Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xl3.1-XL200p22.3.5                         26 END     1           1        3                hypothetical protein LOC100036658 [Xenopus tropicalis]
     2   2.0    0Xl3.1-xl235f18.5                            9 END     5           9       55                hypothetical protein LOC734294 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xlk117h07ex.5                         4 PI      95       2998     3210                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012837792 Xl3.1-xl231b13.3.5 - 51 ESTs
                                                                       .......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xl231b13.3.5                                                                                                                                                                                                                                                                                                                              TTTTTTACAAGGTTGGCAAGTTTTATGAACTTTATCACATGGATGCTGTCATTGGGGTGAATGAGCTGGGCCTGACATTCATGAAAGGAACGTGGGCTCATTCTGGCTTTCCCGAGATTGCTTTTGGTCGCTTTTCTGATGTTCTCGTACAGAAAGGCTACAAAGTATCCAGAGTGGAACAAACGGAAACACCAGAGATGATGGAAGCCCGGTGCAAGTCAATGTCGCATCCAAGTAAATTTGACAGGGTTGTAAGAAGAGAAATATGCAGGATCATTACTAAAGGGACACAGACCTACAGTGTGTTGGATGGTAATCCATCTGAAAGCCATAGTAAGTATCTTCTGTGCTTCAAAGAAAAAATGGACGATTCCTCTGGTCAAAGGAGAGTATACGGCGTCTCTTTTGTGGACACCTCCGTAGGGAAGTTTCACGTCGGTCAGTTTGAGGATGACCGCCATTGTTCACGCTTTAGAACTTTGGTGGCCCATTTCCCTCCAGTTCAGATCTTGTTCGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGCCTTTCGACCTCTATCCAAGAAAGCTTGCAGCCTACATCTCAGTTTTGGGATGCCTCCAGAACACTAAAAACATTAGCTGAAGAAGCTTACTTTGAAAAAGACTTTCAGCCTGCCGCTGGCAATGGTAACCTGCCGTCTGTTTTGAAAAGCATGACTTCAGAAAGTGACTCCTTAGCACTTACTCCCGGTGAAAAGTGCGAATTGGCTCTTTCGGCACTTGGAGCCTGTATATATTACCTGAAAAAATGTCTTATCGACCAAGAGCTGCTCTCCATGGCAAACTTTGAAGAATATGTTCCTGTGGATACTGATGTAGAAAAAGCCCAGACTTCAAGTAATTTCTTTGCCAAGACAAGTCGGCGCATGGTTCTTGACGGAGTGACTCTTACGAATCTGGAAATCCTCCAGAATGGAACAAACGGTTCTACAGAAGGGACGCTGTTGGAAAAACTAGACACCTGCTCTACCCCTTTTGGCAAGCGTCTCTTAAAACAGTGGCTCTGCGCACCCCTTTGTAATCCATTCTCCATTAATGATCGTTTAAATGCAGTGGAAGATCTCATGGCCCTTCCTGGGAAAGTGTCTGAGGTTAGCGAGCTCTTAAAGAAACTGCCCGATCTCGAGAGGCTGCTGAGCAAGATTCACAGTATTGGTTCTCCACTTAAAAGCCAGAACCATCCAGATAGCCGGGCTGTCATGTATGAGGAGATCACTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTACCCTGGAGGGGTTCAAAGTCATGAGAGAAGTGATCAGTATTATGGAAGATGATGTTGCTCATTTTAAGTCAAGTATTCTCAAACAGATTGTTTGTGTTAAAGATAAAGCTTCTCATGGGCGCTTCCCCGATTTATCGGCCGAGCTGAAGAGATGGGATACGTCCTTTGATCACGAGAAAGCCCGCAAGACCGGTGTGATCACTCCAAAAGCGGGTTTCGATCCGGATTACGACGAAGCGTTGAAAGATGTCAAACAAGCCGAGCAAGATCTTAACGAGTATTTGGACAAACAACGCAAACGACTCGGCTGTAAAACCGTCGTCTATTGGGGGACGGCCAAGAACCGATATCAAATGGAAATTCCCGAGAACATCGCTGACCGCAATCTGCCTGAAGAGTACACGCTAAAATCCACCAAAAAAGGGTTCAAGCGCTACTGGACCAAGGCAATTGAAAAGATGTTTGGAGACCTGGTGAACGCAGAGGAACGTAGGGATGCCGCGCTTAAGGACTGCATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAGGAATGGCAGACTGCTGTGGAATGCTTTGCCGTGTTAGATGTTCTGATAAGTTTATCTCAGTACAGTCAAGGAGGGGACGGGCCGGTGTGCAGACCAGAGATAGTGCTACAGGAAAATGGGTCGCCGTTTTTGGAGCTGAAAGGTTCACGACACCCCTGCATCACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTTGTTGGCTGCAAGGAGGAGGATTCTGATGACGGCAGTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCGGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCATCTAATAAACTTTATTTTTTAAAAATGAATTAGGAAGTACTTTTTTCCTTCTTCCCAACCCTAATTTGAATATGTAATTTTTTGTTTGTTTAAATTCATACCTAGCCGCTACATAATGGTTATTGAATACTCCACAATATATTAAGTCTTCCCCATCCCTAATTTCAATATTTAAATTAGGGGTGGGAAGGGAAATCACATGACCATCACAAAACTAGGAAGTAAAAATTTACTCCCTTTTTTTTTCTTTCCTGTGCCTAATTTGAATATGTAAATTAGGGTGGGAAGGGAAATCACATGACCATCATAAAACAAGGGAGTAAACAATTTCCTTTTCTTTCCTGTGCCTAATTTCCATATGCAAACTAAGATTCATCACTCATACTTTTTTTTTCTTCCCCAGCCCTAATTTGAATATGTAAATTAGGGAAGGGAAATCACATGACCATCACAAAACAAAGCAATAAACAATTTGTCCCCATCCCTAATTTCAATATGTAAATTAGGGCAGGAAGGGAAATCACACGACTTCTTCACAAAACAAGGAAGTAAAAATGTGTCCTTCCCTGTCCCTAATTCGC
