Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL499a22ex.5                         68 END     1           1        1                Unknown (protein for IMAGE:6959230) [Xenopus laevis]
     2   2.0    0Xl3.1-IMAGE:6867558.5                      67 END     1           1        1                catenin (cadherin-associated protein), delta 1 [Xenopus tropicalis]
     3   2.0    0Xl3.1-xl230o24.3                            3 END     1           1       33                LOC431876 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-xl230o24.3                            3 PI      98       1538     1662                LOC431876 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012837668 Xl3.1-XL451g08ex.3.5 - 68 ESTs
                                                                       ...-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-XL451g08ex.3.5              CGGAAGTTTCTGGAGGCCGCGTGTATTACAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTTAAAGATGTGGATGGCCCTGTGCAGACTGTGTCTCAGCTGTTGTCCCATAAGAAGCCAAAGGCAGAAGGTTATGCCGCTACATCACTTTCTCTTTATCATTGTGCATCTTTGGTTGACTTTCTTACAGTGGAGAATCCTGTTGACTTTCTCTCAAAAACCAGTGAGATTGCTCTGGATGACACTGAGCTCGAGAAACATCCAGCCACAACAAATGATATACGCGAATGTTGTCGAGATATCAAAGTATTGGGCCGAAAGGAGCTTAGGTTGCTCTTAAACTGGCGTTCTAAACTACGCAGACATCTTGCCAGAAAATTAAAGGAGGCATCTAAAGAATCTGCAATGGAAATAATTCTTAGTTCTGATGAGGAAGAAGAAAAGCAAAAGAAGGACATATGTGATAAAGATTATAATCTGGAGGATGAAGAACTGCACAGGAAGCTGGCTGAAGTTAAAGCTGAAGAACTAACAGCACTTAAGAGGAAAAAGAAGCGTATATTGAAGACCCAGAGGCGGCAGAGAGAGCGGGTTGAACTTAAAATGGATCTTCCTGGAGTTTCTATTGCTGATGAAGGGGAGACTGGCATGTTTTCACTGCATACAATTGGCAAGAATGAGCTTCTGCAGACACTCTCTAAAGGGGATATGTGTGCCGCAGACTCCCTTATATTAGATGACATTCATAATGATGATGTTGTTTTCTCAAATGATGAGACTGAAGAATTGGAGGGAGTAGATGAAATATCTCTTGCAAGTGATTTGGAAGATTATGAGCTGCAGGAAATTCATGCATGTGAGAAAAGTGCAAGGAACAAAAGAATTCAGTATCCGGTTAAAGATTGTTGGATGAAGGATGAAGTACAGATTAACCCGTTACTTGTTTCTCTAGAAGATACATCAGATCGTGAACAGAGAGACACCAGTATGTGGTTTGGAAAGGGAATATTTTCTTCATTGGATCTTGGTGCAGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAAAATCCCACTGAAAATGCCAGATCGAATTAGAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGACACTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTTGTGCATCTGAGAATCATTTTATTGTCTCAACCTCCACAGCAATATTGCATTAATATTGTTGAATGCAGATATATCTGACTGCAGAAAATGTGGACTTAGGGAAAGTATTTACTGGAATTCCAAAAACCAACAGCCCATAAAGTTCAGTGTTTTCAAAAATGGAATGTTCAAATTTGTTGGCAAAATATT
                                                  Xl3.1-CHK-1012722265                    TTTCTGGAGGCCGCGTGTATTACAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTTAAAGATGTGGATGGCCCTGTGCAGACTGTGTCTCAGCTGTTGTCCCATAAGAAGCCAAAGGCAGAAGGTTATGCCGCTACATCACTTTCTCTTTATCATTGTGCATCTTTGGTTGACTTTCTTACAGTGGAGAATCCTGTTGACTTTCTCTCAAAAACCAGTGAGATTGCTCTGGATGACACTGAGCTCGAGAAACATCCAGCCACAACAAATGATATACGCGAATGTTGTCGAGATATCAAAGTATTGGGCCGAAAGGAGCTTAGGTTGCTCTTAAACTGGCGTTCTAAACTACGCAGACATCTTGCCAGAAAATTAAAGGAGGCATCTAAAGAATCTGCAATGGAAATAATTCTTAGTTCTGATGAGGAAGAAGAAAAGCAAAAGAAGGACATATGTGATAAAGATTATAATCTGGAGGATGAAGAACTGCACAGGAAGCTGGCTGAAGTTAAAGCTGAAGAACTAACAGCACTTAAGAGGAAAAAGAAGCGTATATTGAAGACCCAGAGGCGGCAGAGAGAGCGGGTTGAACTTAAAATGGATCTTCCTGGAGTTTCTATTGCTGATGAAGGGGAGACTGGCATGTTTTCACTGCATACAATTGGCAAGAATGAGCTTCTGCAGACACTCTCTAAAGGGGATATGTGTGCCGCAGACTCCCTTATATTAGATGACATTCATAATGATGATGTTGTTTTCTCAAATGATGAGACTGAAGAATTGGAGGGAGTAGATGAAATATCTCTTGCAAGTGATTTGGAAGATTATGAGCTGCAGGAAATTCATGCATGTGAGAAAAGTGCAAGGAACAAAAGAATTCAGTATCCGGTTAAAGATTGTTGGATGAAGGATGAAGTACAGATTAACCCGTTACTTGTTTCTCTAGAAGATACATCAGATCGTGAACAGAGAGACACCAGTATGTGGTTTGGAAAGGGAATATTTTCTTCATTGGATCTTGGTGCAGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAAAATCCCACTGAAAATGCCAGATCGAATTAGAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGACACTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTTGTGxxxxTxAGAATCATTTTATTGTCTCAACCTCCACAGCAATATTGCATTAATATTGTTGAATGCAGATATATCTGACTGCAGAAAATGTGGACTTAGGGAAAGTATTTACTGGAATTCCAAAAACCAACAGCCCATAAAGTTCAGTGTTTTCAAAAATGGAATGTTCAAATTTGTTGGCAA
                                                      consensus depths                   3     5     5     6     8    10    10    12    12    16    14    17    14    18    15    19    17    20    18    20    19    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    21    21    20    21    21    21    21    21    21    21    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    17    19    18    19    19    20    19    20    19    20    19    20    16    19    15    18    14    18    14    18    14    18    15    18    12    18    10    15    12    15    12    15    11    14     8    13     6    11     8    11     8    10     4     8     3     7     3     7     3     5     3     5     3     4     2     3     2     3     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     4     5     5     5     5     5     5     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     4     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     4     5     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     8    10     8    10     8    10     8    11     8    11     9    11     9    11     9    12     9    14     9    15    10    15    11    15    11    15    12    15    12    15    14    15    12    15    11    15    12    15    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    14    14    14    14    13    15    14    15    14    16    13    17    16    18    14    18    