Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xl338g07.5                           76 PI      92          3     2306                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012837721 Xl3.1-IMAGE:4930098.5.5 - 47 ESTs
                                                                       -210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:4930098.5.5                                                                                                                                                                                                                   TTTTTTCTTTTCAGCTGGTAGTGACCCAGCGACGGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCAAATCTCTGGTCTTAATGTGTTGAGGGTTATTAATGAGCCTACTGCTGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAGTTATTGCGGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATTCTGGAAATTCAGAAGGGTGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCATTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTCACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCATTACAGACTGACATCAATCTGCCATACCTTACTATGGACGCTTCTGGACCAAAACACTTAAATATGAAATTGACGCGTTCTCAGTTTGAGGGCATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCGAGCCAAAAAGCTATGCAAGATGCAGAAGTTGGCAAAAGTGACATCGGTGAAGTATTGCTAGTCGGTGGAATGACAAGAATGCCGAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCAGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGCGGTGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTAGATGTCACACCTTTGTCTCTTGGCATTGAAACCCTTGGAGGAGTCTTTACCAAATTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTCTTCTCTACTGCTGCTGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCAAGTGACAATAAACTTCTTGGCCAGTTTACATTGGTTGGAATGCCCCCTGCACCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATAGTTCATGTATCTGCAAAAGACAAAGGCACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGAATTTTTTTTTCTACAAATAATTAAAAAATATACTGCCCATCCCTGTGATATTTGTTCTTTTTTCCCCTTGGATCTTAATATATGAGTAAATCAGAAGCATTGTTACTTGGACTTCATTTTTCAAACTGTTCATTTACTTCTTTAACCTTATAAAGTTCTGGTAATTCCCTCTAAGTATTTCTCACATTTATACAATAATATGGACAGCTCCCGAGTGATTCTGCCTTGCTGTGCTGGGGTTTTGAGTTCATTTCCAGCTTGGACATTAGTTGAAAAGGAGTTTGTATGTTCTCTCATCGTCTGCAAGGGTTTCCTCCGGGTACTCCAAAAACAGACTCCTGATAAAATTGACAATAGAATGTGTGTAAATATGATAGGGACCTTAGATTGTAAGCTCCACTGGGGCAGGGCTGTTATGAATGATGTATAATCTCTGTGAAGCAATGCAGAAATGTGTTGGGACTATATAAATACCAGGAAA
                                                  Xl3.1-CHK-1012722735                                                                                                                                                                                                                         CTTTTCAGCTGGTAGTGACCCAGCGACGGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCAAATCTCTGGTCTTAATGTGTTGAGGGTTATTAATGAGCCTACTGCTGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAGTTATTGCGGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATTCTGGAAATTCAGAAGGGTGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCATTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTCACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCATTACAGACTGACATCAATCTGCCATACCTTACTATGGACGCTTCTGGACCAAAACACTTAAATATGAAATTGACGCGTTCTCAGTTTGAGGGCATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCGAGCCAAAAAGCTATGCAAGATGCAGAAGTTGGCAAAAGTGACATCGGTGAAGTATTGCTAGTCGGTGGAATGACAAGAATGCCGAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCAGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGCGGTGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTAGATGTCACACCTTTGTCTCTTGGCATTGAAACCCTTGGAGGAGTCTTTACCAAATTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTCTTCTCTACTGCTGCTGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCAAGTGACAATAAACTTCTTGGCCAGTTTACATTGGTTGGAATGCCCCCTGCACCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATAGTTCATGTATCTGCAAAAGACAAAGGCACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGAATTTTTTTTTCTACAAATAATTAAAAAATATACTGCCCATCCCTGTGATATTTGTTCTTTTTTCCCCTTGGATCTTAATATATGAGTAAATCAGAAGCATTGTTACTTGGACTTCATTTTTCAAACTGTTCATTTACTTCTTTAACCTTATAAAGTTCTGGTAATTCCCTCTAAGTATTTCTCACATTTATACAATAATATGGACAGCTCCCGAGTGATTCTGCCTTGCTGTGCTGGGGTTTTGAGTTCATTTCCAGCTTGGACATTAGTTGAAAAGGAGTTTGTATGTTCTCTCATCGTCTGCAAGGGTTTCCTCCGGGTACTCCAAAAACAGACTCCTGATAAAATTGACAATAGAATGTGTGTAAATATGATAGGGACCTTAGATTGTAAGCTCCACTGGGGCAGGGCTGTTATGAATGATGTATAATCTCTGTGAAGCAATGCAGAAATGTGTTGGGACTATATAAATACCAGGAAATAAAAT
