Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6636346.5.5                    47 END     1           1        2                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xlk74b15ex.3.5                       47 PI      77       1382     1760                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6954056.5.5                    28 PI      83       1521     1730                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:6944995.5                      15 PI      81       1523     1781                (no blast hit)
     5   0.0    0Xl3.1-XL066j12.3                           13 PI      74       1381     1730                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:8536126.5                       5 PI      79       1485     1730                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:3301644-IMAGp.5                 4 PI      83       1517     1727                (no blast hit)
     8   0.0    0Xl3.1-IMAGE:4032346-IMAGp.5                 4 PI      79       1442     1728                (no blast hit)
     9   0.0    0Xl3.1-IMAGE:8744026.5                       3 PI      80       1455     1723                (no blast hit)
    10   0.0    0Xl3.1-xlk69l12ex.3                          3 PI      79       1481     1717                (no blast hit)
    11   0.0    0Xl3.1-546_2D02.3                            3 PI      75       1453     1782                (no blast hit)
    12   0.0    0Xl3.1-XL075l02.5                            2 PI      86       1500     1692                (no blast hit)
    13   0.0    0Xl3.1-IMAGE:3401215-IMAGp.5                 2 PI      81       1500     1713                PREDICTED: hypothetical protein [Homo sapiens]
    14   0.0    0Xl3.1-XL516k03ex.3                          2 PI      79       1437     1730                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012837771 Xl3.1-xl250i12.3.5 - 61 ESTs
                                                                       ........-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xl250i12.3.5                                                                                                                                                                                   GTTGCGTACTATCCGGCAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAAGGAACAGTTACACCAACAGATGGAAGTGTTTTAAAGGAATGACGATGTGGTGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAGGCTCTGCTATAGTTTGTATAGACGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACGGGATACACAGCAGATAACAGACAAGCTCTGTGGTATACAATGGGATTCTTCAGAGCTTTTGTGTTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTATATGGACTATAGTGGTCTTTCTGAACACACCAGTTTTACCGGTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACATTATTCACAAATAAACTGTCTGTGTTAGACTATTAAAAAAAAAA
                                                  Xl3.1-CHK-1012722747                                                                                                                                                                                         TACTATCCGGCAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAAGGAACAGTTACACCAACAGATGGAAGTGTTTTAAAGGAATGACGATGTGGTGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAGGCTCTGCTATAGTTTGTATAGACGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACGGGATACACAGCAGATAACAGACAAGCTCTGTGGTATACAATGGGATTCTTCAGAGCTTxTxTGTTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTGTATGGACTATAGTGGTCTTTCTGAACACACCAGTTTTACCGGTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACATTATTCACAAATAAACTGTCTGTGTTAGACTATTAAAA
                                                      consensus depths                                                                                                                                                                                        2     5     9    10    12    13    13    14    13    14    13    14    13    14    13    14    13    14    12    14    13    14    13    14    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    14    15    14    15    14    15    14    15    15    15    15    15    15    15    15    15    16    16    16    16    16    17    15    17    16    17    16    18    16    18    16    19    17    19    16    19    18    20    18    20    18    20    18    20    18    21    17    20    17    20    17    20    16    19    16    19    16    19    15    19    16    22    15    22    15    22    16    22    18    23    16    23    16    20    15    19    14    20    12    20    12    19    13    18    13    19    12    18    14    18    13    16    13    15    13    15    13    15    13    15    13    15    14    16    14    16    15    17    15    16    15    16    15    16    15    17    15    17    15    16    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    16    15    16    14    16    13    16    13    16    14    17    14    17    15    19    15    19    15    19    15    19    15    19    16    20    14    21    14    21    14    20    14    20    13    20    14    20    13    21    11    22    15    22    14    23    14    25    15    25    15    24    15    24    15    24    14    25    10    24     8    24    15    23    16    23     9    23     9    22     5    22    15    21    14    21    15    22    15    21    15    22     9    22    13    23    18    23    18    22     4    22    16    22    18    22    19    22    16    22    14    22    10    23    19    23    16    23    15    23    12    23    20    23    19    23    20    23    23    25    23    25    23    24    22    24    22    24    23    25    23    25    23    25    23    25    23    25    23    25    23    24    22    24    23    24    23    24    23    24    22    23    22    23    22    23    21    23    18    22    11    20     8    18     7    13     5     9     4     6