18    19    17    19    19    22    20    22    20    22    19    22    19    22    17    22    18    21    22    22    20    22    21    22    20    22    22    23    20    22    17    22    20    23    19    22    21    23    21    24    19    25    26    29    24    30    17    29    22    28    14    28    23    28    22    27    25    27    23    25    20    25    24    26    20    26    24    26    24    26    25    26    25    26    25    26    25    26    24    26    24    26    25    26    24    26    23    24    24    24    24    24    22    22    18    21    18    21    18    21    18    21    18    21    18    21    17    21    17    21    16    21    15    20    15    20    14    19    14    19    13    19    13    18     5    10     4     9     4     6     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3
  5   1   2      ests                               Xl3.1-XL451g08ex.5             CCGGAAGTTTCTGGAGGCCGCGTGTATTACAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTTAAAGATGTGGATGGCCCTGTGCAGACTGTGTCTCAGCTGTTGTCCCATAAGAAGCCAAAGGCAGAAGGTTATGCCGCTACATCACTTTCTCTTTATCATTGTGCATCTTTGGTTGACTTTCTTACAGT
  5   1   2      ests                               Xl3.1-XL451g08ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAATTAAAGGAGGCATCTAAAGAATCTGCAATGGAAATAATTCTTAGTTCTGATGAGGAAGAAGAAAAGCAAAAGAAGGACATATGTGATAAAGATTATAATCTGGAGGATGAAGAACTGCACAGGAAGCTGGCTGAAGTTAAAGCTGAAGAACTAACAGCACTTAAGAGGAAAAAGAAGCGTATATTGAAGACCCAGAGGCGGCAGAGAGAGCGGGTTGAACTTAAAATGGATCTTCCTGGAGTTTCTATTGCTGATGAAGGGGAGACTGGCATGTTTTCACTGCATACAATTGGCAAGAATGAGCTTCTGCAGACACTCTCTAAAGGGGATATGTGTGCCGCAGACTCCCTTATATTAGATGACATTCATAATGATGATGTTGTTTTCTCAAATGATGAGACTGAAGAATTGGAGGGAGTAGATGAAATATCTCTTGCAAGTGATTTGGAAGATTATGAGCTGCAGGAAATTCATGCATGTGAGAAAAGTGCAAGGAACAAAAGAATTCAGTATCCGGTTAAAGATTGTTGGATGAAGGATGAAGTACAGATTAACCCGTTACTTGTTTCTCTAGAAGATACATCAGATCGTGAACAGAGAGACACCAGTATGTGGTTTGGAAAGGGAATATTTTCTTCATTGGATCTTGGTGCAGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAAAATCCCACTGAAAATGCCAGATCGAATTAGAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGACACTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTGTGCATCTTTAGAATCATTTTATTGTCTCAACCTCCACAGCAATATTGCATTAATATTGTTGAATGCAGATATATCTGACTGCAGAAAATGTGGACTTAGGGAAAGTATTTACTGGAATTCCAAAAACCAACAGCCCATAAAGTTCAGTGTTTTCAAAAATGGAATGTTCAAATTTGTTGGCAAAATATTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----A------
                                               BLH ATG      73    1325              
                                               BLH MIN      73     289              
                                               BLH MPR      70     289              
                                               BLH OVR      73      32              
                                               CDS MIN      73      14              
                                               EST CLI      18      14              
                                               ORF LNG      73       6              
  5   1   2      ests                               Xl3.1-XL451g08ex.5             CCGGAAGTTTCTGGAGGCCGCGTGTATTACAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTTAAAGATGTGGATGGCCCTGTGCAGACTGTGTCTCAGCTGTTGTCCCATAAGAAGCCAAAGGCAGAAGGTTATGCCGCTACATCACTTTCTCTTTATCATTGTGCATCTTTGGTTGACTTTCTTACAGT
                                                  Xl3.1-CHK-1012689328                   GTTTCTGGAGGCCGCGTGTATTACAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTTAAAGATGTGGATGGCCCTGTGCAGACTGTGTCTCAGCTGTTGTCCCATAAGAAGCCAAAGGCAGAAGGTTATGCCGCTACATCACTTTCTCTTTATCATTGTGCATCTTTGGTTGACTTTCTTACAGTGGAGAA
  5   1   2       bld Ooc1 5x3  out                     xlnoc003n23.5p TAAAGCGACTTACCGGAAGTTTCTGGAGGCCGCGTGTATTACAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAAGAGGCTTGCCTTAAGGTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGGTTTTTAAGATAGTG
  5   1   2       chi Ga15                               XL512h09ex.5p  CAAAACGTGAACGATTCTTTAAGAGCGTGTTTACAATACCGCATGGACTGTTAGTGACTTATAAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTTAAAGATGTGGATGGCCCTGTGCAGACTGTGTCTCA
  5   1   2       bld Ov1  5g                         IMAGE:8330081.5p    AGCGACTTACCGGAAGTTTCTGGAGGCCGCGTGTATTACAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTNNTTTGGCCCAGATAAAATAGACACCCGATTCTTTGACCCAAATT
  5   1   2       bld DMZ  5g                              xl233i06.5p         CGATTCGAATCGGCACGAGGGCCGCGTGTATTACAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTTAAAAGATGTGG
  5   1   2       bld Emb4 5g                         IMAGE:5543500.5p             CCGGAAGTTTCTGGAGGCCGCGTGTATTACAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCCGAGATCTTTGTCGTGTGCCAGGGGTTTTTTGGGCCCaaaaaaataaaaCCCCCGATTCTTTGCCCCCCAATTTGGCTTTTAAAGATGGGGATGGGCCCTGTGCCGACCGGGGTCTCCGCTGTTGGCCCCAAGGAAGCCCCAAGGGAGAAAGGGTACGGCCCCTACATCACTTTTCCCTTTATCCTTGGGGCACCTTTGGCGCGGCTTTTTCCTAGAGGGGGGAAAGACCCTGGTGCCTTTTCCCCTCCAACCCCCCGGGCGCTGGCGTGTG
  5   1   2       bld Ga12 5g3  in                         XL200j04.5p               GGAAGTTTCTGGAGGCCGCGTGTATTACAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATATCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTT
  5   1   2       bld DMZ       out                        xl230o24.5p                               CGCGTGTATTACAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCCAGATAAAATAGACACCCGATTCTTTGACCCCNAATTTGCTTTTAAGATGTGGAT