                                                      consensus depths                                                                                                                                                                                                                        3     6     6     7     6     7    10    10    10    10    10    10    10    10    10    12    12    13    14    15    14    15    14    16    14    16    14    16    17    17    16    17    17    17    17    18    18    18    18    18    19    19    19    19    19    19    19    20    19    20    19    20    19    20    19    20    19    20    19    20    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    19    21    20    21    20    21    20    21    19    21    19    20    18    20    18    20    17    20    18    20    16    19    15    18    15    17    15    16    14    16    15    16    14    15    13    14    11    13     9    13     7    11     6    11     8    12     7    12     6    12     8    12     8    12     8    12     8    12     7    12     7    10     7     9     8     9     7     9     6     9     6     8     6     8     6     8     6     8     6     8     5     7     5     7     5     6     5     6     6     7     6     7     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     6     2     6     2     5     3     6     5     6     5     6     6     7     6     7     5     8     5     9     5     9     6     9     7    10     6    10     7    10     7    10     8    11     8    11     8    11     8    12     8    12    10    13    11    14    11    14    12    14    15    16    16    17    16    17    16    17    16    17    16    17    16    17    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    18    18    18    18    18    18    17    18    18    18    19    19    19    19    20    20    20    20    20    20    20    20    20    20    19    19    19    19    19    19    18    18    17    18    18    18    17    17    15    15    10    12     8    10     8    10     7     7     4     6     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2
  5   1   2      ests                            Xl3.1-IMAGE:4930098.5                                                                                                                                                                                                               TTTTTTTTTTCTTTTCAGCTGGTAGTGACCCAGCGACGGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCAAATCTCTGGTCTTAATGTGTTGAGGGTTATTAATGAGCCTACTGCTGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAGTTATTGCGGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATTCTGGAAATTCAGAAGGGTGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCATTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTCACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCATTACAGACTGACATCAATCTGCCATACCTTACTATGGACGCTTCTGGACCAAAACACTTAAATATGAAATTGACGCGTTCTCAGTTTGAGGGCATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCGAGCCAAAAAGCTATGCAAGATGCAGAAGTTGGCAAAAGTGACATCGGTGAAGTATTGCTAGTCGGTGGAATGACAAGAATGCCGAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCAGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGCGGTGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTAGATGTCACACCTTTGTCTCTTGGCATTGAAACCCTTGGAGGAGTCTTTACCAAATTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTCTTCTCTACTGCTGCTGATGGCCAAACACAGGTAGAAATTAAAGTT
  5   1   2      ests                              Xl3.1-xlk105c01ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCTACTGCTGCTGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCAAGTGACAATAAACTTCTTGGCCAGTTTACATTGGTTGGAATGCCCCCTGCACCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATAGTTCATGTATCTGCAAAAGACAAAGGCACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGAATTTTTTTTTCTACAAATAATTAAAAAATATACTGCCCATCCCTGTGATATTTGTTCTTTTTTCCCCTTGGATCTTAATATATGAGTAAATCAGAAGCATTGTTACTTGGACTTCATTTTTCAAACTGTTCATTTACTTCTTTAACCTTATAAAGTTCTGGTAATTCCCTCTAAGTATTTCTCACATTTATACAATAATATGGACAGCTCCCGAGTGATTCTGCCTTGCTGTGCTGGGGTTTTGAGTTCATTTCCAGCTTGGACATTAGTTGAAAAGGAGTTTGTATGTTCTCTCATCGTCTGCAAGGGTTTCCTCCGGGTACTCCAAAAACAGACTCCTGATAAAATTGACAATAGAATGTGTGTAAATATGATAGGGACCTTAGATTGTAAGCTCCACTGGGGCAGGGCTGTTATGAATGATGTATAATCTCTGTGAAGCAATGCAGAAATGTGTTGGGACTATATAAATACCAGGAAAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                               ----C-------
                                               BLH ATG      84     151                                                                                                                                                                                                                   
                                               BLH MIN      84     388                                                                                                                                                                                                                   
                                               BLH MPR      45     388                                                                                                                                                                                                                   
                                               BLH OVR      84     457                                                                                                                                                                                                                   
                                               CDS MIN      84     388                                                                                                                                                                                                                   