  5   1   2       e50                                 Xl3.1-xl250i12.3                                                                                                                                                                                   GTTGCGTACTATCCGGCAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAGGGAACAGTTACACCAACAGATGGAAGTGTTTTAAAGGAATGACGATGTGGTGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAGGCTCTGCTATAGTTTGTATAGACGGGCTGCTGTGTATCTGTGGGGGGCAGTTTGCCCCATGGGAAAAAGTAGAAAAGGCACGGGATACTATAGTGGTCTTTCTGAACACGTGTGGTATACAAGTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAATCTTTTAATGTTTGCCCCATGGCTACACAG
  5   1   2       e50                            Xl3.1-IMAGE:8543083.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAAGGAACAGTTACACCAACAGATGGAAGTGTTTTAAAGGAATGACGGTGTGATGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAAACTCTGCTATAGTTTGTATGGACGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACAGGATACACAGCAGATAACAGACAAGCTCTGTGGTATACAATGGGATTCTTCAGAGCTTTTGTGTTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTATATGGACTATAGTGGTCTTTCTGAACACACCAGTTTTACCGGTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACATTATTCACAAATAAACTGTCTGTGTTAGACTATT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --G----A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------AA-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -A---A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------CA---
                                               BLH ATG      23     961                                                                                                                                                                                   
                                               BLH MIN      23     207                                                                                                                                                                                   
                                               BLH MPR       5     207                                                                                                                                                                                   
                                               BLH OVR      23     198                                                                                                                                                                                   
                                               ORF LNG      23      18                                                                                                                                                                                   
  5   1   2       e50                                 Xl3.1-xl250i12.3                                                                                                                                                                                   GTTGCGTACTATCCGGCAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAGGGAACAGTTACACCAACAGATGGAAGTGTTTTAAAGGAATGACGATGTGGTGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAGGCTCTGCTATAGTTTGTATAGACGGGCTGCTGTGTATCTGTGGGGGGCAGTTTGCCCCATGGGAAAAAGTAGAAAAGGCACGGGATACTATAGTGGTCTTTCTGAACACGTGTGGTATACAAGTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAATCTTTTAATGTTTGCCCCATGGCTACACAG
                                                  Xl3.1-CHK-1012687445                                                                                                                                                                                         TACTATCCGGCAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAGGGAACAGTTACACCAACAGATGGAAGTGTTTTAAAGGAATGACGATGTGGTGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAGGCTCTGCTATAGTTTGTATAGACGGGCTGCTGTGTATCTGTGGGGGGCAGxxxxxCCCATGGxxxxxxGTAGAAAAGGCAxxxxxxACTATAGTGGTCTTTCTGAACACGxxxGxTATACAAxxGxAxGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAATxxTTxAATGTTTGCCCCATGGCTACACAGCAGCTT
  5   1   2       chi Brn1                            IMAGE:7018473.5p GCTAGCGCAACCTATGAAAATCCCGCTGGCTAATTTTATTCTGCGCGTGCCGAATTTGACACAAAAGTTTCCAAGGACCTGTACGTGACAGCCCCACCTATGACGCGTGCGTAAACCTGTCCTTGCGTCTGTCTATATCCGAACCCCCTCTGCACATGCGCATTGTTCATGCTGTCAGGTTGCGTACTATCCGGCAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACGGAAGGAGAGTACAGCAGCTTTGGAAACATGAAAGTGTGTTCCGGGGGTAGTCGAGAGTCTCAAGGATCATTACCCGGAGTAAAATTCTCTCCCCCATTGGAAAAATAATGCGTTTTAAATTTGGCCCCGGGGAGGAAAGGGACCCCCAAAAAGAATCACAGCCTGG