  5   1   2       bld Emb4 5g                         IMAGE:5572762.5p                                GCGTGTATTACAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATTCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTTAAAGATGTGGATGGCCCTGTGCAGACTGTGTCTCAGCTGTTGTCCCATAAGAAGCCAAGGGCAGAAGGTTATGGCCGCTACATCACCTTTCTCTTTTATCATTGGGGCAAT
  5   1   2       bld Sp1       in                    IMAGE:4175265.5p                                   TGTATTACAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATTGTGTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCA
  5   1   2       bld Ga18      in                       xlk65f06ex.5p                                    GNNATTACAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAANNTAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGNTGGNTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGNTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGNATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCANGGTTTTTTGGCCCCAGATAAAATAGANACCCGATTCTTTGACCCCAAATTTGCTTTTAAAGATGTGGANGGCCCTGTNCAGACTGTGTCTCAGCTGTTGTCCCATAAGAAGNCAAANNAGAAGGNNNGCCNCTACATCACTTTCTC
  5   1   2       bld Tbd7 5g3  in                         XL090a05.5p                                          GAAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCC
  5   1   2      seed Ga15 5g3  in                       XL451g08ex.5p                                           AAAACGTGAACGATTCTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTTAAAGATGTGGATGGCCCTGTGCAGACTGTGTCTCAGCTGTTGTCCCATAAG
  5   1   2       bld Ga15      in                       XL519i17ex.5p                                                     CGATTCTTTAAGAGAGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGCGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCGGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCTCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTTAAAGATGTGGATGGCCCTGTGCAGACTGTGTCTCAGCTGTTGTCCCATAAGAAGCCAAAGGCAGAAGGTTATGCCGCTACATCACTTTCTCTTTATCATTGTGCATCTTTGGTTGACT
  5   1   2       bld Sp1       in                    IMAGE:4965486.5p                                                      GACCCACGCGTCCGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTT
  5   1   2       bld Neu7 5g3  in                         XL013c19.5p                                                          CTTTAAGAGGGCCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGGTTTTTTTGGCCCC
  5   1   2       bld Ga18 5g3  in                      xlk124i13ex.5p                                                          TCTTTAAGAGGNNCTTTCTGCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGNTAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGNCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCNNNNNTCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGNNTTTTTGGCCCCAGATAAAATAGACACCCGANTCTTTGACCCCAAATTTGCTTTTAAAGATGNGGANGNCCCTGTNNAGACTGTGTCTCAGCTGTTGTCCNNNNAAGAAGNCAAANNAGNAGGNTNTGCCGCTACNTCACTTT
  5   1   2       bld Neu7 5g3  in                         XL047f09.5p                                                                         CTGCTATCTAATATGGGGNAAGNAGGGGAAAGTCGGAAAGAGCCGGAGGATAAGTTCTATCATTTAGCCAAAGNAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGT
  5   1   2       bld Ga18 5g                             xlk6b05ex.5p                                                                             GCTATCTAATATGGGGAAGAAGGGGAAAGTCGGAAAGAGCCGGAAGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGNTCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGANAGTGAACTCCACCAAGCCCCAGGNATCTCGCAGTGAGAGTNCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGNCCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTTAAAGATGTGGATGGCCCTGTNNAGACTGTGTCTCAGCTGTTGTCCCATAAGNNGNCAAANNAGNANGG
  5   1   2       bld DMZ                                  xl276h03.5p                                                                                                 ATCGATTCGCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGGGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCGGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTTAAAGATGTGGATGGCCCTGTGCAGACTGTGTCTCAGCTGTTGTCCCATAAG
  5   1   2       bld Ga15      in                       XL417m22ex.5p                                                                                                   GGAAAGTCGGAAAGAGCCGGAAGGATAAGTTCTATCATTTAGCCAAAGAGACTGGTTACCGGTCTCGTTCTGCATTCAAGCTTATTCAGCTAAATAGAAAATTTCAATTTTTGCAGAGAGCTCGTGCTCTTGTGGATCTGTGTGCTGCCCCAGGAGGCTGGCTTCAAGTTGCGGCAAAGTTTATGCCAGTATCCAGTCTTATTATAGGAATAGACCTAGTACCCATAAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCAGACGTGGTTCTGAATGATGGGGCACCAAATGTTGGAGCAAACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCCAGAGGTGGTTGGTTCATTACTAAAATATTTCGCTCATCGGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTTAAAGATGTGGATGGCCCTGTGCAGACTGTGTCTCAGCTGTTGTCCCATAAGAAGCCAAAGGCAGAAGGTTATGCCGCTACATCACTTTCTCTTTATCATTGTGCATCTTTGGTTGACTTTCTTACAGTGGAGAATCCTTTTGA