                                                  Xl3.1-CHK-1012721387                                                                                                                                                                                                                                                                                                                                    ACAAGGTTGGCAAGTTTTATGAACTTTATCACATGGATGCTGTCATTGGGGTGAATGAGCTGGGCCTGACATTCATGAAAGGAACGTGGGCTCATTCTGGCTTTCCCGAGATTGCTTTTGGTCGCTTTTCTGATGTTCTCGTACAGAAAGGCTACAAAGTATCCAGAGTGGAACAAACGGAAACACCAGAGATGATGGAAGCCCGGTGCAAGTCAATGTCGCATCCAAGTAAATTTGACAGGGTTGTAAGAAGAGAAATATGCAGGATCATTACTAAAGGGACACAGACCTACAGTGTGTTGGATGGTAATCCATCTGAAAGCCATAGTAAGTATCTTCTGTGCTTCAAAGAAAAAATGGACGATTCCTCTGGTCAAAGGAGAGTATACGGCGTCTCTTTTGTGGACACCTCCGTAGGGAAGTTTCACGTCGGTCAGTTTGAGGATGACCGCCATTGTTCACGCTTTAGAACTTTGGTGGCCCATTTCCCTCCAGTTCAGATCTTGTTCGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGCCTTTCGACCTCTATCCAAGAAAGCTTGCAGCCTACATCTCAGTTTTGGGATGCCTCCAGAACACTAAAAACATTAGCTGAAGAAGCTTACTTTGAAAAAGACTTTCAGCCTGCCGCTGGCAATGGTAACCTGCCGTCTGTTTTGAAAAGCATGACTTCAGAAAGTGACTCCTTAGCACTTACTCCCGGTGAAAAGTGCGAATTGGCTCTTTCGGCACTTGGAGCCTGTATATATTACCTGAAAAAATGTCTTATCGACCAAGAGCTGCTCTCCATGGCAAACTTTGAAGAATATGTTCCTGTGGATACTGATGTAGAAAAAGCCCAGACTTCAAGTAATTTCTTTGCCAAGACAAGTCGGCGCATGGTTCTTGACGGAGTGACTCTTACGAATCTGGAAATCCTCCAGAATGGAACAAACGGTTCTACAGAAGGGACGCTGTTGGAAAAACTAGACACCTGCTCTACCCCTTTTGGCAAGCGTCTCTTAAAACAGTGGCTCTGCGCACCCCTTTGTAATCCATTCTCCATTAATGATCGTTTAAATGCAGTGGAAGATCTCATGGCCCTTCCTGGGAAAGTGTCTGAGGTTAGCGAGCTCTTAAAGAAACTGCCCGATCTCGAGAGGCTGCTGAGCAAGATTCACAGTATTGGTTCTCCACTTAAAAGCCAGAACCATCCAGATAGCCGGGCTGTCATGTATGAGGAGATCACTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTACCCTGGAGGGGTTCAAAGTCATGAGAGAAGTGATCAGTATTATGGAAGATGATGTTGCTCATTTTAAGTCAAGTATTCTCAAACAGATTGTTTGTGTTAAAGATAAAGCTTCTCATGGGCGCTTCCCCGATTTATCGGCCGAGCTGAAGAGATGGGATACGTCCTTTGATCACGAGAAAGCCCGCAAGACCGGTGTGATCACTCCAAAAGCGGGTTTCGATCCGGATTACGACGAAGCGTTGAAAGATGTCAAACAAGCCGAGCAAGATCTTAACGAGTATTTGGACAAACAACGCAAACGACTCGGCTGTAAAACCGTCGTCTATTGGGGGACGGCCAAGAACCGATATCAAATGGAAATTCCCGAGAACATCGCTGACCGCAATCTGCCTGAAGAGTACACGCTAAAATCCACCAAAAAAGGGTTCAAGCGCTACTGGACCAAGGCAATTGAAAAGATGTTTGGAGACCTGGTGAACGCAGAGGAACGTAGGGATGCCGCGCTTAAGGACTGCATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAGGAATGGCAGACTGCTGTGGAATGCTTTGCCGTGTTAGATGTTCTGATAAGTTTATCTCAGTACAGTCAAGGAGGGGACGGGCCGGTGTGCAGACCAGAGATAGTGCTACAGGAAAATGGGTCGCCGTTTTTGGAGCTGAAAGGTTCACGACACCCCTGCATCACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTTGTTGGCTGCAAGGAGGAGGATTCTGATGACGGCAGTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCGGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCATCTAATAAACTTTATTTTTTAAAAATGAxxxxxxxAGTACTTTTTTCCTTCTTCCCAACCCTAATTTGAATxTxTxxTTTTTTGTTTGTTTAAATTCATACCTAGCCGCTACATAATGGTTATTGAATACTCCACAATATATTAAGTCTxxxxxxTCCCTAATTTCAATATTTAAATTAGGGGTGGGAAGGGAAATCACATGACCATCACAAAACTAGGAAGTAAAAATTTACTCCCTTTTTTTTTCTTTCCTGTGCCTAATTTGAATATGTAAATTAGGGTGGGAAGGGAAATCACATGACCATCATAAAACAAGGGAGTAAACAATTTCCTTTTCTTTCCTGTGCCTAATTTCCATATGCAAACTAAGATTCATCACTCATACTTTTTTTTTCTTCCCCAGCCCTAATTTGAATATGTAAATTAGGGAAGGGAAATCACATGACCATCACAAAACAAAGCAATAAACAATTTGTCCCCATCCCTAATTTCAATATGTAAATTAGGGCAGGAAGGGAAATCACACGACTTCTTCACAAAACAAGGAAGTAAAAATGTGTCCTTCCCTGTCCCTAATTCGCATATGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                   3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     5     6     6     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     6     5     6     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     6     4     5     4     5     4     5     4     5     4     5     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     7     5     7     5     8     7     8     7     8     7     8     7     8     6     8     7     8     7     8     8    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     8    10     8    10     8     9     8     9     8     9     8     9     8     9     5     6     8     8     7     8     7     8     7     8     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     8     8     9     8     9     8     9     9    10     