  5   1   2       bld Lmb1 5g                         IMAGE:8533001.5p                                                                                                                                               ATAANNNNNCCAGCATNAGTGAAGAGGTCCTAATTAAATTCNTCCCNTCCGGCAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGGCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAGGCGAATATATGAAACTTGGGGATGGCTGTTCTTCATGCTGCAGGAATAGCTCAGGTACCCGATTCTCTTGAAGCTGATGTGACACACACATGCGCTGGGTCACCCCACATTGAGGATGGAGCTAACGTTGCAATGA
  5   1   2       chi Tad2                            IMAGE:6934324.5p                                                                                                                                                 GGGGCATTGTTCATGCTGTCAGGTTGCGTACTATCCGGCAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACATTCTTTCATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCCTTCCCATATATCACGAAAATAATCTACTTCGCACAAGTCTGGACCCTTTATGCCAATGTCATACACTGCCCGGAGTGTCCCCTGGGGTTTCATACCCCGCCCATAAGGGACCATTGATATTAATGAATTAGTGAGAGAAAAACCCCGGAAGGGAGAGTTACCAGCCACCTTGGGAAACCATGAAAAATTGTGTTCCGGGCGGTAATTCGAAAAAGTCTCCAAGAATTCATTTACCCCGGAAGTAAAAATTTCCCCTCCCCCCATTTGGCCaaaaaaaaaGCCCGCTTTTAAAAATTTA
  5   1   2       bld DMZ  5g3  in                         xl311n04.5p                                                                                                                                                                           ATCGAATTCGAATTCGGGCACGAGGAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAA
  5   1   2       bld Em10 5g                         IMAGE:7982264.5p                                                                                                                                                                                   GTTGCGTACTATCCGGCAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAATGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAAAATGCGTTTAATTTGGCCCGGGAGGAAGGACGCTAGAAGATCACAGCTGTTCACAAGGCGAATATATGAAACTTGGGGAATGGCTGTTCTTCAGTGCTGCAAGAAGTACCTTCGGTTACCCCATATCACCTTGAAGCTTGATTGT
  5   1   2       bld Ov1  5g                         IMAGE:6319245.5p                                                                                                                                                                                    TTGCGTACTATCCGGCAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGCATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAACGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCCGCTTGGAACATGAGAGTGCGCCCGGCGTATTCCAGAGTTTCCAGATCATTACCCCGAGTAAATTCTCTCCGCATTGCCCTAATATGCCCCTCTAAGCTGGCCCCGGGAGGCACGGATGTCAAGAAGATCACCAGCTTGTTTACCAGGCCGAATATCTATGAAACCTTGGAGGACGGGGTAGGTCCCTCCCATGGCTGCAAGGAACGCATCCTTCCGGGTAACTCCGTATATTCCCCTTTGCAAAAGCTTGGCCCGGTTTACGCCCCTCTACTATTGCCCCCTTGGTTGCTCCATACCTTCATAGCAGTCCTTGCCCACCGCCCCGGTGAAATTCCCTTACACTTGGTTTTGAGCAAA
  5   1   2       bld Ga15 5g3  in                       XL466b15ex.5p                                                                                                                                                                                    TTGCGTACTATCCGGCAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTTTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTG
  5   1   2       bld Te2N 5g3  in                    IMAGE:7201965.5p                                                                                                                                                                                       CGTACTATCCGGCAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTTGACACACA
  5   1   2       bld Kid  5g                         IMAGE:7008287.5p                                                                                                                                                                                           CTATCCGGCAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAGGGAGTAGCCTCANGGTACCCGATATCACCTTGAGAGCATGATTGTTGACACACACATGCAGCTGTGTCCACCCCCGCAGTTGACGTGATGTGATGCCAATCTGTATGGCAATATGTAACACGTATGCGCCGATTGTCGGGGGTCTGACTTGTCGGGGCAATATGCATGTCAGCATTTTGAACGCCACAGACCAGCAAGCTCGCAAAGAATCGCATCACGCAGCCTTGAAGTATATTG
  5   1   2      seed Ov1  5g3  in                    IMAGE:8328004.5p                                                                                                                                                                                               CCGGCAGGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAAC
  5   1   2       bld Emb9 5g                         IMAGE:7974333.5p                                                                                                                                                                                                     GGAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAAGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAAGAAGTAGCCTCAAGGTACCCCGATATCACCTTGTAGACATGATTGTGACAACCCACATTGCACCGTTTC
  5   1   2       bld Emb9 5g                         IMAGE:7977931.5p                                                                                                                                                                                                      GAGAATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTTACCC
  5   1   2       bld Ga18 5g                           xlk107g16ex.5p                                                                                                                                                                                                          ATGGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGNACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCTCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCNGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTNAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGNNNAGGACGCAAGAAGATCACAGCTGTNNACAAGGCGAATNNTNTGAAANTTGGGGANGGGCTGTTCCTTCANTGCTGCNAGGAAGTAGCNTCAGGGTACCCNGATATCNNNTTTGAGAGCATGATTGTTGA
  5   1   2       bld Ga12      in                         XL167d06.5p                                                                                                                                                                                                            GGCTTCTCGTACCTTAACTGCTGCTTACCGCTTGCTTCCCTCACCCGCACATCTTCGGCCAGGACTCAGACAGCCGCAGCAGGCACTGTCTGCTGTGTGGAAACAGAATAGAGATTATTCAATACCCCCGCCAGCCAAGTATGGAGGAAGGCACACAGTAACCATGATCCCCGGAGATGGTATCGGGCCTGAACTTATGCTGCACGTGAAGGAAGTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAA
  5   1   2       bld Emb4      in                    IMAGE:4202328.5p                                                                                                                                                                                                                                                                                                                                                                                                                                   GTATTTAGGCATTCCTGTGTGCCAGTAGATTTTGAAGTAGTAAATGTAAATTCGTCATCTGTGATGAAAACGACATTCAGAATGCCATTACAGCCATCCGTCGGAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCCGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGT
  5   1   2       bld Tbd7      in                         XL110h08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GNAACAGGGTCGCACTAAAAGGTAACATTGAGACAAACCACAACATGCTGCCTTCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAG
  5   1   2       bld Ooc3                            IMAGE:3472997.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTGAGACAAACCACAACATGCCGCCTAGCCCATATATCACGAAATAATCTACTTCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGG
  5   1   2       chi Int2                            IMAGE:8825386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGTAACGTTATAAggggggggggggggTTCTCTTTAATCGTCCCTGCCAATGTCATACACTGCCGGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGGATGCACACGGCAGACATCGGAGGTCAGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGACACACACTTGCAATGGAGCCACCATGCAGAGACGACGCATGCTTACTTGGTGTGAATCTAGGTGACTGCTATCTGTCCATGGTGTCCCACTGTCGTGAATTGTTCCGCTTGTGTTATGACACGATCAGTCGTGCTGTAAATGAACAGGTTACATACCCAACTGCAT
  5   1   2       bld Brn1      in                    IMAGE:6951046.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAACCGGGTTCCGGAATTCTCCGGGATCTGGCCGGAGTGTCCCNTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTTGTAAAAATGGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGGACACAACACTTGCAATGGGAAGCCCACAATGGCAGAAGAAACCACGCATGCTTTACTTTGGGGGTTGGAAATCTTAGGGTTGACTGCCTTATCTGTTTCCCATGGGGGCCCCCCTGGTTCGTGGATAAGTTCCGCCTTGTGTTATA
  5   1   2       bld Emb3      in                    IMAGE:3400683.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAGTGTCCCTGGGGTTCATACCCGCCATAAGGACATTGATATTATGATAGTGAGAGAGAACACAGAAGGAGAGTACAGCAGCTTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGACGATCACAGCTGTTGACACCGCGAATATTATGAAACTTGTGGATGGGCTGATCCTTCAGTGCTGAAGGGCCATA
  5   1   2       chi Tail                            IMAGE:8542270.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATNNNNCTCACGATTNGNGNAAAGATACCAAATAAATTCGTCCCTGAGAGTGTGTCCGGGGTAGTCGAGAGTCTCAAGATCATTACCCGAGTAAATTCTCTCCGCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCTTGGACACACACTTGCAATGGAAGCCACAATGCAGAAGNACGAGCATGCTTACTTGTGGGTGAATCTAGGGGACTGCTATCTGTCCCTGGTGTCCACTGTCTGAATGTCGCTTGTGAAGGACCACAATCATTCTGGTGTTAAGAC
  5   1   2       bld Lmb1                            IMAGE:8534059.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAAANNCCTCAGTATNAGNNGAAGGATACCAAATAAATTCGTCCCCAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTGGAATCTTANGGTGACTGCTTATCTGTTCCCATGGTGTCCACTGTTCGTGATATTCCGCTTGTGTAAGTGACACACAGATCTATTCCTGTGTTGTAAGGAACATTACCCAACGATAAATTGTTTGAAGATGAAAGTATGTCTGCATGGACACTGGGGTTGCTTGAGGTC
  5   1   2       bld Ga18      in                      xlk160f04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCCGCATTGNAGAATATGCGTTTAAGTTGGCCCGGGAGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGNCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAANNTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGNTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCNCTTGTGTATAGNGACACACAGATCTAGNNCCTGTGTTGTTAAAGGAACAGTTACACCAACAGATGGANGNNTTTTGGGGAATGACGGTGTGATGTGCTGCACTGGTACAGCTGGNGTGTTTNNTTCAGAAANTCTGCTATAGTTTGNGTGGNCGGNCT
  5   1   2       bld He1                             IMAGE:4408358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCATTGCAGAATATGCGTTTAAGTTGGCCCGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTAT
  5   1   2       bld Em10                            IMAGE:8321714.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTTCGGTCCGGATTCCGGGATGAGGAAGACGCAAGAAGATCACAGCTGTTCACAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCTCCTCTATTCGCAAAGCTATTTCTGGGCAGTATGAATGAACCCCGGATGCACACGGCAGACATCTGAGGTCAGGGTACCACTTCAAAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAATATGGGCAACTTTAGCATTCTGAGAAGATATCAGTCACAGCCTGAACCCAACACTTGCAATGGAAGCCACCATGGCAAAGAACCACCCATGCTTATTTTTGGTTGGATCATAAGGTGACTGTTTATCTATCCCAAGGAGTCCACTGTTCCTGATATTCCAC