                                               ORF LNG      84     176                                                                                                                                                                                                                   
  5   1   2      ests                            Xl3.1-IMAGE:4930098.5                                                                                                                                                                                                               TTTTTTTTTTCTTTTCAGCTGGTAGTGACCCAGCGACGGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCAAATCTCTGGTCTTAATGTGTTGAGGGTTATTAATGAGCCTACTGCTGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAGTTATTGCGGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATTCTGGAAATTCAGAAGGGTGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCATTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTCACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCATTACAGACTGACATCAATCTGCCATACCTTACTATGGACGCTTCTGGACCAAAACACTTAAATATGAAATTGACGCGTTCTCAGTTTGAGGGCATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCGAGCCAAAAAGCTATGCAAGATGCAGAAGTTGGCAAAAGTGACATCGGTGAAGTATTGCTAGTCGGTGGAATGACAAGAATGCCGAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCAGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGCGGTGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTAGATGTCACACCTTTGTCTCTTGGCATTGAAACCCTTGGAGGAGTCTTTACCAAATTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTCTTCTCTACTGCTGCTGATGGCCAAACACAGGTAGAAATTAAAGTT
                                                  Xl3.1-CHK-1012688675                                                                                                                                                                                                                     TTTTCTTTTCAGCTGGTAGTGACCCAGCGACGGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCAAATCTCTGGTCTTAATGTGTTGAGGGTTATTAATGAGCCTACTGCTGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAGTTATTGCGGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATTCTGGAAATTCAGAAGGGTGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCATTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTCACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCATTACAGACTGACATCAATCTGCCATACCTTACTATGGACGCTTCTGGACCAAAACACTTAAATATGAAATTGACGCGTTCTCAGTTTGAGGGCATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCGAGCCAAAAAGCTATGCAAGATGCAGAAGTTGGCAAAAGTGACATCGGTGAAGTATTGCTAGTCGGTGGAATGACAAGAATGCCGAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCAGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGCGGTGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTAGATGTCACACCTTTGTCTCTTGGCATTGAAACCCTTGGAGGAGTCTTTACCAAATTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTCTTCTCTACTGCTGCTGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAA
  5   1   2       bld Tail 5g                         IMAGE:8544825.5p GCAGAGCCATCCAATGAATTCGTCCCACAGGTAAAATAACGTGGTATAGCCGTGCTCTTTAGCTGTTAGCCGTGAGGCTTTCCAAGCAGGCGTTTGTTTTATAGCACGGAGGAGGGGAAAATCTGTGAGGAAATCGGCCTTTTACCTTGCTTTTAACCTTTCTGTCACACCCACGTGGTTAAGAGGTTTCTAGAAGTGGTACGCttttttttttttcttttCAGCTGGTAGTGACCCAGCGACGGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACAGCTAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAA
  5   1   2       chi Thy                             IMAGE:8549915.5p                   GAGTGCAAACAGGTAAATAACGTGGTATAGCCGTGCTCTTTAGCTGTTAGCCGTGAGGCTTTCCAAGCAGGCGTTTGTTTTATAGCACGGAGGAGGGGAAAATCTGTGAGGAAATCGGCCTTTTACCTTGCTTTTAACCTTTCTGTCACACCCACGTGGTTAAGAGGTTTCTAGAAGTGGTACGCtttttttttttttCTTTTCAGCTGGTAGTGACCCAGCGACGGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGAAAACAAGCAAAGGTGCTTGAAATTCAGAAGGGCCAGAACACACCTTCAGTATAGCTTTTCATCGAGGGTGAACGTTAGTAGGATGCCACTAACNACAGGCGGCACTAACCTAACACACATCTATGTACAAGCGCTTATGGCGGCGTTTGAGANCTGAGTCAGAAGACCTAAATGTCCTTTCAATGTGAGCTCAATGTGAGCTGGTGATCCATGAACTCATCCNATCAATGTGATTGTTATAAATGAAAACACGAATATTGTCTCTGCAATGGTTCTGCTGTATCTATCACACGACAGACGGATCTGCTATGTAGTTAAGCAGCGCTCTGATATCACATTGTACTGGAANATT
  5   1   2       bld Tad1 5g                         IMAGE:6878719.5p                                                                                                                                GGGGAATAACGCCTGTAAGAAATCACTCAAGCTCCGTGACGTTTCTGCGGAACTTCCAAACATCAGCCCTTTCTATCCTAAGAGTAGTGCAAAACAGCTGGTAGTGACCCAGCGACGGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCCGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCCGAGTCAGATTGGTGCATTTTGTTTTAATAAAAATGGAAAGAGACAGCGGAAAAACTATTTGGGGTCATTTCTGCCAAAAAATGCTGTTATCACTGGTCCCCTGCATACTTTCAATGACTCACCACCGACAGGGCAACAAA
  5   1   2       bld Ov1  5g                         IMAGE:6316419.5p                                                                                                                                                                                                CCACGCGTCCGAGCACGGAGGAGGGGAAAATCTCTGGTAGTGACCCAGCGACGGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGGCAAATCTCTGGTCTTAATGTGTTGAGGGTTATTAATGAGCCTACTGCTGCTGCCCTTGCCTATGGACTAAAATAAATCTGAATGACAAAGTTATTGCGGGTCCAC