9    10     9    11     9    11     5    10     7    10     7    10     7     8     7     8     6     9     6     9     6     9     6     9     7     9     7    10     8    13     9    15    10    17    12    18    12    19    16    19    15    18    15    18    14    18    14    19    14    19    15    20    15    20    15    19    15    19    15    19    14    18    16    18    15    17    15    17    15    17    15    17    16    18    16    19    17    19    17    19    16    19    15    19    16    19    17    19    17    19    17    19    19    21    18    21    19    21    18    21    19    21    20    21    18    21    18    21    17    20    17    20    16    21    16    21    16    20    17    20    16    20    16    20    15    20    15    19    15    18    15    18    18    21    18    21    18    21    19    20    18    20    18    19    16    18    15    17    15    17     9    11     6     7     5     6     4     4     3     4     2     3     2     3     2     3     2     3     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     4     2     4     2     4     2     3     2     4     2     4     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     4     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2      4-98                                 Xl3.1-xl231b13.3                                                                                                                                                                                                                                                                                                                              TTTTTTACAAGGTTGGCAAGTTTTATGAACTTTATCACATGGATGCTGTCATTGGGGTGAATGAGCTGGGCCTGACATTCATGAAAGGAACGTGGGCTCATTCTGGCTTTCCCGAGATTGCTTTTGGTCGCTTTTCTGATGTTCTCGTACAGAAAGGCTACAAAGTATCCAGAGTGGAACAAACGGAAACACCAGAGATGATGGAAGCCCGGTGCAAGTCAATGTCGCATCCAAGTAAATTTGACAGGGTTGTAAGAAGAGAAATATGCAGGATCATTACTAAAGGGACACAGACCTACAGTGTGTTGGATGGTAATCCATCTGAAAGCCATAGTAAGTATCTTCTGTGCTTCAAAGAAAAAATGGACGATTCCTCTGGTCAAAGGAGAGTATACGGCGTCTCTTTTGTGGACACCTCCGTAGGGAAGTTTCACGTCGGTCAGTTTGAGGATGACCGCCATTGTTCACGCTTTAGAACTTTGGTGGCCCATTTCCCTCCAGTTCAGATCTTGTTCGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGCCTTTCGACCTCTATCCAAGAAAGCTTGCAGCCTACATCTCAGTTTTGGGATGCCTCCAGAACACTAAAAACATTAGCTGAAGAAGCTTACTTTGAAAAAGACTTTCAGCCTGCCGCTGGCAATGGTAACCTGCCGTCTGTTTTGAAAAGCATGACTTCAGAAAGTGACTCCTTAGCACTTACTCCCGGTGAAAAGTGCGAATTGGCTCTTTCGGCACTTGGAGCCTGTATATATTACCTGAAAAAATGTCTTATCGACCAAGAGCTGCTCTCCATGGCAAACTTTGAAGAATATGTTCCTGTGGATACTGATGTAGAAAAAGCCCAGACTTCAAGTAATTTCTTTGCCAAGACAAGTCGGCGCATGGTTCTTGACGGAGTGACTCTTACGAATCTGGAAATCCTCCAGAATGGAACAAACGGTTCTACAGAAGGGACGCTGTTGGAAAAACTAGACACCTGCTCTACCCCTTTTGGCAAGCGTCTCTTAAAACAGTGGCTCTGCGCACCCCTTTGTAATCCATTCTCCATTAATGATCGTTTAAATGCAGTGGAAGATCTCATGGCCCTTCCTGGGAAAGTGTCTGAGGTTAGCGAGCTCTTAAAGAAACTGCCCGATCTCGAGAGGCTGCTGAGCAAGATTCACAGTATTGGTTCTCCACTTAAAAGCCAGAACCATCCAGATAGCCGGGCTGTCATGTATGAGGAGATCACTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTACCCTGGAGGGGTTCAAAGTCATGAGAGAAGTGATCAGTATTATGGAAGATGATGTTGCTCATTTTAAGTCAAGTATTCTCAAACAGATTGTTTGTGTTAAAGATAAAGCTTCTCATGGGCGCTTCCCCGATTTATCGGCCGAGCTGAAGAGATGGGATACGTCCTTTGATCACGAGAAAGCCCGCAAGACCGGTGTGATCACTCCAAAAGCGGGTTTCGATCCGGATTACGACGAAGCGTTGAAAGATGTCAAACAAGCCGAGCAAGATCTTAACGAGTATTTGGACAAACAACGCAAACGACTCGGCTGTAAAACCGTCGTCTATTGGGGGACGGCCAAGAACCGATATCAAATGGAAATTCCCGAGAACATCGCTGACCGCAATCTGCCTGAAGAGTACACGCTAAAATCCACCAAAAAAGGGTTCAAGCGCTACTGGACCAAGGCAATTGAAAAGATGTTTGGAGACCTGGTGAACGCAGAGGAACGTAGGGATGCCGCGCTTAAGGACTGCATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAGGAATGGCAGACTGCTGTGGAATGCTTTGCCGTGTTAGATGTTCTGATAAGTTTATCTCAGTACAGTCAAGGAGGGGACGGGCCGGTGTGCAGACCAGAGATAGTGCTACAGGAAAATGGGTCGCCGTTTTTGGAGCTGAAAGGTTCACGACACCCCTGCATCACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTTGTTGGCTGCAAGGAGGAGGATTCTGATGACGGCAGTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCGGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCATCTAATAAACTTTATTTTTTAAAAATGAA