  5   1   2       bld DMZ                                  xl331o01.5p                                                                                                                                                                                                                                                                                                                                     AAAACCCATTCCTAATGTGTTGACTCTACAGGAAGATATAACGACTGAGGACTGCAGACAGGCAGTGAAGAAGCATTTGCAGACATGGAAGGCANACGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCANACTGGACACATGATGCTTTCTCACAAGTGCATCTCTCTCTGATGGCCCTTCGTCTAGCCTGTGACTGTCTCTCAAG
  5   1   2       bld Emb4                            IMAGE:5542404.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCATTACTAAAATATTTCGCTCATCTGATTATCAGTCACTGCTCTGGATCCTACAGCAGTTTTTTAAGAAAGTGAACTCCACCAAGCCCCAGGCATCTCGCAGTGAGAGTGCAGAGATCTTTGTCGTGTGCCAGGGTTTTTTGGCCCCAGATAAAATAGACACCCGATTCTTTGACCCCAAATTTGCTTTTAAAGATGTGGATGGCCCTGTGCAGACTGTGTCTCAGCTGTTGTCCCATAAGAAGCCAAAGGCAGAAGGTTATGCCGCTACATCACTTTCTCTTTATCATTGTGCATCTTTGGTTGACTTTCTTACAGTGGAGAATCCTGTTGACTTTCTCTCAAAAACCAGTGAGATTGCTCTGGATGACACTGAGCTCGAGAAACATCCAGCCACAACAAATGATATACGCGAATGTTGTCGAGATATCAAAGTATTGGGCCGAAAGGAGCTTAGGTTGCTCTTAAACTGGCGTTCTAAACTACGCAGACATCTTGCCAGAAAATTAAAGGAGGCATCTAAAGAATCTGCAATGGAAATAATTCTTAGTTCTGATGAGGAAGAAGAAAAGCAAAAGAAGGACATATGTGATAAAGATTATAATCTGGAGGATGAAGAACTGCACAGGAAGCTGGCTGAAGTTAAAGCTGAAGAACTAACAGCACTTAAGAGGAAAAAGAAGCGTATATTGAAGACCCAGAGGCGGCAGAGAGAGCGGGTTGAACTTAAAATGGATCTTCCTGGAGTTTCTATTGCTGATGAAAGGGAGACTGGCATGTTTTCACTGCATACCATTGGCAAGAATGAGCTTTCTGCAGACACTCTTCTAAGGGGGATTATGTGTGCCCCAAAACTCCCCTTAATATTAGAATGACA
  5   1   2      ests                               Xl3.1-XL451g08ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAATTAAAGGAGGCATCTAAAGAATCTGCAATGGAAATAATTCTTAGTTCTGATGAGGAAGAAGAAAAGCAAAAGAAGGACATATGTGATAAAGATTATAATCTGGAGGATGAAGAACTGCACAGGAAGCTGGCTGAAGTTAAAGCTGAAGAACTAACAGCACTTAAGAGGAAAAAGAAGCGTATATTGAAGACCCAGAGGCGGCAGAGAGAGCGGGTTGAACTTAAAATGGATCTTCCTGGAGTTTCTATTGCTGATGAAGGGGAGACTGGCATGTTTTCACTGCATACAATTGGCAAGAATGAGCTTCTGCAGACACTCTCTAAAGGGGATATGTGTGCCGCAGACTCCCTTATATTAGATGACATTCATAATGATGATGTTGTTTTCTCAAATGATGAGACTGAAGAATTGGAGGGAGTAGATGAAATATCTCTTGCAAGTGATTTGGAAGATTATGAGCTGCAGGAAATTCATGCATGTGAGAAAAGTGCAAGGAACAAAAGAATTCAGTATCCGGTTAAAGATTGTTGGATGAAGGATGAAGTACAGATTAACCCGTTACTTGTTTCTCTAGAAGATACATCAGATCGTGAACAGAGAGACACCAGTATGTGGTTTGGAAAGGGAATATTTTCTTCATTGGATCTTGGTGCAGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAAAATCCCACTGAAAATGCCAGATCGAATTAGAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGACACTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTGTGCATCTTTAGAATCATTTTATTGTCTCAACCTCCACAGCAATATTGCATTAATATTGTTGAATGCAGATATATCTGACTGCAGAAAATGTGGACTTAGGGAAAGTATTTACTGGAATTCCAAAAACCAACAGCCCATAAAGTTCAGTGTTTTCAAAAATGGAATGTTCAAATTTGTTGGCAAAATATTTT
                                                  Xl3.1-CHK-1012686848                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGGAGGCATCTAAAGAATCTGCAATGGAAATAATTCTTAGTTCTGATGAGGAAGAAGAAAAGCAAAAGAAGGACATATGTGATAAAGATTATAATCTGGAGGATGAAGAACTGCACAGGAAGCTGGCTGAAGTTAAAGCTGAAGAACTAACAGCACTTAAGAGGAAAAAGAAGCGTATATTGAAGACCCAGAGGCGGCAGAGAGAGCGGGTTGAACTTAAAATGGATCTTCCTGGAGTTTCTATTGCTGATGAAGGGGAGACTGGCATGTTTTCACTGCATACAATTGGCAAGAATGAGCTTCTGCAGACACTCTCTAAAGGGGATATGTGTGCCGCAGACTCCCTTATATTAGATGACATTCATAATGATGATGTTGTTTTCTCAAATGATGAGACTGAAGAATTGGAGGGAGTAGATGAAATATCTCTTGCAAGTGATTTGGAAGATTATGAGCTGCAGGAAATTCATGCATGTGAGAAAAGTGCAAGGAACAAAAGAATTCAGTATCCGGTTAAAGATTGTTGGATGAAGGATGAAGTACAGATTAACCCGTTACTTGTTTCTCTAGAAGATACATCAGATCGTGAACAGAGAGACACCAGTATGTGGTTTGGAAAGGGAATATTTTCTTCATTGGATCTTGGTGCAGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAAAATCCCACTGAAAATGCCAGATCGAATTAGAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGACACTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTxxxxxxCTTTAGAATCATTTTATTGTCTCAACCTCCACAGCAATATTGCATTAATATTGTTGAATGCAGATATATCTGACTGCAGAAAATGTGGACTTAGGGAAAGTATTTACTGGAATTCCAAAAACCAACAGCCCATAAAGTTCAGTGTTTTCAAAAATGGAATGTTCAAATTTGTTGGCAAAA
  5   1   2       bld Tad2                            IMAGE:6936513.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGGCCGAAAGGAGCTTAGGTTGCTCTTAAACTGGCGTTCTAAACTACGCAGACATCTTGCCAGAAAATTAAAGGAGGCATCTAAAGAATCTGCAATGGAAATAATTCTTAGTTCTGATGAGGAAGAAGAAAAGCAAAAGAAGGACATATGTGATAAAGATTATAATCTGGAGGATGAAGAACTGCACAGGAAGCTGGCTGAAGTTAAAGCTGAAGAACTAACAGCACTTAAGAGGAAAAAGAAGCGTATATTGAAGACCCAGAGGCGGCAGAGAGAGCGGGTTGAACTTAAAATGGATCTTCCTGGAGTTTCTATTGCTGATGAAGGGGAGACTGGCATGTTTTCACTGCATACAATTGGCAAGAATGAGCTTCTGCAGACACTCTCTAAAGGGGATATGTGTGCCGCAGACTCCCTTATATTAGATGACATTCATAATGATGATGTTGTTTTCTCAAATGATGAGACTGAAGAATTGGAGGGAGTAGATGAAATATCTCTTGCAAGTGATTTGGAAGATTATGAGCTGCAGGAAATTCATGCATGTGAGANAAGTGCAAGGAACAAAAAGAATTCAGTATCCGGGTTAAAAGATTGTTTGGATGAAAGGGATGAAGTACCAGATTAAACCCGGTTTACTTGTTTTCTCCTAGAAAAATACATCCAGAATCGTGGAACAGGAGAAGAACACCCAGGTATTTTGGGGTTTTGGCAAAAAGGGAAAATATTTTTTCCCTTCCATTGGGGATTCCTTGGGGTGCCCAGAATTTAAAAAGAAATATTGGGGGAGGAAATTTAA
  5   1   2       bld Neu7      in                         XL033h13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAATTAAAGGAGGCATCTAAAGAATCTGCAATGGAAATAATTCTTAGTTCTGATGAGGAAGAAGAAAAGCAAAAGAAGGACATATGTGATAAAGATTATAATCTGGAGGATGAAGAACTGCACAGGAAGCTGGCTGAAGTTAAAGCTGAAGAACTAACAGCACTTAAGAGGAAAAAGAAGCGTATATTGAAGACCCAGAGGCGGCAGAGAGAGCGGGTTGAACTTAAAATGGATCTTCCTGGAGTTTCTATTGCTGATGAAGGGGAGACTGGCATGTTTTCACTGCATACAATTGGCAAGAATGAGCTTCTGCAGACACTCTCTAAAGGGGATATGTGTGCCGCAGACTCCCTTATATTAGATGACATTCATAATGATGATGTTGTTTTCTCAAATGATGAGACTGAAGAATTGGAGGGAGTAGATGAAATATCTCTTGCAAGTGATTTGGAAGATTATGAGCTGCAGGAAATTCATGCATGTGAGAAAAGTGCA