  5   1   2       bld Kid  5g                         IMAGE:7010505.5p                                                                                                                                                                                                  TGGTACGttttttttttttttttCTTTTCAGCTGGTAGTGACCCAGCGACGGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCCCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCAAATCTCTGNGTCTAATGTGNTTGAGGT
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959189.5p                                                                                                                                                                                                                AGAGTAGTGCAAAACAGCTGGTAGTGACCCAGCGACGGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGNGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTTATAAAAATGAAAGAGACAGCGGAA
  5   1   2       bld Tail 5g                         IMAGE:8544858.5p                                                                                                                                                                                                                        TNGGGAGTATCAAAAAAATTGTCCCGACGGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAAACAAGGATGCTGGGCAAATCTCTGGTCTTATGTGTTGAGGGNTATAATGAGCTACTGCTGCTGCCTTGCCTATGACTAATAATCTGATGACAATTTTGGGTCATGACTTGGGGAGACATTGAATCTCATCTGAATCTAAAGTGTTTGAGTAAATCAAATGAGACATC
  5   1   2       bld Lmb1 5g                         IMAGE:8533058.5p                                                                                                                                                                                                                                             CAGCGACGGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCCCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAAGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCGAATCTCTGGTCTTAATGTGTTGAGGGTTATAATGAGGCTACTGCTGCTGCCTTGCCTATGGACAAATAATCTGAGGACAAGTTTTGCGCCTATGACCTGGGGGAGGACATTTGAATTTCATTCTGGAATCTGAGGGG
  5   1   2       bld Emb4 5g                         IMAGE:5572721.5p                                                                                                                                                                                                                                                  ACGGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCCCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCAAATCTCTGGTCTTAATGGTGTTGAGGGGTTATTAAATGAGCCTACTGCTGGGCTGCCCTTGCCCTATGGACTANNGATAAATCTGATGACAAAAGTTTATTGGCGGTCTATTGAACCTTTGGGGGGAAGAAACATTTTGAATATCTCCCATTTCTGGGAAATTCCAAAAAggggggggTTTTTTTAAAGTTAAAAAAC
  5   1   2       bld Ga18 5g3  in                      xlk105c01ex.5p                                                                                                                                                                                                                                                  GACGTTCACAAGTTGTCATTGTGTGACTTGACTTTCAATCGCTCTCATCATGCTGTGTGCCGGCGGATCCCTAGCCTCTCCTCTCTCACATGTTTCACGGATATTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGANAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGNNAAATCTCTGGNCTTAATGTGTTGAGGGNNTTAATGAGCCTNCTGCTGCTGCCCTTNNCTATGGNCTAGATAAATCTGATGACAAAGTT
  5   1   2       bld Te2       in                    IMAGE:7207941.5p                                                                                                                                                                                                                                                                                            TACCCGGGAATTTCCGCGGGATGGATCCCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCAAATCTCTGGTCTTAATGTGTTGAGGGTTATTAATGAGCCTACTGCTGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAGTTATTGCGGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATTTCTGGAATTCAGAAGGNTGTTTTTGAAGTAAAATCACAAATGGAGACACATCCTTGGGANGTGAAGATTTTGATTCAGCATTGCTGCAGCATATTGTAAGCAATTCAAAAGAAAGTCTGGTGTGGACCTCACCAAGATAATATGGCACTTCCAAAAGTCCGAAAGCTTGCTAAAAAGGCAAAATGGTTAATGTCTTTCC
  5   1   2       bld Neu7      in                         XL047n13.5p                                                                                                                                                                                                                                                                                                     CTGTGTGCCGGCGGNTCCCTANCCTCTCCTCTCTCACATGTTTCACGGNTACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGNATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGGAAAACTATTTTGGGTCATTCTGCC