  5  -1   2      4-98                                Xl3.1-xlk4p04ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACCACTTAGGAAGTACTTTTTTCCTTCTTCCCAACCCTAATTTGAATATGTAAATTAGGGGTGGGAAGGGAAATCACATGACCATCACAAAACTAGGAATTAAACAATTTGTCCCCACTTTTTCTTCCCCATCCCTAATTTCAATATTTAAATTAGGGGTGGGAAGGGAAATCACATGACCATCACAAAACTAGGAAGTAAAAATTTACTCCCTTTTTTTTTCTTTCCTGTGCCTAATTTGAATATGTAAATTAGGGTGGGAAGGGAAATCACATGACCATCATAAAACAAGGGAGTAAACAATTTCCTTTTCTTTCCTGTGCCTAATTTCCATATGCAAACTAAGATTCATCACTCATACTTTTTTTTTCTTCCCCAGCCCTAATTTGAATATGTAAATTAGGGAAGGGAAATCACATGACCATCACAAAACAAAGCAATAAACAATTTGTCCCCATCCCTAATTTCAATATGTAAATTAGGGCAGGAAGGGAAATCACACGACTTCTTCACAAAACAAGGAAGTAAAAATGTGTCCTTCCCTGTCCCTAATTCGCATATGTAAATTAGGGGTGGAATGGGAAATCACATGACCATCACAAAACAAGGAAGTAAAAAAATTTGTCCCCACTTTTTCCTTCCCCATCCCTAATTTACATCTGCAAACTAGGACTCTGTTCGGTATTTGGCTAAATCTTTCATGAAGGATCCGGCTGATTAGTGGATTGGGTGCACCCCTACATGATGATGGAAGGCTTGAGCCAATCACTGCTCTGTCTGATCATGGTGTGAGTTTGGCCCCGACATTCAGATGAATAATGGGGGGTCGGGGCGAATGTAACTGTTGTGGCAGATGATGGTGGGACTTTGTTGAATGTTCTTTGTCTAATTGTCTTCTCCTGGCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCATCTAATAAACTTTATTTTTTAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----G-------
  5   1   2      4-98                                 Xl3.1-xl231b13.3                                                                                                                                                                                                                                                                                                                              TTTTTTACAAGGTTGGCAAGTTTTATGAACTTTATCACATGGATGCTGTCATTGGGGTGAATGAGCTGGGCCTGACATTCATGAAAGGAACGTGGGCTCATTCTGGCTTTCCCGAGATTGCTTTTGGTCGCTTTTCTGATGTTCTCGTACAGAAAGGCTACAAAGTATCCAGAGTGGAACAAACGGAAACACCAGAGATGATGGAAGCCCGGTGCAAGTCAATGTCGCATCCAAGTAAATTTGACAGGGTTGTAAGAAGAGAAATATGCAGGATCATTACTAAAGGGACACAGACCTACAGTGTGTTGGATGGTAATCCATCTGAAAGCCATAGTAAGTATCTTCTGTGCTTCAAAGAAAAAATGGACGATTCCTCTGGTCAAAGGAGAGTATACGGCGTCTCTTTTGTGGACACCTCCGTAGGGAAGTTTCACGTCGGTCAGTTTGAGGATGACCGCCATTGTTCACGCTTTAGAACTTTGGTGGCCCATTTCCCTCCAGTTCAGATCTTGTTCGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGCCTTTCGACCTCTATCCAAGAAAGCTTGCAGCCTACATCTCAGTTTTGGGATGCCTCCAGAACACTAAAAACATTAGCTGAAGAAGCTTACTTTGAAAAAGACTTTCAGCCTGCCGCTGGCAATGGTAACCTGCCGTCTGTTTTGAAAAGCATGACTTCAGAAAGTGACTCCTTAGCACTTACTCCCGGTGAAAAGTGCGAATTGGCTCTTTCGGCACTTGGAGCCTGTATATATTACCTGAAAAAATGTCTTATCGACCAAGAGCTGCTCTCCATGGCAAACTTTGAAGAATATGTTCCTGTGGATACTGATGTAGAAAAAGCCCAGACTTCAAGTAATTTCTTTGCCAAGACAAGTCGGCGCATGGTTCTTGACGGAGTGACTCTTACGAATCTGGAAATCCTCCAGAATGGAACAAACGGTTCTACAGAAGGGACGCTGTTGGAAAAACTAGACACCTGCTCTACCCCTTTTGGCAAGCGTCTCTTAAAACAGTGGCTCTGCGCACCCCTTTGTAATCCATTCTCCATTAATGATCGTTTAAATGCAGTGGAAGATCTCATGGCCCTTCCTGGGAAAGTGTCTGAGGTTAGCGAGCTCTTAAAGAAACTGCCCGATCTCGAGAGGCTGCTGAGCAAGATTCACAGTATTGGTTCTCCACTTAAAAGCCAGAACCATCCAGATAGCCGGGCTGTCATGTATGAGGAGATCACTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTACCCTGGAGGGGTTCAAAGTCATGAGAGAAGTGATCAGTATTATGGAAGATGATGTTGCTCATTTTAAGTCAAGTATTCTCAAACAGATTGTTTGTGTTAAAGATAAAGCTTCTCATGGGCGCTTCCCCGATTTATCGGCCGAGCTGAAGAGATGGGATACGTCCTTTGATCACGAGAAAGCCCGCAAGACCGGTGTGATCACTCCAAAAGCGGGTTTCGATCCGGATTACGACGAAGCGTTGAAAGATGTCAAACAAGCCGAGCAAGATCTTAACGAGTATTTGGACAAACAACGCAAACGACTCGGCTGTAAAACCGTCGTCTATTGGGGGACGGCCAAGAACCGATATCAAATGGAAATTCCCGAGAACATCGCTGACCGCAATCTGCCTGAAGAGTACACGCTAAAATCCACCAAAAAAGGGTTCAAGCGCTACTGGACCAAGGCAATTGAAAAGATGTTTGGAGACCTGGTGAACGCAGAGGAACGTAGGGATGCCGCGCTTAAGGACTGCATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAGGAATGGCAGACTGCTGTGGAATGCTTTGCCGTGTTAGATGTTCTGATAAGTTTATCTCAGTACAGTCAAGGAGGGGACGGGCCGGTGTGCAGACCAGAGATAGTGCTACAGGAAAATGGGTCGCCGTTTTTGGAGCTGAAAGGTTCACGACACCCCTGCATCACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTTGTTGGCTGCAAGGAGGAGGATTCTGATGACGGCAGTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCGGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCATCTAATAAACTTTATTTTTTAAAAATGAA
