTAAGTTCAGTGGAGAAGAATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGaaaaaaaaGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATgggggtggggggCTTGCTGTATTTCTGATCGCTTTTAAGGATTCTCTAATAAACCTTTCTCAAACATTT
  3   1   2       bld Ga18                             rxlk140p07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTATGTTAGGTATGTACATTTTCAGGTGTGCAATAATTAGGCATGAATTCTGTACGGCATGTGTTTACATGCAGTTTATGTTAGTAAAACAGCATGAAAAAAAAGGTGACACTGTTGATATACTAACAGGTGATATTGAATGCAGGGCCGTTACATGTTAGGAAGATGGGGGGATGTTAATAATATGTGATACATAATGGGGGTGGGGGGCTTGCTGTNNTTCTGATCGCNTNTAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)