  5   1   2       bld Emb4                            IMAGE:4930098.5p                                                                                                                                                                                                                                                                                                                  GGATCCCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCAAATCTCTGGTCTTAATGTGTTGAGGGTTATTAATGAGCCTACTGCTGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAGTTATTGCGGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATTCTGNGAATTCAGAAGGGTGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCCTTGGAGGTGGAGGAATTTTGATCAAGGCATTGGCTGCCAGCATTATTGGTAAAAGCAGGTTCAAAAAGAAAAATCCTGGGTGTGGGAACCCTC
  5   1   2      seed Neu7      in                         XL003k09.5p                                                                                                                                                                                                                                                                                                                       GCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCAAATCTCTGGTCTTAATGTGTTGA
  5   1   2       bld Tbd7      in                         XL099b05.5p                                                                                                                                                                                                                                                                                                                       GCTAGCCTCTCCTCTCTCACATGTTTCACGGATACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAAC
  5   1   2       bld Tbd7      in                         XL072k04.5p                                                                                                                                                                                                                                                                                                                                            GTTTCACGGNTACTTCGCAAGGGTTGTTTTAATGGTCTAAGCCAAGNATGTTCTACAATCAGTATTTAAGCGGGACTATGCGTCTGAATCTGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAG
  5   1   2       bld Egg6      in                    IMAGE:4435435.5p                                                                                                                                                                                                                                                                                                                                                                                   AAGCCAACATGTTCTACTATCCGTATTTAAACGGCACTATGCGCCTGAATCTGATAAAGGTGCTGTTATTGGAATTGATCTATGAACAACAAATTCTTGTGATGCTGTAATGGAGGGAAAACAAGCAAAGGAGCTTGAAAATTCAGAAGGGGGCACAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGTGGTCACTAACCCTAGCAACACATTCTATGCTACAAAACGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGGTCTGACAGACACTAGACATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGCGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGCGCATTTGATTTAATAAAAATGATAGAGACAGCGGAAAACTATTTGGGTCATTCTGACAAACATGCTGATATCACTGTTCCTGCATACATCGATGACTCACAGCGACAG
  5   1   2       bld Emb4                            IMAGE:4680505.5p                                                                                                                                                                                                                                                                                                                                                                                                                             CACGCGTCCGGTTAAAGGTGCTGTTATTGGAATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTGTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCAAATCTCTGGGCTTAATGTGTTGAGGGTTATTAATGAGCCTACTGCTGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAGTTATTGCGGTCTATGACCTTGGGGGG
  5   1   2       bld Ooc2                            IMAGE:3746206.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCAAATCTCTGGTCTTAATGTGTTGANGGTTATTAATGAGCCTACTGCTGCTGCCCTTGCCTATGGACTNAGATAATCTGATGACANAGTTATTGCGGTCTATGACCTTTGGGGAGGAAACATTGATATCTCCATTCTGGAAAATCAGAGG
  5   1   2       bld DMZ       in                         xl251a03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGAAAACAAGCAAAGGTGCTTGAAAATTCAGAAGGGGCCAGAACAACACCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCAAATCTCTGGTCTTAATGTGTTGAGGGTTATTAATGAGCCTACTGCTGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAGTTATTGCGGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATTCTGGAAATTCAGAAGGGTGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCATTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTCA
  5   1   2       bld DMZ       in                         xl329l02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTTAGTAGGGATGCCAGCTAAACGACAGGCGGTCACTAACCCTAACAACACATTCTATGCTACAAAGCGCCTTATTGGCCGGCGTTTTGATGATGCTGAAGTTCAGAAAGACACTAAAAATGTTCCTTTCAAAATTGTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTCTATTCTCCGAGTCAGATTGGTGCATTTGTTTTAATAAAAATGAAAGAGACAGCGGAAAACTATTTGGGTCATTCTGCCAAAAATGCTGTTATCACTGTCCCTGCATACTTCAATGACTCACAGCGACAGGCAACAAAGGATGCTGGGCAAATCTCTGGTCTTAATGTGTTGAGGGTTATTAATGAGCCTACTGCTGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAGTTATTGCGGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATTCTGGAAATTCAGAAGGGTGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCATTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTCACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCATTACAGACTGACATCAATCTGCCATACCTTACTATGGACGCTTCTGGACCAAA