                                                  Xl3.1-CHK-1012686818                                                                                                                                                                                                                                                                                                                                    ACAAGGTTGGCAAGTTTTATGAACTTTATCACATGGATGCTGTCATTGGGGTGAATGAGCTGGGCCTGACATTCATGAAAGGAACGTGGGCTCATTCTGGCTTTCCCGAGATTGCTTTTGGTCGCTTTTCTGATGTTCTCGTACAGAAAGGCTACAAAGTATCCAGAGTGGAACAAACGGAAACACCAGAGATGATGGAAGCCCGGTGCAAGTCAATGTCGCATCCAAGTAAATTTGACAGGGTTGTAAGAAGAGAAATATGCAGGATCATTACTAAAGGGACACAGACCTACAGTGTGTTGGATGGTAATCCATCTGAAAGCCATAGTAAGTATCTTCTGTGCTTCAAAGAAAAAATGGACGATTCCTCTGGTCAAAGGAGAGTATACGGCGTCTCTTTTGTGGACACCTCCGTAGGGAAGTTTCACGTCGGTCAGTTTGAGGATGACCGCCATTGTTCACGCTTTAGAACTTTGGTGGCCCATTTCCCTCCAGTTCAGATCTTGTTCGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGCCTTTCGACCTCTATCCAAGAAAGCTTGCAGCCTACATCTCAGTTTTGGGATGCCTCCAGAACACTAAAAACATTAGCTGAAGAAGCTTACTTTGAAAAAGACTTTCAGCCTGCCGCTGGCAATGGTAACCTGCCGTCTGTTTTGAAAAGCATGACTTCAGAAAGTGACTCCTTAGCACTTACTCCCGGTGAAAAGTGCGAATTGGCTCTTTCGGCACTTGGAGCCTGTATATATTACCTGAAAAAATGTCTTATCGACCAAGAGCTGCTCTCCATGGCAAACTTTGAAGAATATGTTCCTGTGGATACTGATGTAGAAAAAGCCCAGACTTCAAGTAATTTCTTTGCCAAGACAAGTCGGCGCATGGTTCTTGACGGAGTGACTCTTACGAATCTGGAAATCCTCCAGAATGGAACAAACGGTTCTACAGAAGGGACGCTGTTGGAAAAACTAGACACCTGCTCTACCCCTTTTGGCAAGCGTCTCTTAAAACAGTGGCTCTGCGCACCCCTTTGTAATCCATTCTCCATTAATGATCGTTTAAATGCAGTGGAAGATCTCATGGCCCTTCCTGGGAAAGTGTCTGAGGTTAGCGAGCTCTTAAAGAAACTGCCCGATCTCGAGAGGCTGCTGAGCAAGATTCACAGTATTGGTTCTCCACTTAAAAGCCAGAACCATCCAGATAGCCGGGCTGTCATGTATGAGGAGATCACTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTACCCTGGAGGGGTTCAAAGTCATGAGAGAAGTGATCAGTATTATGGAAGATGATGTTGCTCATTTTAAGTCAAGTATTCTCAAACAGATTGTTTGTGTTAAAGATAAAGCTTCTCATGGGCGCTTCCCCGATTTATCGGCCGAGCTGAAGAGATGGGATACGTCCTTTGATCACGAGAAAGCCCGCAAGACCGGTGTGATCACTCCAAAAGCGGGTTTCGATCCGGATTACGACGAAGCGTTGAAAGATGTCAAACAAGCCGAGCAAGATCTTAACGAGTATTTGGACAAACAACGCAAACGACTCGGCTGTAAAACCGTCGTCTATTGGGGGACGGCCAAGAACCGATATCAAATGGAAATTCCCGAGAACATCGCTGACCGCAATCTGCCTGAAGAGTACACGCTAAAATCCACCAAAAAAGGGTTCAAGCGCTACTGGACCAAGGCAATTGAAAAGATGTTTGGAGACCTGGTGAACGCAGAGGAACGTAGGGATGCCGCGCTTAAGGACTGCATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAGGAATGGCAGACTGCTGTGGAATGCTTTGCCGTGTTAGATGTTCTGATAAGTTTATCTCAGTACAGTCAAGGAGGGGACGGGCCGGTGTGCAGACCAGAGATAGTGCTACAGGAAAATGGGTCGCCGTTTTTGGAGCTGAAAGGTTCACGACACCCCTGCATCACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTTGTTGGCTGCAAGGAGGAGGATTCTGATGACGGCAGTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCGGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCATCTAATAAACTTTATTTTTTAAA
  5   1   2       bld Oo1                             IMAGE:5084838.5p CGCGGATGAACAATCTGAAACCCCCAAGAGAACAAGCAATGTGTCTACAGAGGCCAAGTTAAAGTTATCCTCCTTCTCTGCCCCTGAGTCATTTGAATCACAGGCAAACACTGGTGGGACTGGCGCGTTTTCTATATGGGAACATGAGAAGTTTGATTGGCTGCAAGATGGGAAAAGAAAGGATATGAAACGTAAAAGGCAGACTGATGCTGATTACGACCCAAGCACCTTGTACATTCCAGATGATTTCCTTAATAAATGTACTCCAGGCGTGAGAAAATGGTGGCAGCTCAAATCTCAGAACTTTGATACGGTTATTTTTTACAAGGTTGGCAAGTTTTATGAACTTTATCACATGGATGCTGTCATTGGGGTGAATGAGCTGGGCCTGACATTCATGAAAGGAACGTGGGCTCATTCTGGCTTTCCCGAGATTGCTTTTGGTCGCTTTTCTGATGTTCTCGTACAGAAAGGCTACAAAGTATCCAGAGTGGAACAAACGGAAACACCAGAGATGATGGAAGCCCGGTGCAAGTCAATGTCGCATCCAAGTAAATTTGACAGGGTTGTAAGAAGAGAAATATGCAGGATCATTACTAAAGGGACACAGACCTACAGTGTGTTGGATGGTAATCCATCTGANAGCCATAGTAAGTATCTTCTGTGCTTCAAAGAAAAAATGGACGATTCCTCTGGTCAAAGGAGAGTATACGGCGTCTCTTTTGTGGACACCTCCGTAGGGAAGTTTCACGTCGGTCAGTTTGAGGATGACCGCCATTGTTCACGCCTTAGAACTTTGGTGGGCCATTTTCCTCCCGTTCAGATCCTGGTCCGAGAAGGCAACCCTTCCTTCAGATACAAGGAAAGGTTTTGAAGAGCTGGCCTTTCCGACCTCTATCCCAAAAAAGC