  5   1   2       bld Emb3                            IMAGE:3400612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGCGTCCGAGAAAAGCAAAAGAAGGACATATGTGATAAAGATTATAATCTGGAGGATGAAGAACTGCACAGGAAGCTGGCTGAAGTTAAAGCTGAAGAACTAACAGCACTTAAGAGGAAAAAGAAGCGTATATTGAAGACCCAGAGGCGGCAGAGAGAGCGGGTTGAACTTAAAATGGATCTTCCTGGAGTTTCTATTGCTGATGAAGGGGAGACT
  5   1   2       bld Ga15      in                       XL492g08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGAAAAGCAAAAGAAGGACATATGTGATAAAGATTATAATCTGGAGGATGAAGAACTGCACAGGAAGCTGGCTGAAGTTAAAGCTGAAGAACTAACAGCACTTAAGAGGAAAAAGAAGCGTATATTGAAGACCCAGAGGCGGCAGAGAGAGCGGGTTGAACTTAAAATGGATCTTCCTGGAGTTTCTATTGCTGATGAAGGGGAGACTGGCATGTTTTCACTGCATACAATTGGCAAGAATGAGCTTCTGCAGACACTCTCTAAAGGGGATATGTGTGCCGCAGACTCCCTTATATTAGATGACATTCATAATGATGATGTTGTTTTCTCAAATGATGAGACTGAAGAATTGGAGGGAGTAGATGAAATATCTCTTGCAAGTGATTTGGAAGATTATGAGCTGCAGGAAATTCATGCATGTGAGAAAAGTGCAAGGAACAAAAGAATTCAGTATCCGGTTAAAGATTGTTGGATGAAGGATGAAGTACAGATTAACCCGTTACTTGTTTCTCTAGAAGATACATCAGATCGTGAACAGAGAGACACCAGTATGTGGTTTGGAAAGGGAATATTTTCTTCATTGGATCTTGGTGCAGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAAAATCCCACTGAAAATGCCAGATCGAATTAAAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGGCTATAACCAGCCAGCACTGCAAAGG
  5   1   2       bld Neu7                                 XL030o02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGCAGGNAATTCGGCACGAGGCTGCACAGGNAAGCTGGCTGAAGTTAAAGCTGAAGAACTAACAGCACTTAAGAGGAAAAAGAAGCGTATATTGAAGACCCAGAGGCGGCAGAGAGAGCGGGTTGAACTTAAAATGGATCTTCCTGGAGTTTCTATTGCTGATGAAGGGGAGACTGGCATGATTTCACTGCATACAATTGGCAAGAATGAGCTTCTGCAGACACTCTCTAAAGGGGATATGTGTGCCGCAGACTCCCTTATATTAGATGACATTCATAATGATGATGTTGTTTTCTCAAATGATGAGACTGAAGAATTGGAGGGAGTAGATGAAATATCTCTTGCAAGTGATTTGGAAGATTATGAGCTGCAGGAAATTCATGCATGTGAGAAAAGTGCAAGGAACAAAAGAATTCAGTATCCGGTTAAAGATTGTTGGATGAAGGATGAAGTACAGATTAACCCGTTACTTGTTTCTCTAGAAGATACATCAGATCGTGAACAGAGAGACACCAGTATGTGGTTTGGAAAGGGAATATTTTCTTCATTGGATCTTGGTGCAGATGAAGAT
  5   1   2       bld Skin                            IMAGE:8644991.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTGCAACACTCTCTAAAGGGGATATGTGTGCCGCAGACTCCCTTATATTAGATGACATTCATAATGATGATGTTGTTTTCTCAAATGATGAGACTGAAGAATTGGAGGGAGTAGATGAAATATCTCTTGCAAGTGATTTGGAAGATTATGAGCTGCAGGAAATTCATGCATGTGAGAAAAGTGCAAGGAACAAAAGAATTCAGTATCCGGTTAAAGATTGTTGGATGAAGGATGAAGTACAGATTAACCCGTTACTTGTTTCTCTAGAAGATACATCAGATCGTGAACAGAGAGACACCAGTATGTGGTTTGGAAAGGGAATATTTTCTTCATTGGATCTTGGTGCAGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAAAATCCCACTGAAAATGCCAGATCGAATTAGAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCNAGACTATGGAAAGAAGTGCGGGGGAAAGGAAGAGTCAGGAGAAGAGATAAGCAGATTTTGAGTAGTGCTATAGACGTACAGTAACGATTCGTGTGGTGGCCAGATGGCTGCTCTGNACAGTATGCTACTCTAGAATCACAGAATCTATGATGGTCTCATAACTATTTA
  3   1   2       bld Ga18      in                       xlk65f06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTNNTGCANNNNGAGAAAAGTNNNNGNANNAAAAGNNTTCAGTATCCGNTNAANNNNTGGATGAAGGATGAAGTACAGATTNNNCGTTACTTNTTTNNTNNNANAGATACATCNGATCGNGNACAGAGAGNNNCNAGTNTGTGGTTTGGAAAGGGNNNATTTTCTNNATTGGATCTTGGNGCAGATGAAGATATGGAGATTAAGNAAATGCNACTTTTGAAAGGAAATAAAATGGGNAAANNCCCNCTGAAAATGCCAGATCGAATTAAAAATAAACCTTTACAACTNNNCNGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGNACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGNCTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGNCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTAnnnGAAGCAAAAGCAAGAAAAAAGAGAAGGACACTCAAGAAGATGGAACAAATGAAAAAAAAANNNNNANCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTNNACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGNCCATTTCAAGGNNGNAG
  5   1   2       bld Lmb2                            IMAGE:8637618.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAAGGAACAAAGAATTCAGTATCCGGTTAAAGATTGTTGGATGAAGGATGAAGTACAGATTAACCCGTTACTTGTTTCTCTAGAAGATACATCAGATCGTGAACAGAGAGACACCAGTATGTGGTTTGGAAAGGGAATATTTTCTTCATTGGATCTTGGTGCAGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAAAATCCCACTGAAAATGCCAGATCGAATTAAAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAAATCACAAGAGATCTAATTGATGGTTCCTTCATAGACGTAATTTTATGATGATGAGGATGAACTCCGGATTGTTNGTGTCAGAGAGAGGAGCACAGGATGTTCAGTTCTGTGATCGACTATGATGAGATATCGAAGCTCACGAGACTATGCTCTCATTAAAGTACGAGCAAGCAGAAAGAGAGACTCAGAGAGACATGAAAAGCTGACTGTACCGGAATCAGAGACTCACTCATAAGAAGTCG
  5   1   2       bld DMZ       in                         xl303j09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAGAATTCAGTATCCGGTTAAAGATTGTTGGATGAAGGATGAAGTACAGATTAACCCGTTACTTGTTTCTCTAGAAGATACATCAGATCGTGAACAGAGAGACACCAGTATGTGGTTTGGAAAGGGAATATTTTCTTCATTGGATCTTGGTGCAGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAATATCCCACTGAAAATGCCAGATCGAATTAGAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAACGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATT
  5   1   2       bld DMZ       in                         xl224k11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAGAATTCAGTATCCGGTTAAAGATTGTTGGATGAAGGATGAAGTACAGATTAACCCGTTACTTGTTTCTCTAGAAGATACATCAGATCGTGAACAGAGAGACACCAGTATGTGGTTTGGAAAGGGAATATTTTCTTCATTGGATCTTGGTGCAGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAATATCCCACTGAAAATGCCAGATCGAATTAGAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAACGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAA
  5   1   2       bld Ga15      in                       XL405l22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGATCGTGAACAGAGAGACACCAGTATGTGGTTTGGAAAGGGAATATTTTCTTCATTGGATCTTGGTGCAGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAAAATCCCACTGAAAATGCCAGATCGAATTAGAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGAATTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTANCTGAAGCAAAAGCNA
  3   1   2       bld Ga15      in                       XL405l22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGATCGTGAACAGAGAGACACCAGTATGTGGTTTGGAAAGGGAATATTTTCTTCATTGGATCTTGGTGCAGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAAAATCCCACTGAAAATGCCAGATCGAATTAGAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGAATTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAAC
  5   1   2       bld Tbd4                   IMAGE:4059562-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCATCCGGATTTCGAAATTCCCCGCGGTGCAGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAAAATCCCACTGAAAATGCCAGATCGAATTAGAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGAATTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTaaaaaagtagctgaagcaaaagcaagaaaaaagagaaggacactcaagaagatggaacaaatgaaaaaaaaaGCTGAAGCAGTGGT
  5   1   2       bld Tbd4                            IMAGE:4059562.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAAAATCCCACTGAAAATGCCGGATCGAATTAGAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGAATTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAG
  5   1   2       bld Emb4                            IMAGE:4203632.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGATAAGCAATGCACTTTTGAAGGAATAAAAGGGCAAATCCCACTGAAATGCCAGATCGAATTAGAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATGTGTTGAAAAGTCTGGGGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGG
  5   1   2       chi Gas8      in                    IMAGE:3517618.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGCAGATGAAGATATGGAGATTAAGCAAATGCAACTTTTGAAAGGAAATAAAATGGGCAAAATCCCACTGAAAATGCCAGGCCAAGTCTGCAGCCAAATGTGTTGAAAAGTCTGGTGCTATAACCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACANGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTATCTGAAGCCAAAGCTAAGAAAAAGAGAAGGACACTCAAGAAGAGGGAACACATGaaaaaaaaaGCTGAAGCAGTT
  3   1   2       bld Ga15      in                       XL417m22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAAAGNAAATANANTGGGCAATATCCCACTGAAAATGCCAGATCGAATTAGAAATAAACCTTTACAACTTGGCCTGGCCACGTCTGCAGCCAAATNTGTNNAAAAGTCTGGGGCTATNACCAGCAGCNCTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAACGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTG
  3   1   2       bld Ga18                             rxlk122e23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAANNGNNAAANNCCCACTGAAAATGCNAGATCGNATTAAAAATAANCCTTTACNNCTTGNCCTGGCCACNNCTGCANCCAAATGTGTTGAAAANTCTGGGGCTATNANCNAGCANNNCTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAAACCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGNAAAAATGATTCAAGCAACTCTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGNCTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGNNCCAGATGNNCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTnnnGAAGCAAAAGCAAGAAAAAAGAGAAGGACACTCAAGAAGATGGAACAAATGAAAAAAANNNNGNAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGNNNACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAAGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGNCCNTTTCAAGGTNGTAGANNG
  3   1   2       bld Ga15      in                       XL519i17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATNCCAGATCAAATTTAGAAATAANCCNNTACAACTTGGCCTGTCCACGTCTGCAGCCAAATGTNTTNAAAAGTCTGGGGCTATANCCAGCAGCACTGCAAAGGTGACAGAGTTTATGCAAAGATCTGAAGAANCCTCATCATCTAAAGTGTGCTCTAAAGATATTTCAGGGAAAAATGATTCAAGCANCTNTGATAGTGACAACAGCGAGGATGAGTTCATTGCCAAGACTATGGAAAGAAGTGCGGGAAAAAGGAAAGAGCAAGGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAATGATGAGGAACGCATCAGGATTGTTCAAGTTCCTGTTGATCGANCACTATGATGGAAGATCTATCGAAAGCGTC
  3   1   2       bld Ga18 5g3  in                      xlk124i13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATGAGTTCATTNCCANGNCTATGNAAAGNANTGCNGNAAAAAGGAAAGAGCAAGNAGAAGAAGATAAAGCAGNTTTGAAGTAGTTGCTATAGANCGTACAGTTAAACGNTCTCGTGTGGTGGGCCCAGATGNCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGNACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTAnnTGAAGCAAAAGCAAGAAAAAAGAGAAGGACACTCAAGAAGATGGAACAAATGAAAAAAAAANCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGNACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTANNNCNCTNCCTTTTTTTGGCCTGTACTATGTTTTGTNCNTCNTTT
  3   1   2       bld Ga15 5g3  in                       XL451g08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAAAGAAGTGCGGGGAAAAAGGAAAGNGCAAGGGGAAGAAGATAAAGCNGATTTTGAAGTAGTTGCTATAGAACGTNCNGTTAAACGATCTCGNGTGGTGGGCCCNGATGGCCTTGCTNTTGGAACNGTTATTGCTNCNTNTAAGNAATCNACCAGAGATNTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGNGGATGAACTCCCGGATTGGTTTGTGTCNGAAGAGAGGAAGCCCNGGATTGTTCNAGTTCCTGTTGATCGNCATATGATGGAAGACTATCGAAAGCGTCNACGNGAACTAAATGCTCGTCCCNTTAAAAAAGTAGCTGAAGCNAAAGCNAGAAAAAAGAGAAGGACCCTCNAGAAGATGGAACNAATGAAAAAAAAAGCTGAAGCNGTGGTTAACCCCNGTGATATATCCGAAAGAGAGAAAGCTGCNCAGCTTCGTAGTATATACNGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCNAGAAAAGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCNTTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTGG
  5   1   2       bld Ga15                               XL452e19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCTCCGAAAGAGCAAGGGAGAAGAAGATAAAGCAGATTTTGAAGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCNACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTaaaaaagtagctgaagcaaaagcaagaaaaaagagaaggacgctcaagaagatggaacaaatgaaaaaaaaaGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAATCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGaaaaaaaaaGTGAATTAATACAAGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATGTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCA
  3   1   2       bld Emb4                            IMAGE:4960264.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAAGAAAGATAAAGCAGATTTTGAGGTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATGGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGACACTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACG
  3   1   2       bld Sp1       in                    IMAGE:4965486.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTAGTTGCTATAGAACGTACAGTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGACACTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACG
  5   1   2      seed Ga15      in                       XL430o05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACAGTTATTGCTACATCTAAGAAATCAACAAGAGATCTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTaaaaaagtagctgaagcaaaagcaagaaaaaagagaaggacactcaagaagatggaacaaatgaaaaaaaaaGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGaaaaaaaaaaGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAANCAG
  3   1   2       bld Ga15      in                       XL430o05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTAAACGATNTCGTGTGGTGGGCCCNGATGGCCTTGCTNTTGGAACNGTTATTGCTACNTNTAAGAAATCNACNAGNGATTTAATTGATGGTTCCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCNCNGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGNGAACTAAATGCTCGTCCCNTTAAAAAAGTAGCTGAAGCNAAAGCNAGAAAAAAGNGAAGGACCCTCNAGAAGATGGAACNAATGAAAAAAAAAGCTGAAGCAGTGGTTAACCCCAGTGATATATCCGAAAGAGAGAAAGCTGCNCAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCNTTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCAT
  3   1   2       bld Ga15                               XL432d24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTAAACGATCTCGTGTGGTGGGCCCAGATGGCCTTGCTCTTGGAACNGTTATTGCTACATNTAAGAAATCNACNAGAGATTTAATTGATGGTTCCTTCAATNGNCGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCNGAAGAGAGGAAGCCCNGGATTGTTCAAGTTCCTGTTGATNGACATATGATGGAAGNCTATCGAAAGCGTCNACGAGAACTAAATGCTCGTCCCNTTAAAAAAGTAGNTGAAGCAAAAGCNAGAAAAAAGNGAAGGGCNCTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCNGTGGTTAACNCCNGTGATATATCCGAAAGAGAGAAAGCTGCNCAGCTTCGTAGTATATNCAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTNCTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCNTTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTT
  3   1   2       bld Ga12 5g3  in                         XL200j04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTGATGGTACCTTCAATAGACGTAATTTTAATGATGATGAGGATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCNCAGGATTGTTCAAGTTCCTGTTGATNGACATATGATGGAAGACTATNGAAAGNGTNAACGAGAACTAAATGCTNGTCCCATTAAAAAAGTAGnTGAAGCAAAAGCAAGAAAAAAGnGAAGGnCnCTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACNCCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTNGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTNGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTTGTGCATCTGGCTTAATAAAGAC
  5   1   2       bld Ga15      in                       XL460m07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTaaaaaagtagctgaagcaaaagcaagaaaaaagagaaggacactcaagaagatggaacaaatgaaaaaaaaaGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGaaaaaaaaaaGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATANCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTTGTGCATCTGGCTTANTAAAGACAGTATAAGCTCCNNAAANANAA
  3   1   2       bld Ga15      in                       XL460m07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGAACTCCCGGATTGGTTTGTGTCAGAAGAGAGGAAGCCCNGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGNGAACTAAATGCTCGTCCCNTTAAAAAAGTAGCTGAAGCNAAAGCNAGAAAAAAGNGAAGGACCCTCAAGAAGATGGAACNAATGAAAAAAAAAGCTGAAGCNGTGGTTAACCCCAGTGATATATCCGAAAGAGAGAAAGCTGCNCAGCTTCGTAGTATATACNGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCNAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCNTTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATT
  3   1   2       bld Neu7                                 XL002b14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAAGCACAGGATTGTTCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGNGTCAACGAGAACTAAATGCTNGTCCCATTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGACnCTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTTG
  3   1   2       bld Sp1       in                    IMAGE:4175265.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACAGGATTGTCCAAGTTCCTGTTGATCGACATATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGACACTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAA
  3   1   2       bld Tbd7 5g3  in                         XL090a05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACATATGATGGAAGACTATCGAAAGNGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGnCnCTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACNCCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTNGTAGTATATACAGAAAAGGTGTCCTTGGTAAANAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTGGCCTGTACTATGTTT
  3   1   2       bld Tbd7                                 XL059f10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGATGGAAGACTATCGAAAGCGTCAACGAGAACTAAATGCTNGTCCCATTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGACACTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTTGTGCAT
  3   1   2       bld DMZ       in                         xl224k11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCGAAAGCGTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGnCGCTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAGTGAATTAATACAAGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATGTACTGATGACTTTGTGATATCAANCAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTTGTGCATCTTTAGAATCATTTTATTGTCTCAACCTCCACAGCAATATTGCATTAATATTGTTGAATGCAGATATATCTGACTGCAGAAAATGTGGACTTAGGGAAAGTATTTNCTGGAATTCCAAAAACCAACAGCCCATAAAGTTCAGTGTTTTCAAAAATGGAATGTTCAAATTTGTGGCAAAATA
  3   1   2       bld DMZ       in                         xl303j09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGTCAACGAGAACTAAATGCTCGTCCCNTTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGACGCTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAGTGAATTAATACAAGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATGTACTGATGACTTTGTGATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTTGTGCATCTTTAGAATCATTTTATTGTCTCAACCTCCACAGCAATATTGCATTAATATTGTTGAATGCAGATATATCTGACTGCAGAAAATGTGGACTTAGGGAAAGTATTTACTGGAATTCCAAAAACCAACAGCCCATAAAGTTCAGTGTTTTCAAAAATGGAATGTTCAAATTTGTTGGCAAAATATTTT
  3   1   2       bld Neu7 5g3  in                         XL047f09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCAACGAGAACTAAATGCTCGTCCCATTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGACnCTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTTGTGCATCGGNCTTAATAAAGA
  3   1   2       bld Neu7 5g3  in                         XL013c19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAACGAGAACTAAATGCTNGTCCCATTAAAAAAGTAGCTnAAGCAAAAGCAAGAAAAAAGAGAAGGACnCTCAAGAAGATGGAACAAATnAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTTGTGCATNCGGNCTTAATAAAGAC
  3   1   2       bld Gas8      in                    IMAGE:3517618.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGGACTAAAAGGTTGGTCCCATTAAAAAGGTAGTGAAGGCAAAGCCAGGAAAAAAGAGAGGGCCCTTCAAGAAGATGGACCAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAGCGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTTGTGCATCTGGCTTAATAAAGACAGTATAAGCTCAAAAAAAAAAAAAAAA
  3   1   2       bld Neu7      in                         XL033h13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTAAATGCTCGTNCCATTAAAAAAGTAGCTGAAGCAAAAGCAAGAAAAAAGAGAAGGACACTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTTGTGCATCGGTCTTAATAAAG
  3   1   2       bld Emb3      out                   IMAGE:3400610.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTATATCCTCGTTCCATCCGAGAAGCAGCTGGAGCATGACCAACACCCAAGCGGAGGACCCTCAGGAAGATGGATCAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCGCAAAGAGAGAAAGCTGCGCAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTAAAAA
  3   1   2       bld Neu7                                 XL046o10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAATAGTTATTATGTCTTATTTCCATGTTATCCACATTCAAACTTNTATCTACAGACACTCAAGAAGATGGAACAAATGAAAAAAAAAGCTGAAGCAGTGGTTAACACCAGTGATATATCCGAAAGAGAGAAAGCTGCACAGCTTCGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTACTTATTTGGTGGCCAAGAAAGGAGTTGGGCGAAAGGTTCGTCGGCCAGCTGGAATTAAAGGCCATTTCAAGGTGGTAGATGGAAGAATGAAAAAGGACATGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTAAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTAC
  3   1   2       bld Ga15      in                       XL492g08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TNTCCGAAAGNGAGAAAGCTGCACANNTTNGTAGTATATACAGAAAAGGTGTCCTTGGTAAAGAGAAGCCTCAAGTTNCTTATTTGGTGGCCNAGAAAGGANTTGGGNGAAAGGTTNGTCNGCCAGCTNGAATTAAAGGCCNTTTCNAGGTGGTNGATGGAAGAATGAAAAAGGACAAGAGAAGTCAACGAAAAAAAAAAGTGAATTAATACAGGGATTGAATTAGTGCTTGCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTAACTGATGACTTNGTAATATCAAATCATGTATCAAGATANGCAGANGGCAAGGACATATA
  3   1   2       bld Ga15                               XL449d24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTTTACCCTTTTTGCTGTCTTATTTAATTGTTGAAAATTTACTGATGACTTTGTAATATCAAACAGTACAAGATAGCAGAGGCAAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTT
  5   1   2       bld Ga18      in                       xlk53o19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    tAATTGTTGAAAATGTACTGATGACTTTGTGATATCAAACAGTACAAGATAGCAGANNNAGGACATATAACTATAGCCCCTACCTTTTTTTGGCCTGTACTATGTTTTGTGCATCATTTTGTGCATCTTTAGAATCATTTTATTGTCTCAACCTCCACAGCAATATTGCATTAATATTGTTGAATGCAGATATATCTGACTGCAGAAAATGTGGACTTAGGGAAAGTATTTACTGGAATTCCAAAAACCAACAGCCCATAAAGTTCAGTGTTTTCAAAAATGGAATGTTCAAATTTGTTGGCAAAATATTTTTTTCTGTGTTTGTTAATATTCTTTCTATACACTATAAAACAAATGTACCCCANaaaaaaaaaa
  3   1   2       bld Ga18      in                       xlk53o19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTGATATCANNCAGNNCNAGATAGNAGAGGCAAGGACATATATCTATAGCCCCTNCCTTTTTTTGGCCTGNNNNNNGTTTTGTGCATCATTTTGTGCATCTTTAGAATCATTTTATTGTCTCAACCTCCACAGCAATATTGCATTAATATTGTTGAATGCAGATATATCTGACTGCAGAAAATGTGGACTTAGGGAAAGTATTTACTGGAATTCCAAAAACCAACAGCCCATAAAGTTCAGTGTTTTCAAAAATGGAATGTTCAAATTTGTTGGCAAAATATTNTNNCTGTGTTGTTAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)