  5   1   2       bld Int2                            IMAGE:8530649.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGCTGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAGTTATTGCGGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATTCTGGAAATTCAGAAGGGTGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCATTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTCACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCATTACAGACTGACATCAATCTGCCATACCTTACTATGGACGCTTCTGGACCAAAACACTTAAATATGAAATTGACGCGTTCTCAGTTTGAGGGCATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCGAGCCAAAAAGCTATGCAAGATGCAGAAGTTGGCAAAAGTGACATCGGTGAAGTATTGCTAGTCGGTGGAATGACAAGAATGCCGAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCAGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGCGGTGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTAGATGTCACACCTTTGTCTCTTGGCATTGAAACCCTTGGAGGAGTCTTTACCAATTGATTGTAAAAAACACTACTATA
  5   1   2       bld Emb4      in                    IMAGE:4202792.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATAAATCTGATGACAAAGTTATTGCGGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATTCTGGAAATTCAGAAGGGTGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCATTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTCACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCATTACAGACTGACATCAATCTGCCATACCTTACTATGGACGCTTCTGGACCAAAACACTTAAATATGAAATTGACGCGTTCTCAGTTTGAGGGCATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCGAGCCAAAAAGCTATGCAAGATGCAGAAGTTGGCAAAAGTGACATCGGTGAAGTATTGCTAGTCGGTGGAATGACAAGAATGCCGAAGGTCCAGCAAACTGTGCAAGAT
  5   1   2       bld Eye1                            IMAGE:7020398.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGACCGGTCCGGAATTCCCGGGGATATTTGATATCTCCATTCTGGAAATTCAGAAGGGTGTTTTTGAATAAAATCCACAAATGGAGACACATTCCTTGTAGGTGAAGATTTTGATCAAGCATTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTCACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCATTACAGACTGACATCAATCTGCCATACCTTACTATGGACGCTTCTGGACCAAAACACTTAAATATGAAATTGACGCGTTCTCAGTTTGAGGGCATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCGAGCCAAAAAGCTATGCAAGATGCAGAAGTTGGCAAAAGTGACATCGGTGAAGTATTGCTAGTCGGTGGAATGACAAGAATGCCGAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCAGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGCGGTGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTAGATGTCACACCTTTGTCTCTTGGCATTGAAACCCTTGGAGGAGTCTTTACCAAATTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTCTTCTCTACTGCTGCTGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGGAGAGAGAGAAATGGCAAGTGACAATAAACTTCTTGGCCAGTTTACATTGGTTGGAATGCCCCCTGCACCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTTGACATTGATGCAAATGGGAATAGTTCATGTATCTGCAAAAGA
  5   1   2       bld Emb1                            IMAGE:6634532.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATTCTGGAAATTCAGAAGGGTGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCATTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTCACCAAAGATAATATGGCACTTCAGAGAGTCAGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCATTACAGACTGACATCAATCTGCCATACCTTACTATGGACGCTTCTGGACCAAAACACTTAAATATGAAATTGACGCGTTCTCAGTTTGAGGGCATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCGAGCCAAAAAGCTATGCAAGATGCAGAAGTTGGCAAAAGTGACATCGGTGAAGTATTGCTAGTCGGTGGAATGACAAGAATGCCGAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCAGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGCGGTGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTAGATGTCACACCTTTGTCTCTTGGCATTGAAACCCTTGGAGGAGTCTTTACCAATTTGATGGGAGAAACCAACTATACCCACAAAGAAAAGCCAGTCTTCTCTACTGCTGCTGATGCCAAACACAGGTAGAAAATAAAGTTCATCACAGGAGAGAGAGAAATGGCAAGGGACAATAAATTTCTTGGGCAGTTTACATTGGTTGGAAATGCCCCCTGCACCCTCGGGGAGGGGCTCCAAATTGAAATCCCTTTTGGACATTGGATGCCAAAGGGGAAATAGTTCCTTGGGATCCGGCCAAAAGAACCAAGGGA
  5   1   2       bld Lmb1      in                    IMAGE:8531675.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCATTACAGACTGACATCAATCTGCCATACCTTACTATGGACGCTTCTGGACCAAAACACTTAAATATGAAATTGACGCGTTCTCAGTTTGAGGGCATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCGAGCCAAAAAGCTATGCAAGATGCAGAAGTTGGCAAAAGTGACATCGGTGAAGTATTGCTAGTCGGTGGAATGACAAGAATGCCGAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCAGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGCGGTGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTAGATGTCACACCTTTGTCTCTTGGCATTGAAACCCTTGGAGGAGTCTTTACCAAATTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTCTTCTCTACTGCTGCTGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCAAGTGACAATAAACTTCTTGGCCAGTTTACATTGGTTGGAATGCCCCCTGCACCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATAGTTCATGTATCTGCAAAAGACAAGGCACAGGCCGTGAACACAAATTGTATTCAGTCTCTGGTGGATAAGCA