  5   1   2       bld DMZ       in                         xl292n19.5p                                                                                                                                                                                                                                                                                                                              TTTTTTACAAGGTTGGCAAGTTTTATGAACTTTATCACATGGATGCTGTCATTGGGGTGAATGAGCTGGGCCTGACATTCATGAAAGGAACGTGGGCTCATTCTGGCTTTCCCGAGATTGCTTTTGGTCGCTTTTCTGATGTTCTCGTACAGAAAGGCTACAAAGTATCCNGAGTGGAACAAACGGAAACACCAGAGATGATGGAAGCCCGGTGCAAGTCAATGTCGCATCCAAGTAAATTTGACAGGGTTGTAAGAAGAGAAATATGCAGGATCATTACTAAAGGGACACAGACCTACAGTGTGTTGGATGGTAATCCATCTGAAAGCCATAGTAAGTATCTTCTGTGCTTCAAAGAAAAAATGGAAGATTCCTCTGGTCAAAGGAGAGTATACGGCGTCTCTTTTGTGGACACCTCCGTANGGAAGTTTCACGTCGGTCAGTTTGAGGATGACCGCCATTGTTCACGCTTTAGAACTTTGGTGGCCCATTTCCCTCCAGTTCAGATCTTGTTCGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGCCTTTCGACCTCTATCCAAGAAAGCTTGCAGCCTACATCTCAGTTTTGGGATGCCTCCAGAACACTAAAAACATTAG
  5   1   2       bld DMZ       in                         xl338o21.5p                                                                                                                                                                                                                                                                                                                              TTTTTTACAAGGTTGGCAAGTTTTATGAACTTTATCACATGGATGCTGTCATTGGGGTGAATGAGCTGGGCCTGACATTCATGAAAGGAACGTGGGCTCATTCTGGCTTTCCCGAGATTGCTTTTGGTCGCTTTTCTGATGTTCTCGTACAGAAAGGCTACAAAGTATCCAGAGTGGAACAAACGGAAACACCAGAGATGATGGAAGCCCGGTGCAAGTCAATGTCGCATCCAAGTAAATTTGACAGGGTTGTAAGAAGAGAAATATGCAGGATCATTACTAAAGGGACACAGACCTACAGTGTGTTGGATGGTAATCCATCTGAAAGCCATAGTAAGTATCTTCTGTGCTTCAAAGAAAAAATGGAAGATTCCTCTGGTCAAAGGAGAGTATACGGCGTCTCTTTTGTGGACACCTCCGTAGGGAAGTTTCACGTCGGTCAGTTTGAGGATGACCGCCATTGTTCACGCTTTAGAACTTTGGTGGCCCATTTCCCTCCAGTTCAGATCTTGTTCGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGCCTTTCGACCTCTATCCAAGAAAGCTTGCAGCCTACATCTCAGTTTTGGGATGCCTCCAGAACACTAAAAACATTAGCTGAAGAAGCTTACTTTGAAAAAGACTTTCAGCCTGCCGCTGGCAATGGTAACCTGCCGTCTGTTTTGAAAAGCATGACTTCAGAAAGTGACTCCT
  5   1   2       bld Ga12                                 XL146l10.5p                                                                                                                                                                                                                                                                                                                                                                                                                            GGCTNTTCTGGCTTTCCCGAGNATTGCTTTTGGTCGCTTTTCTGATGTTCTCGTACAGAAAGGCTACAAAGTATCCAGAGTGGAACAAACGGAAACACCAGAGATGATGGAAGCCCGGTGCAAGTCAATGTCGCATCCAAGTAAATTTGACAGGGTTGTAAGAAGAGAAATATGCAGGATCATTACTAAAGGGACACAGACCTACAGTGTGTTGGATGGTAATCCATCTGAAAGCCATAGTAAGTATCTTCTGTGCTTCAAAGAAAAAATGGACGATTCCTCTGGTCAAAGGAGAGTATACGGCGTCTCTTTTGTGGACACCTCCGTAGGGAAGTTTCACGTCGGTCAGTTTGAGGATGACCGCCATTGTTCACGCTTTAGAACTTTGGTGGCCCATTTCCCTCCAGTTCAGATCTTGTTTGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGCCTTTCGACCTCTATCCAAGAAAGCTTGCAGCCTACATCTCAGTTTTGGGATGCCTCCAGAACACTAAAAACATTAGCTGAAGAAGCTTACTTTGAAAAAGACTTTCAGCCTGCCGCTGGCAATGGTAACCTGCCGTCTGTTTTGAAAAGCATGACTTCAGAAAGTGACTCCTTAGCACTTACTCCTGGTGAAAAGTGCGAATTGGCTCTTTCGGCACTT
  5   1   2       bld Tbd7                                 XL075k07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAAAATGGACGATTCCTCTGGTNAAAGGAGAGTATACGGCGTCTCTTTTGTGGACACCTCCGTAGGGAAGTTTCACGTCGGTCAGTTTGAGGATGACCGCCATTGTTCACGCTTTAGAACTTTGGTGGCCCATTTCCCTCCAGTTCAGATCTTGTTTGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGCCTTTCGACCTCTATCCAAGAAAGCTTGCAGCCTACATCTCAGTTTTGGGATGCCTCCAGAACACTAAAAACATTAGCTGAAGAAGCTTACTTTGAAAAAGACTTTCAGCCTGCCGCTGGCAATGGTAACCTGCCGTCTGTTTTGAAAAGCATGACTTCAGAAAGTGACTCCTTAGCACTTACTCCTGGTGAAAAGTGCGAATTGGCTCTTTCGGCACTTGGAGCCTGTATATATTACCTGAAAAAATGTCTTATCGACCAAGAGCTGCTCTCCATGGCAAACTTTGAAGAATATGTTCCTGTGGATACTGATGTAGAAAAAGCCCAGACTTCAAGTAATTTCTTTGCCAAGACAAGTCGGCGCATGGTTCTTGATGGAGTGACGCTTACAAATCTGGAAATCCTCCAAAATGGAA
  5   1   2       bld Tbd1                                 AW765352.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGACCGCCATTGTTCACGCTTTAGAACTTTGGTGGCCCATTTCCCTCCAGTTCAGATCTTGTTCGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGCCTTTCGACCTCTATCCAAGAAAGCTTGCAGCCTACATCTCAGTTTTGGGATGCCTCCAGAACACTAAAAACATTAGCTGAAGAAGCTTACTTTGAAAAAGACTTTCAGCCTGCCGCTGGCAATGGTAACCTGCCGTCTGTTTTGAAAAGCATGACTTCAGAAAGTGACTCCTTAGCACTTACTCCCGGTGAAAAGTGCGAATTGGCTCTTTCGGCACTTGGAGCCTGTATATATTACCTGAAAAAATGTCTTATCGACCAAGAGCTGCTCTCCATGGCAAACTTTGAAGAATATGTTCCTGTGGATACTGATGTAGAAAAAGCCCAGACTTCAAGTAATTTCTTTGCCAAGACAAGTCGGCGCATGGTTCTTGACGGAGTGACTCTTACGAATCTGGAAATCCTCCAGAATGGAACAAATGGG