  5   1   2       bld FaB       in                    IMAGE:8070256.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGGAGGAAGGACGCAAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGATACGACGCATGCTTACTTTGTGGTTGGAATCTTANGGTGACTGCTTTATCTGTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATTCTAGTTCCGG
  5   1   2       bld Te2N      in                    IMAGE:7764559.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGAAGATCACAGCTGTTCACAAGGCGAATATTATGAAACTTGGGGATGGGCTGTTCCTTCAGTGCTGCAAGGAAGTAGCCTCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTTCTGTGTTGTTAAGGGAACAGTACACCAACAGATGAAAGTGGTT
  5   1   2       bld Ooc1      in                     Ooc1-db23a02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      gggtcgacccacgcgtccgcccacgcgtccgCAGGGTACCCCGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACT
  5   1   2       bld Tad2                            IMAGE:6932242.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGGATATCACCTTTGAGAGCATGATTGTTGACAACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGGTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTTGTTAAAGGAACGTTTACACCCACCGATGAAAAGTGGTTTTGAAAGGAATGACGATGTGGGTGTGCTGCACTGGTACCAACTGGTGTGTTTTGCCTTCAAAAGGCTN
  5   1   2       bld Ooc1      in                     Ooc1-db23d06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGTCGACCCACGCGTCCGCAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAA
  5   1   2       bld Spl                             IMAGE:8461180.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTGACACACCACAATGCAGCTGGTGTCCAACCCCCAGCAGTTTGACGTGATGGTGATGCCTAATCTGTATGGCAATATTGTAAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAAGGAACAGTTACACCAACAGATGAGGGTGTTTTGAGGGAATGACGATGTGGTGTGCTGCACTGGTACAGCTGGTGTGTTGCTTCAGAACTCTACTGTGGTTGTATAGAGGGCTGCTGTGTGTCTGTGGGGGCAGCCATCAAGCTGAAAGTAGAAAGCACAGATGCCACGATACGACAGCTCTGTGTACATGGATCTCGGGCTTGGTGCGCTGGACTGGCTAAGTGCCAGCACACACTGT
  5   1   2       bld Tad2                            IMAGE:6876405.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAACAACGTATGCGCCGGATTGGTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAAGGAACAGTTACACCCACAGATGGAAATGTTTTAAAGGGAATGACGATGTGGGTGTGCTGCCCTGGTACAACTGGTGGTGTTTGCTTTCGGAAACTCTGCTATAGTTTGGGGTAAGGCGGGCTGCCTGTGGATCCTggggggggggcaagccaatttgaaagttgaaaaacaggaaaaaaaGGGCCCGGGGAACCGCCTCGCAGAAGAACCGACCCAACCCTCGCGAAAAGATATAGAACGGGGGAATGTCGTTCAAGAAAATGCTTGAAAGACTAGGCGCTCGCC
  5   1   2       chi Ooc3                            IMAGE:3437398.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCGGGGGTCCTGGACTTGTTCCGGGGGCAAATTATGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTATCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTGCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACGGATCTAGTTCCTGTGTTGGTAAAGGGACAGTTCCACCAACAGATGAGAGTGTGCTGTAGGAATGACGATATGATGTGCTGCACTGGGGCAACTGGTGTGACCGCTTACTATGCTCTAATGTAGTATGAATAGGCCGGCTAGCTGCTGGATATCGGGCGCATGCAACCAATTGCTCAACACTTCTACGGGCTGCGGAATCACGGCTGATGGCAACNCAGCTGTGTGTATCCTAG
  5   1   2       bld DMZ       in                         xl250i12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGCAATGTCTATGCAGTTTTTGAAACGGCCACAAGGAACACAGGCAAAAGCATCGCCAACAAGAACATCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTTTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAGGGAACAGTTACACCAACAGATGAAAGTGTTTTAAAGGAATGACGATGTGGTGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAGGCTCTGCTATAGTTTGTATAGACGGGCTGCTGTGTGTCTGTGCTTGAATGTTTGCCCCATGGCTGCGCAGCGGCTTGTTTGTATGGACTATAGTGGTCTTTCTGAACACGCCAGTTTTGCCGGTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGT
  5   1   2       chi Lmb1                            IMAGE:8534529.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTNTNNNTCCTGTTNNANTGAGAAGTACCTAAATAAATTCGTCCCCGCAAATCCCACCGCCATGCTCCTTGCAAGCTGCATGATGTTGGATCATCTCAAGTTGCACAGCTACGCCGCCTCTATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACGGCAGACATCGGAGGTCAGGGTACCACTTCAGAAGTGGTGCAGTCAATCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATGTGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAGGGAACAGTTACACCAACAGATGGAAGTGTTTTGGGGGAATGACAGTGTGGTGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCGGAGGCTCTGCTATAGTTTGTATAAGCGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCTAAGCTGAAAAAGTAGAAAAGGCACGGGATGCGCGGCGGATGGCAGACNAACTCTGTGGTATACAATGGGATTCTTCAGAGACTTTATGTTGTCTGCTGGGTGTCCTGTGCGTGAAAGTTTGCCCCATGGCTACACAGCGGCCTTGTTGTGTGGACTAGGTAGTCTTTCTAACGCACATTTTGGCCGGTGCGGCACGTTTATCGTCTTCTTTAAAACTTAGCCTTTGCGGTCTTAAAACCTTCCAAATATTGTGCGATAATGCCTGTCTTTG
  3   1   2       bld DMZ       in                         xl250i12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTGCAAGCAGATCATTGTAAAAAATGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTTTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAGGGAACAGTTACACCAACAGATGAAAGTGTTTTAAAGGAATGACGATGTGGTGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAGGCTCTGCTATAGTTTGTATAGACGGGCTGCTGTGTGTCTGTGCTTGAATGTTTGCCCCATGGCTGCGCAGCGGCTTGTTTGTATGGACTATAGTGGTCTTTCTGAACACGCCAGTTTTGCCGGTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTA
  5   1   2       bld Te2N      in                    IMAGE:7202445.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGACACAACACTTGCAATGGAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTTTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAAGGAACAGTTACACCAACAGATGGAAGTGTTTTAAGGGAATGACAATGTGATGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAGACTCTGCTGTAGTTTGTATAGGCGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACGGGATACACAGCAGATGACGGGCAAGCTCTGTGGTATACAATGGGATTCTTCGGGGCTTGTATGTTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTGTATGGACTATAGTAGTCTTTCTGAACACACCGGTTTTGCCAGTGCAGGGCACATTGTATCATTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTGAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAAACATGATGTGTCTTANGGAACATGCAGTGCTGGGTGAGCCCAAAGACACAGAGAATCTATAATATAAAGTATGTGTGTTAAAGGTTATATCAAATCTTGAGCTCAGATGCACTGATTGTAACAGTATGATTGCTTGGTTTCAAAACTACATAAAAAATCATTTATTCACCAATTAAACTTGTCTGGTGTTTGGACTTTTTTTaaaaaaaaaaaaa
  5   1   2       e50                            Xl3.1-IMAGE:8543083.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAAGGAACAGTTACACCAACAGATGGAAGTGTTTTAAAGGAATGACGGTGTGATGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAAACTCTGCTATAGTTTGTATGGACGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACAGGATACACAGCAGATAACAGACAAGCTCTGTGGTATACAATGGGATTCTTCAGAGCTTTTGTGTTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTATATGGACTATAGTGGTCTTTCTGAACACACCAGTTTTACCGGTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACATTATTCACAAATAAACTGTCTGTGTTAGACTATT
                                                  Xl3.1-CHK-1012688894                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAAGGAACAGTTACACCAACAGATGGAAGTGTTTTAAAGGAATGACGGTGTGATGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAAACTCTGCTATAGTTTGTATxGxCGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACGGGATACACAGCAGATAACAGACAAGCTCTGTGGTATACAATGGGATTCTTCAGAGCTTTTGTGTTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTGTATGGACTATAGTGGTCTTTCTGAACACACCAGTTTTACCGGTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACATTATTCACAAATAAACTGTCTGTGTTAGACTATTAAAAAA
  3   1   2       bld Tail                            IMAGE:8543083.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGAAGGTCCAGGTTACCACTTCAGAAAGTGTGGCAGTCCATCGCAGCAGATCAATGTAAAAAATGCGAGGCTGTTAGCAGTCTGAGAGGATATCAGTCACAGGCTGACACAAACACTGCAATGAAGCCACCAATGCAGAAGAAACCGACGCATGCTACTTTGTGGTGAATCTTAGGGTGACTGCTATCTGTTCCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAAGGAACAGTTACACCAACAGATGAAAGTGTTTTAAAGGAATGACGGTATGGTGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGGGGCTCTGCTATGGTTTATATAAACAGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACGGGATACACAGCAGATAACAGACAAGCTCTGTGGTATACAATGGGATTCTTCAGAGCTTGTATGTTGTCTGCTGTGTGTCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTATATAGACTATAGTAGTCTTTCTGAACACATCAGTTTTACCGGTGCAGGGCACGTTATATCGTTCTTCCTTTAGAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTCAAAACTACATAGAAA
  3   1   2       bld Brn1      in                    IMAGE:6951046.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGGCAGTCATTTGCAAAGCAGATCATGTAAAAAAAGGGCGAGCTGTAGCAGTCTGAGAGGATATCAGTCACAGCCTGGACACAACACTTGCAATGAAAGCCACCAATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAAGGAACAGTTACACCAACAGATGGAAGTGTTTTAAAGGAATGACGATGTGGTGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAGGCTCTGCTGTGGTTTGTATGAGCGGGCTGCTGTGTGTCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACAGGATACACGGCGGATAACAGACAAGCTCTGTGGTATACAATGGGATTCTTCAGAGCTTTTATGTTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTATATGGACTATAGTAGTCTTTCTGAACACACCGGTTTTACCAGTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGAGCTTGTTTTAA
  3   1   2       add Ga18      in                      xlk160f04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGCCTGGACANAANNCTTGCAATGGNAGCCNCCNATGCAGAAGAAACGACGCATGCTTACTTTGTGGTTGGAATCTTAGGGTGACTGCTTATCTGTTCCNATGNNGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAAGGAACAGTTACACCAACAGATGGAAGTGTTTTGGGGGAATGACGGTGTGATGTGCTGCACTGGTACAGCTGGTGTGTTTGCTTCAGAAACTCTGCTATAGTTTGTGTGGACGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACGGGATGCACAGCGGATGACAGACAAGCTCTGTGGTATACAATGGGATTCTTCAGAGCTTTTGTGTTGTCTGCTGTGTGTCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTGTGTAAACTATAGTGGTCTTTCTGAACACACCGGTTTTGCCGNTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTGAATACACTTCCAAGATTAGTTTGTGGCAGATACANNNTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGNNCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAANCTANATAGAAA
  3   1   2       bld Spl                             IMAGE:8463306.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAAGTAACTGCATCCTTTTCGCAGATCATACGCTGACCACATGCATGAGCACATGCGAGAAGAGCATGCTATTGTGTTGAATCTAGGGACGTTATCTGTCCCATGTGTCCATGTTCGTGTATGTCCGCTGTGTATAGTGACACACAGATCTAGTCCTGTGTTGTAAAGGAACAGTTACACCAACAGATGAAAGTGTTTTAAAGGAATGACAATATAATGTGCTGCACTAGTACAGCTGGTGTGTTTGCTTCAGAAACTCTACTATAGTTTATATAGACAGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACAGGATACACAGCAGATAACAGACAAGCTCTGTGGTATACAATGGGATTCTTCAGAGCTTTTATATTGTCTACTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTATTTATATAAACTATAGTGGTCTTTCTGAACACACCAGTTTTACCGGTGCAGGGCACATTGTATCATTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACATATCACAACTAACGCGTC
  3   1   2       bld DMZ  5g3  in                         xl311n04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTAGGGTGACTGCTTATCTGTTCCCATGGTGTCCCACTGTTCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAAGGAACAGTTACACCAACAGATGGAAGTGTTTTGAAGGAATGACGGTATGATGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAAACTCTGCTATAGTTTGTATAGGCGAGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACGGGATACACAGCAGATAACAGACAAGCTCTGTGGTATACAATGGGATTCTTCAGGACTTGTATATTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTGTATGGACTATGGTGGTCTTTCTGAACACACCAGTTTTACCGGTGCAGGGCACATTGTGTCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAGGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACCATAGAAATA
  3   1   2       bld Skin                            IMAGE:8641176.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGATTTTTTTTTTCCAAGGTCCCACCTTTTTTAAAATTTCCCNTTNNTAANGTGACCAACAATTTTAGTTTCTTGTTTTTAAGGGAACGTTTCACCAAAGATGAAAGTTTTTTAGGGGAATGCCATTTGATGTGCTGCACTTGTACAAACTGGTGGTTTGCTTCAGAGACTCTATTGTGGGTTATTTATAAAACAGGCTGTTGTGTATCTGTGGGGGGCCGCCTTTCAAAGCTGAAAAAGTAGAAAAGGCACAGGATACACAGCAGATAACAGACAAGCTCTGTAGTATACAATGGGATTCTTCAGAACTTTTATATTATCTACTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACGGCAGCTTGTTTATATAAGCTGTAGTGGTCTTTCTGAACACACCAGTTTTACCAGTGCAGGGCACATTGTATCATTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTCAAAACTACATGAAATCCTTTCCCAANANCCNNCCCCCCCCNNAAAAAA
  3   1   2       bld Ga12      in                         XL167d06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGTGATATGTCCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTTGTTAAAGGAACAGTTACACCAACAGATGGAAGTGTTTTGGGGGAGTGACGGTGTGATGTGCTGCACTGGTACAGCTGGTGTGTTTGCTTCAGAGGCTCTGCTGTAGTTTGTATGAGCGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACGGGATACACGGCGGATAACAGACAAGCTTCTGTGGTATACAATGGGATTCTTCAGAGCTTTTGTGTTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTGCGCGGCAGCTTGTTTATATGGACTATAGTGGTCTTTCTGAACACACCGGTTTTACCGGTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAGTCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACATTATCACAAA
  3   1   2       bld Te2N      in                    IMAGE:7202445.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGATATGTCCGCTTTTGTATAGTGACACACAGATCTAGTTCCTGTGTGTTAAAGGAACAGTTACACCAACAGATGGAAGTGTTTTAAGGGAATGACAATGTGATGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAGACTCTGCTGTAGTTTGTATAGGCGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACGGGATACACAGCAGATGACGGGCAAGCTCTGTGGTATACAATGGGATTCTTCGGGGCTTGTATGTTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTGTATGGACTATAGTAGTCTTTCTGAACACACCGGTTTTGCCAGTGCAGGGCACATTGTATCATTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTGAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTCAAAACTACATAGAAATACATATCACAAGTAACGTCGTAA
  3   1   2       bld Ga15 5g3  in                       XL466b15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGTCCGCTNGTGTATNGTGACACACAGATCTAGTTCCTGTGTTGTTAAGGGANCAGTTACACCAACAGATGGAAGTGTTTTGGAGGAATGACGGTGTGATGTGCTGCACTGGTACAACTGGTGTGTTTGCTTCAGAGGCTCTACTATGGTTTGTATGGACGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACAGGATACACAGCGGATAACAGACAAGCTCTGTGGTATACAATGGGATTCTTCGGGGCTTTTGTGTTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACGCAGCAGCTTGTTTATATGGACTGTAGTGGTCTTTCTGAACGCACCGGTTTTACCGGTGCAGGGCACATTGTGTCGTTCTTCCTTTAGAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACCATAGAAATACATATCACAA
  3   1   2       bld Te2N 5g3  in                    IMAGE:7201965.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGCTTGTGTATAGTGACACACAGATCTAGTTCCTGTGTGTTAAAGGAACAGTTACACCAACAGATGAAAGTTTTTAAAGGAATGACGGTATGGTGTGCTGCACTGGTACAGCTGGTGTGTTTGCTTCAGAAACTCTGCTATGGTTTGTATAAGCGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACGGGGTGCGCGGCGGATGACGGACAAGCTCTGTGGTATACAATGGGATTCTTCAGAGCTTGTGTGTTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCGGCTTGTTTATGTAGGCTATGGTGGTCTTTCTGAACACACCAGTTTTACCGGTGCAGGGCACATTGTGTCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTCAAAACTACATAGAAATACATATCACAAATAACTCTTG
  3   1   2       bld FaB       in                    IMAGE:8070256.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTCTATTAAGACCCATAGTTTCTCATTTCTCTCTCCGCTAGATCAGTTTCTCCACAAACTTGACATGTTTCATGGGGTTGAGAGCTGATGTTCTGCCCCGGCGAGCTGGTCTGGGTGCTTCACCAACTCCACTATCGTTTATATAAACAAGCTTCTGTGCATCTGTGGGGGGGCAGCCATTCAAAGCTGAAAAAGTCGAAAAGGCACAGGATACACAGCAGATAACAGACAAGCTCTGTAGTATACAATGGGATTCTTCAGAACTTTTATATTATCTACTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTATTTATATAAACTATAGTGGTCTTTCTGAACACACCAGTTTTACCAGTGCAGGGCACATTATATCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACTTTATTCCCCCCATCCACCCCCCCGGT
  5   1   2       bld Brn3                            IMAGE:8538924.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACAGATCTAGTTCCTGTGTTGTTAAAGGAACAGTTACACCAACAGATGAAAGTGTTTTAAAGGAATGACGATGTGGTGTGCTGCACTGGTGCAACTGGTGTGTTTGCTTCAGAGACTCTACTGTAGTTTATATGGACGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACAGGATACACAGCAGATAACAGACAAGCTCTGTGGTATACAATGGGATTCTTCAGAATTTTTATATTATCTACTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTATGTGGGCTATAGTGGTCTTTCTGAACACACCAGTTTTACCGGTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAACTACATAGAAATACATTATTCACAATAACTGTCTGTGTAGACTTTnnnnnnnanannannnnnannnnangncnnnnncnanatnnnacnnnaaaaaanaaaaannnnnannaannanaaaaagaaaaCACNGGT