  5   1   2      ests                              Xl3.1-xlk105c01ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCTACTGCTGCTGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCAAGTGACAATAAACTTCTTGGCCAGTTTACATTGGTTGGAATGCCCCCTGCACCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATAGTTCATGTATCTGCAAAAGACAAAGGCACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGAATTTTTTTTTCTACAAATAATTAAAAAATATACTGCCCATCCCTGTGATATTTGTTCTTTTTTCCCCTTGGATCTTAATATATGAGTAAATCAGAAGCATTGTTACTTGGACTTCATTTTTCAAACTGTTCATTTACTTCTTTAACCTTATAAAGTTCTGGTAATTCCCTCTAAGTATTTCTCACATTTATACAATAATATGGACAGCTCCCGAGTGATTCTGCCTTGCTGTGCTGGGGTTTTGAGTTCATTTCCAGCTTGGACATTAGTTGAAAAGGAGTTTGTATGTTCTCTCATCGTCTGCAAGGGTTTCCTCCGGGTACTCCAAAAACAGACTCCTGATAAAATTGACAATAGAATGTGTGTAAATATGATAGGGACCTTAGATTGTAAGCTCCACTGGGGCAGGGCTGTTATGAATGATGTATAATCTCTGTGAAGCAATGCAGAAATGTGTTGGGACTATATAAATACCAGGAAAT
                                                  Xl3.1-CHK-1012689635                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTGCTGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCAAGTGACAATAAACTTCTTGGCCAGTTTACATTGGTTGGAATGCCCCCTGCACCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATAGTTCATGTATCTGCAAAAGACAAAGGCACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGAATTTTTTTTTCTACAAATAATTAAAAAATATACTGCCCATCCCTGTGATATTTGTTCTTTTTTCCCCTTGGATCTTAATATATGAGTAAATCAGAAGCATTGTTACTTGGACTTCATTTTTCAAACTGTTCATTTACTTCTTTAACCTTATAAAGTTCTGGTAATTCCCTCTAAGTATTTCTCACATTTATACAATAATATGGACAGCTCCCGAGTGATTCTGCCTTGCTGTGCTGGGGTTTTGAGTTCATTTCCAGCTTGGACATTAGTTGAAAAGGAGTTTGTATGTTCTCTCATCGTCTGCAAGGGTTTCCTCCGGGTACTCCAAAAACAGACTCCTGATAAAATTGACAATAGAATGTGTGTAAATATGATAGGGACCTTAGATTGTAAGCTCCACTGGGGCAGGGCTGTTATGAATGATGTATAATCTCTGTGAAGCAATGCAGAAATGTGTTGGGACTATATAAATACCAGGAAATAAAATA
  3   1   2       bld Lmb1      in                    IMAGE:8531675.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTCCTGCCCAAGGCTTGCAAATGCGAAGTGGCAAATTACTCGTGAGATGCTATCGTGATGCAAGAATGGAGTTCAGCACTGCAGATTGTTGACGGCCCAGCAGCAGTATCAATGAAGCAGTGCATGAGCTGCATCAGCGGTGGTTAGCAGAGGATGTACAGATGTCTGTTGTTAGATGTCACACTTGTCTTTTGGCATGAAACCCTGAGAGTCTTTACCAAATTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTCTCTCTACTGCTGCTGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCAAGTGACAATAAACTTCTTGGCCAGTTTACATTGGTTGGAATGCCCCGTGCACCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATAGTTCATGTATCTGCAAAAGACAAAGGCACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTG
  3   1   2       bld Ga18 5g3  in                      xlk105c01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ANNNTTTNCCAANTTGATTGGAAGAAACNNAACTANNNCNACAAAGAAAANCCAGGTCTTCTCTACTGCTGCTGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCAAGTGACAATAANCTTCTTGGCCAGTTTACATTGGTTGGAATNCCCCCTGCACCTCGTGGAGTNCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATAGTTCATGTATCTGCAAAAGACAAAGGCACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGA
  3   1   2       bld DMZ       in                         xl329l02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGGAAAGCCNGGTCTTCTCTACTGCTGCTGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCAAGTGACAATAAACTTCTTGGCCAGTTTACATTGGTTGGAATGCCCCCTGCACCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATAGTTCATGTATCTGCAAAAGACAAAGGCACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATGAATTTT
  3   1   2      seed DMZ       in                         xl251a03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCAAGTGACAATAAACTTCTTGGCCAGTTTACATTGGTTGGAATGCCCCCTGCACCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATAGTTCATGTATCTGCAAAAGACAAAGGCACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGT
  5  -1   2       bld Te2N                            IMAGE:7767126.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCATCAAGGAGAGAGAGAAATGGCAGTGACAATAAACTCTTGGCCCAGTTTACATTGGTNGGAATGCCCCCTGCACCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATAGTTCATGTATCTGCAAAAGACAAAGGCACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGAttttttttCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGAAtttttttttctacaaataattaaaaaatatactgcccaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Te2       in                    IMAGE:7207941.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGGAGAAAGCGCCCGGCCCAAAATCTTTTTGCCCCTTTTCATGGGGGGAAACCCCCCCCCCCTCGGGGGAGCCCCCAAAAAAAGGTCCTTTTACCATGAGGGCAAAGGAAAAATTCCATTTTTGCAAAAAACAAAGGCCACGGCCGGAAAAAACAAAATGTTTTTTCTTCTTTTGGTGGGATAAGCAAAGGTGACATTGAGAATTTGGGGAAGAAATGCAGAAAAGTATGCAGGGGAAAATTGGAGAAGAAAAGGAACAAAGTGAAACGGTTAACAATGCTGAAAGGTATTATCCACGACACAGAGTCAAAAATTGAGGAATTTAGGGATCAGTGGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGAATTTTATTCTACAACTCAACGACACATAC
  3   1   2       bld Tbd7      in                         XL072k04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGTTTACATTGGTTGGAATGCCCCCTGCACCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATAGTTCATGTATCTGCAAAAGACAAAGGCACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTGGATATNAATTTTTTTTTCTACAAANATTAAAA