  5   1   2       bld Emb1                            IMAGE:6863696.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTCTTGGATGCCTCCAGAACACTAAAAACATTAGCTAGAAGAAGCTTACTTTGAAAAAGACTTTCAGCCTGCCACTGGCAATGGTAACCTGCCGTCTGTTTTGAAAAGCATGACTTCAGAAAGTGACTCCTTAGCACTTACTCCCGGTGAAAAGTGCGAATTGGCTCTTTCGGCACTTGGAGCCTGTATATATTACCTGAAAAAATGTCTTATCGACCAAGAGCTGCTCTCCATGGCAAACTTTGAAGAATATGTTCCTGTGGATACTGATGTAGAAAAAGCCCAGACTTCAAGTAATTTCTTTGCCAAGACAAGTCGGCGCATGGTTCTTGACGGAGTGACTCTTACGAATCTGGAAATCCTCCAGAATGGAACAAACGGTTCTACAGAAGGGACGCTGTTGGAAAAACTAGACACCTGCTCTACCCCTTTTGGCAAGCGTCTCTTAAAACAGTGGCTCTGCGCACCCCTTTGTAATCCATTCTCCATTAATGATCGTTTAAATGCAGTGGAAGATCTCATGGCCCTTCCTGGGAAAGTGTCTGAGGTTAGCGAGCTCTTAAAGAAACTGCCCGATCTCGAAAGGCTGCTGAACAAAATTCACAGTATTGGGTTCTCCACTTTAAAAGCCCAGAAACCTTTCAGAATAGCCGGGGCTGTCCTGGTATGAGGGAAAAATTCACCTTTCCAGGAAAGAAGAAGAATTGCCAAATTTCTTATCCAACCCTGGGAGGGGTTCAAAGTCATGaaaaaaaaGTGATCCCCTATTCTTGGAAAAATGATAGTTTGCCCACtttttaaggccaaggtttttttccaaacaagattgttttggggtttaaaagaaaaaaaCTTTCTTCTAGGGGGCGCCCTTCTCCCCTAATTTATCCGGCCCGAAACCCaaaaaaaaTGGGGAATAACCTCCCTTTTGTACTCCC
  5  -1   2       bld Bla2                            IMAGE:7299589.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      NaaaaaaaaaaaaaaNGCCCTCCAGGTGTCCTTGGCCAAAAAAGGAATTTAATTCCGCGCAAATACCTTTTAAAACAATAAAGATCCTTATTCTCGGAAAAGGAATGTTTTGCCATGGCCTTATTTTCCAAAAATTTTTCGCCAAGGTTTTCCCTGCAATTTAAGAATGTTCCTGGGATTTGTTAAAAAAGGCAGATTCAATAATTTTTGCCAGACAATTCGGGCATGTTCTTAGGANGGAGCTACCATTTGGAATCTTCAAAAATGACCAACGTTTTACAGAAGGACGCTGTGGAAAACTAGACACTTGTCTACCCTTTTGGAAGCGTCTCTAAAACAGTGCTCTGCGCACCCCTTGTATCCATCTCCATTTATGATCGTTTANTGCAGTGAAGATCTCATGGGCCTCCTGGAAAGTGTCTGAGTTAGCGAGCTCTAAAGAAGCTGCCCGATCTCGAGAGGCTGCTGAGCAAGATTCACAGTATTGGTTCTCCACTTAAAAGCCAGAACCATCCAGATAGCCGGGCTGTCATGTATGAGGAGATCACTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTACCCTGGAGGGGTTCAAAGTCATGAGAGAAGTGATCAGTATTATGGAAGATGATGTTGCTCATTTTAAGTCAAGTATTCTCAAACAGATTGTTTGTGTTAAAGATAAAGCTTCTCATGGGCGCTTCCCCGATTTATCGGCCGAGCTGAAGAGATGGGATACGTCCTTTGATCACGAGAAAGCCCGCAAGACCGGTGTGATCACTCCAAAAGCGGGTTTCGATCCGGATTACGACGAAGCGTTGAAAGATGTCAAACAAGCCGAGCAAGAGCTTAACGAGTATTTGGACAAACAACGCAAACGACTCGGCTGTAAAACCGTCGTCTATTGGGGGACGGCCAAGAACCGATATCAAATGGAAATTCCCGAGAACATCGCTGACCGCAATCTGCCTGAAGAGTACACGCTAAAATCCACCAAAAAAGGGTTCAAGCGCTACTGGACCAAGGCAATTGAAAAGATGTTTGGAGACCTGGTGAACGCAGAGGAACGTAGGGATGCCGCGCTTAAGGACTGCATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAGGAATGGCAGACTGCTGTGGAATGCTTTGCCGTGTTAGATGTTCTGATAAGTTTATCTCAGTACAGTCAAGGAGGGGACGGGCCGGTGTGCAGACCAGAGATAGTGCTACAGGAAAATGGGTCGCCGTTTTTGGAGCTGAAAGGTTCACGACACCCCTGCaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCGCCCATTATCCGG
  5   1   2       bld Emb1                            IMAGE:6866119.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGTGCGAATTGGCTCTTTCGGCACTTGGAGCCTGTATATATTACCTGAAAAAATGTCTTATCGACCAAGAGCTGCTCTCCATGGCAAACTTTGAAGAATATGTTCCTGTGGATACTGATGTAGAAAAAGCCCAGACTTCAAGTAATTTCTTTGCCAAGACAAGTCGGCGCATGGTTCTTGACGGAGTGACTCTTACGAATCTGGAAATCCTCCAGAATGGAACAAACGGTTCTACAGAAGGGACGCTGTTGGAAAAACTAGACACCTGCTCTACCCCTTTTGGCAAGCGTCTCTTAAAACAGTGGCTCTGCGCACCCCTTTGTAATCCATTCTCCATTAATGATCGTTTAAATGCAGTGGAAGATCTCATGGCCCTTCCTGGGAAAGTGTCTGAGGTTAGCGAGCTCTTAAAGAAACTGCCCGATCTCGAGAGGCTGCTGAGCAAGATTCACAGTATTGGTTCTCCACTTAAAAGCCAGAACCATCCAGATAGCCGGGCTGTCATGTATGAGGAGATCACTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTACCCTGGAGGGGTTCAAAGTCATGAGAGAAGTGATCAGTATTATGGAAGATGATGTTGCTCATTTTAAGTCAAGTATTCTCAAACAGATTGTTTGTGTTAAAGATAAAGCTTCTCATGGGCGCTTCCCCGATTTATCGGCCGAGCTGAAGAGATGGGATACGTCCTTTGATCACGAGAAAGCCCGCAAGACCGGTGTGATCACTCCAAAAGCGGGTTTCGATCCGGATTACGACGAAACGTTGAAAGATGTCAAACAAGCCCGAGCAAGATCTTAACGAGTATTTGGGACAAACAACGCAAACGACTCGGCTGTAA