  3   1   2       bld Te2N      in                    IMAGE:7764559.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGTTAAAGGAACAGTTACACCACCAGATGAAAGTGTTTTAAAGGAATGACAATATAATGTGCTGCACTGGTACAGCTGGTGTGTTTGCTTCAGAGACTCTGCTATAGTTTATATAAACGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACGGGATACACGGCAGATAACAGACAAGCTCTGTGGTATACAATGGGATTCTTCAGAGCTTGTATGTTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTATATGGACTATAGTGGTCTTTCTGAACACATCAGTTTTACCGGTGCAGGGCACATTATATCATTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACATTATTCACAAATAAACTGTCTGTGTTAGACTATTAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Ov1  5g3  in                    IMAGE:8328004.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGATGGAAGTGTTTTGAAGGAATGACGGTGTGATGTGCTGCACTGGTACAGCTGGTGTGTTTGCTTCAGAGGCTCTGCTATGGTTTGTATAGACGGGCTGCTGTGTATCTGTGGGGGGCAGCCATTCAAAGCTGAAAAAGTAGAAAAGGCACGGGATACACAGCAGATAACAGACGGGCTCTGTGGTATACAATGGGATTCTTCGGGGCTTGTGTGTTGTCTGCTGTGTGTCCTGTGCTTGAATGTTTGCCCCATGGCTGCACAGCAGCTTGTTTGTATGGACTATAGTGGTCTTTCTGAACGCATCAGTTTTACCGGTGCAGGGCACATTGTGTCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTGAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACATTATTCACAAATAAACTGTCTGTGTTAGACTATAAAAAAAAAAAAAAAAG
  3   1   0       add Ga12 5x3  out                        XL213g20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACGGGCTGCATTGTAGCCATGGGGGCAGCCATTCAAAGCTGAAAAAGGAGAAAAGGCACGGGATACACAGCTGATAAGATACGCTCTGTAGTATACAATGGGATTCTTCAGAACTTGTCTACTGTGTGTCCTGTGCTTGAATTGCTGCCCATGGCTGCACAGCAGCTTGTTTGTATAGACTATATTAGACTTTCTGATGCGGACACGCCAGTTTTGCAGGTGCAGGGCAGCAGCGCATTGTATCTCCATTGCTTCAAATCCCTTTCACTATTTGCTGTTACTGTTCCTTTAAATATTTCTCCAGCCTTGCAGTTTAAGCTGGTCACTTTTAAGCTGGTAACTGGTGGTTCTGCCAACTGCAACACACAGCTGAAGGCCTTTGCTGCTGTAGTCTGTTTAAAAGGTGGCCTGTGATTGGATAGTCCTTTGCCAAGCTGTGGGCCAGATCTCAGATACACACATTTAAGTATGCCCACAACAGTGTTAAACTGCAGGACAGTGGCAGTTTGGACAATAGGCTAAGATGCATTCGTGCTGTAGCCACCTTGAATCCTGCGGTTATAAATTTAGCCAGGTAAAAGGCTGCCAGAATCCAGCATGCAATGGGAATTTTTATAAAAAGGTATTTAAACACAAAGGATAATGCCAGGAACATCTGTAAAAGTGTTCCTATGTAAAACTGAAAATTGTAGTCACCAATTTGTCAAATCAATTT
  5   1   2       bld Gas3      in                      xlnga003e07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGATGCGCAGCGGATAACGGACAAGCTCTGTGGTATACAATGGGATTCTTCGGGGCTTGTGTGTTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTATATGGACTATAGTGGTCTTTCTGAACACACCGGTTTTGCCGGTGCAGGGCGCATTGTATCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTGAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCANAACTACATAGAAATACATTATTCACANATAAACTGTCTGTGTTAG
  3   1   2       bld Ooc1      in                     Ooc1-db23d06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAGATAACAGACAAGCTCTGTGGTATACAATGGGATTCTTCGGGACTTTTATGTTGTCTACTGTGTGTCCTGTGCTTGAATGTTTGCCCCATGGCTGCACAGCGGCTTGTTTGTATGGACTATGGTAGTCTTTCTGAGCACACCAGTTTTACCGGTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAGTCTTTTGCTGTTCCTTTGAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACATTATTCACAAATAAACTGTCTGTGTTAGACTATTAAAAAAAAAA
  3   1   2       bld Ooc1      in                     Ooc1-db23a02.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTTATGTTGTCTGCTGTGTATCCTGTGCTTGAATGTTTGCCCCATGGCTGCACAGCAGCTTGTTTGTATGGACTATGGTGGTCTTTCTGAACACACCAGTTTTGCCGGTGCAGGGCACATTGTATCGTTCTTCCTTTAAAACACTTTAGTCTTTTGCTGTTCCTTTGAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACATTATTCACAAATAAACTGTCTGTGTTAGACTAAAAAAAAAA
  3   1   2       bld Gas3      in                      xlnga003e07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGCTTGAATGTTTGCCCCATGGCTACACAGCAGCTTGTTTATATGGACTATAGTGGTCTTTCTGAACACACCGGTTTTGCCGGTGCAGGGCGCATTGTATCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGGTCCCTTTGAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACATTATTCACAAATAAACTGTCTGTGTTAGAAA
  3   1   2       bld Emb4      in                    IMAGE:4202328.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGCTTATTTATATAGACTATGGTGGTCTTTCTGAACACACCAGTTTTACCGGTGCAGGGCACATTGTGTCGTTCTTCCTTTAAGACACTTTAATCTTTTGCTGTTCCTTTAAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAANAACTACATAGAAATACATTATTCACAAATAAACTGTCTGTGTTAGACTATTAAAAAAAAA
  3   1   2       bld Emb3      in                    IMAGE:3400683.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATAAACTATGGTGGTCTTTCTGAACACACCAGTTTTACCGGTGCAGGGCACATTGTGTCGTTCTTCCTTTAAAACACTTTAATCTTTTGCTGTTCCTTTGAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAANACTACATAGAAATACATTATTCACAAATAAACTGTCTGTGTTAGACTATAAAAA
  5   1   2       bld Ga15      in                       XL482f08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTCCTTTGAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACATTATTCACAAATAAACTGTCTGTGTTAGACTATTaaaaaaaaaa
  3   1   2      seed Ga15      in                       XL482f08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCCTTTGAATACACTTCCAAGATTAGTTTGTGGCAGATACAATGCTCTGCTTCTTAATGTGTGATTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATAGGTTATATCAAATCTTGAGCTCAGATGCACTGATGTTACAGTATGATGCTTGTTTTCAAAACTACATAGAAATACAT
  3   1   2       bld Tbd7      in                         XL110h08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ANTGTACCTCGCCAACAATGCATGTGTCCCCATGTGGGGCAGACTGGGAACAATGATGTGTCCTAGGGAACATGCAGTGCTGGTGAAGCCCAAAGACACAGAGAATCTATAATATAAGTTATGTGTGTTATA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)