  3   1   2       bld Ov1                             IMAGE:8328741.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGTCACTTTTGACATTGATGCAAATGGAATAGTTCATGTATCTGCAAAAGACAAAGGCACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGAATTTTTTTTTCTACAAATAATTAAAAAATATACTGCCAAAAAAAAAAAAAAAG
  3   1   2       bld Emb1      in                    IMAGE:3402302.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACGCGTCCCGCAAAAGCAAAGGCACAGGCCGTGAACACAATTTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGAATTTTTTTTTCTACAAATAATTAAAAAATA
  5   1   2       bld Emb1      in                    IMAGE:3402302.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGACAAAGGCACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGANATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGAttttttttCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTNTACTGTATNTTTGCAGTACTCTTCATCTTTTGTTGCTG
  3   1   2       bld Egg6                            IMAGE:4436034.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGGCACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGA
  3   1   2       bld Egg6      in                    IMAGE:4435435.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGAAT
  5   1   2       chi Spl                             IMAGE:8463472.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAATNNNNAAACGGATANNNGAAGCAGAATAAATAAAATTCGTCCCTGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGAttttttttCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGAAtttttttttCTACAAATAATTAAAAAATATACTGCCCATCCCTGTGATATTTGTTCTTTTTTCCCCTTGGATCTTAATATATGAGTAAATCAGAAGCATTGTTACTTGGACTTCATTTTTCAAACTGTTCATTTACTTCTTTAACCTTATAAAGTTCTGGTAATTCCCTCTAAGTATTTCTCACATTTATACAATAATATGGACA
  3   1   2       bld Neu7                                 XL007l05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTAATTTTTTTTTCTACAAATAATTAAAAAATATAC
  3   1   2       bld Neu7                                 XL021g19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTAAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCNT
  3   1   2       bld Emb4 5g3  in                    IMAGE:4959189.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGAATTTTTTTTTCTACAAATAATTAAAAAATATACTGCCC
  5   1   2       bld Emb4                            IMAGE:4680152.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAAGATCGGAGAAGAAAGGAACAAGTGGAAGCTGTAAACAATGCTGAAGGTATTATTCACGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGTTGCCAGCTGATGAGTGTAACAAGCTTAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCGCGTAAAGACGAAGAAACTGGGGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGAttttttttCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGT
  3   1   2       bld Tbd7      in                         XL099b05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGCTTCACTTAAATTATTTGAAAAGGCTTACAAAAAGATGGCNNCTGAAAGAAGCGGCTCTGAAAGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATGGCTCCTGATTTTTTTTCTTGAGAAATCATCATAGTCCTGAGCAAAAATAACCATAAATCT
  3   1   2       bld Neu7      in                         XL003k09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTGGACCACAAAAAGACGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGAATTTTTTTTTCTACAAATAATTAAAAAATATACTGCCCATCCCTGTGATATTTGTTCTTTTTTCCCCTTGGATCTTAATATATGAGTAAATCAGAAGCATTGTTACTTGGACTTCATTTTTCAAACTGTTCATTTACTTCTTTAACCTTATAAAGTTCTGGTAATTCCCTCTAAGTATTTCTCACATTTATACAATAATATGGACAGCTCCCGAGTGATTCTGCCTTGCTGTGCTGGGGTTTTGAGTTCATTTCCAGCTTGGACATTAGTTGAAAAGGAGTTTGTATGTTCTCTCATCGTCTGCAAGGGTTTCCTCCGGGTACTCCAAAAACAGACTCCTGATAAAATTGACAATAGAATGTGTGTAAATATGATAGGGACCTTAGATTGTAAGCTCCACTGGGGCAGGGCTGTTATGAATGATGTATAATCTCTGTGAAGCAATGCAGAAATGTGTTNGGACTATATAAATACCAGGAAATAAAATAAATAC
  3   1   2       bld Neu7      in                         XL047n13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGATCAGAAGGAAGAAAAGCAATAAGTATTCTGGTGTAAAATGCGCTTGGGAATAACTCCTGATTTTTTTTCTTGAGAATTCATCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTCATCTTTTGTTGCTGTTGTTTTAGTTGGATATTGAATTTTTTTTTCTACAAATAATTAAAAAATATACTGCCCATCCCTGTGATATTTGTTCTTTTTTCCCCTTGGATCTTAATATATGAGTAAATCAGAAGCATTGTTACTTGGACTTCATTTTTCAAACTGTTCATTTACTTCTTTAACCTTATAAAGTTCTGGTAATTCCCTCTAAGTATTTCTCACATTTATACAATAATATGGACAGCTCCCGAGTGATTCTGCCTTGCTGTGCTGGGGTTTTGAGTTCATTTCCAGCTTGGACATTAGTTGAAAAGGAGTTTGTATGTTCTCTCATCGTCTGCAAGGGTTTCCTCCGGGTACTCCAAAAACAGACTCCTGATAAAATTGACAATAGAATGTGTGTAAATATGATAGGGACCTTAGATTGTAAGCTCCACTGGGGCAGGGCTGTTATGAATGATGTATAATCTCTGTGAAGCAATGCAGAAATGTGTTGGGACTATAT
  3   1   2       bld Emb4      in                    IMAGE:4202792.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTACAAATAATTAAAAAATATACTGCCCATCCCTGTGATATTTGTTCTTTTTTCCCCTTGGATCTTAATATATGAGTAAATCAGAAGCATTGTTACTTGGACTTCATTTTTCAAACTGTTCATTTACTTCTTTAACCTTATAAAGTTCTGGTAATTCCCTCTAAGTATTTCTCACATTTATACAATAATATGGACAGCTCCCGAGTGATTCTGCCTTGCTGTGCTGGGGTTTTGAGTTCATTTCCAGCTTGGACATTAGTTGAAAAGGAGTTTGTATGTTCTCTCATCGTCTGCAAGGGTTTCCTCCGGGTACTCCAAAAACAGACTCCTGATAAAATTGACAATAGAATGTGTGTAAATATGATAGGGACCTTAGATTGTAAGCTCCACTGGGGCAGGGCTGTTATGAATGATGTATAATCTCTGTGAAGCAATGCAGAAATGTGTTGGGACTATATAAATACCAGGAAATAAAATAAATACAGTAATCTAATTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)