  5   1   2       bld DMZ                                  xl311n10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGATACTGATGTAGAAAAAGCCCAGACTTCAAGTAATTTCTTTGCCAAGACAAGTCGGCGCATGGTTCTTGACGGAGTGACTCTTACGAATCTGGAAATCCTCCAGAATGGAACAAACGGTTCTACAGAAGGGACGCTGTTGGAAAAACTAGACACCTGCTCTACCCCTTTTGGCAAGCGTCTCTTAAAACAGTGGCTCTGCGCACCCCTTTGTAATCCATTCTCCATTAATGATCGTTTAAATGCAGTGGAAGATCTCATGGCCCTTCCTGGGAAAGTGTCTGAGGTTAGCGAGCTCTTAAAGAAACTGCCCGATCTCGAGAGGCTGCTGAGCAAGATTCACAGTATTGGTTCTCCACTTAAAAGCCAGAACCATCCAGATAGCCGGGCTGTCATGTATGAGGAGATCACTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTACCCTGGAGGGGTTCAAAGTCATGAGAGAAGTGATCAGTATTATGGAAGATGATGTTGCTCATTTTAAGTCAAGTATTCTCAAACAGATTGTTTGTGTTAAAGATAAAGCTTCTCATGGGCGCTTCCCCGATTTATCGGCCGAGCTGAAGAGATGGGATACGTCCTTTGATCACGAGAAAGCCCGCAAGACCGGTGTGATCACTCCAAAAGCGGGTTTCGATCCGGATT
  5   1   2       bld DMZ                                  xl311e01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGATACTGATGTAGAAAAAGCCCAGACTTCAAGTAATTTCTTTGCCAAGACAAGTCGGCGCATGGTTCTTGACGGAGTGACTCTTACGAATCTGGAAATCCTCCAGAATGGAACAAACGGTTCTACAGAAGGGACGCTGTTGGAAAAACTAGACACCTGCTCTACCCCTTTTGGCAAGCGTCTCTTAAAACAGTGGCTCTGCGCACCCCTTTGTAATCCATTCTCCATTAATGATCGTTTAAATGCAGTGGAAGATCTCATGGCCCTTCCTGGGAAAGTGTCTGAGGTTAGCGAGCTCTTAAAGAAACTGCCCGATCTCGAGAGGCTGCTGAGCAAGATTCACAGTATTGGTTCTCCACTTAAAAGCCAGAACCATCCAGATAGCCGGGCTGTCATGTATGAGGAGATCACTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTACCCTGGAGGGGTTCAAAGTCATGAGAGAAGTGATCAGTATTATGGAAGATGATGTTGCTCATTTTAAGTCAAGTATTCTCAAACAGATTGTTTGTGTTAAAGATAAAGCTTCTCATGGGCGCTTCCCCGATTTATCGGCCGAGCTGAAGAGATGGGATACGTCCTTTGATCACGAGAAAGCCCGCAAGACCGGTGTGATCACTCCAAAAGCGGGTTTCGATCCGGATT
  5   1   2       bld Em10                            IMAGE:8321701.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCGTCTCTTGAACAGTGGCTCTGCGCACCCCTTTGTAATCCATTCTCCATTAATGATCGTTTAAATGCAGTGGAAGATCTCATGGCCCTTCCTGGGAAAGTGTCTGAGGTTAGCGAGCTCTTAAAGAAACTGCCCGATCTCGAGAGGCTGCTGAGCAAGATTCACAGTATTGGTTCTCCACTTAAAAGCCAGAACCATCCAGATAGCCGGGCTGTCATGTATGAGGAGATCACTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTACCCTGGAGGGGTTCAAAGTCATGAGAGAAGTGATCAGTATTATGGAAGATGATGTTGCTCATTTTAAGTCAAGTATTCTCAAACAGATTGTTTGTGTTAAAGATAAAGCTTCTCATGGGCGCTTCCCTGATTTATCGGCCGAGCTGAAGAGATGGGATACGTCCTTTGATCACGAGAAAGCCCGCAAGACCGGTGTGATCACTCCAAAAGCGGGTTTCGATCCGGATTACGATGAAGCGTTGAAAGATGTCAAACAAGCCGAGCAAGATCTTAACGAGTATTTGGACAAACAACGCAGACGACTCGGCTGTAAAACCGTCGTCTATTGGGGGACGGCCAAGAACCGATATCAGATGGAAATTCCCGAGAACATCGCTGACCGCGATCTGCCTGAAGAGTACGCGCTAAAATCCACCAAAGATGGTTCAAGCGCTACTGGACCAGCGCATTGAAATGAG
  5   1   2       bld Em10                            IMAGE:8318197.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTTCCCGGTTCCGGGAATTCCCGGGATCGAGCTCTTAAAAGAAAACTGCCCGATCTCGAGAGGCTGCTGAGCAAGATTCACAGTATTGGTTCTTCCACTTAAAAGCCAGAACCATCCAGATAGCCGGGCTGTCATGTATGAGGAGATCACTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTACCCTGGAGGGGTTCAAAGTCATGAGAGAAGTGATCAGTATTATGGAAGATGATGTTGCTCATTTTAAGTCTAGTATTCTCAAACAGATTGTTTGTGTTAATGATAAAGCTTCTCATGGGCGCTTCCCTGATTTATCGGCCGAGCTTAAGTTTGGGATACGTCCTTTGATCACGAAA
  5   1   2       bld Emb1                            IMAGE:6866315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGCTTAAAGAAACTGCCCGATCTCGAGAGGCTGCTGAGCAAGATTCACAGTATTGGTTCTCCACTTAAAAGCCAGAACCATCCAGATAGCCGGGCTGTCATGTATGAGGAGATCACTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTACCCTGGAGGGGTTCAAAGTCATGAGAGAAGTGATCAGTATTATGGAAGATGATGTTGCTCATTTTAAGTCAAGTATTCTCAAACAGATTGTTTGTGTTAAAGATAAAGCTTCTCATGGGCGCTTCCCCGATTTATCGGCCGAGCTGAAGAGATGGGATACGTCCTTTGATCACGAGAAAGCCCGCAAGACCGGTGTGATCACTCCAAAAGCGGGTTTCGATCCGGATTACGACGAAGCGTTGAAAGATGTCAAACAAGCCGAGCAAGATCTTAACGAGTATTTGGACAAACAACGCAAACGACTCGGCTGTAAAACCGTCGTCTATTGGGGGACGGCCAAGAACCGATATCAAATGGAAATTCCCGAGAACATCGCTGACCGCAATCTGCCTGAAGAGTACACGCTAAAATCCACCAAAAAAGGGTTCAAGCGCTACTGGACCAAGGCAATTGAAAAGATGTTTGGAGACCTGGTGAACGCAGAGGAACGTAGGGATGCCGCGCTTAAGGACTGCATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAGGAATGGCAGACTGCTGTGGAATGCTTTGCCGTGTTAGATGTTCTGATAAGTTTATCTCAGTACAGTCAAGGAGGGGGACGGGCCGGTGTGCAGACCAGAGATAGTGCTACGGGGAAAAGGGTCGCCCTT
  5   1   2       bld Ga15                               XL498n11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATAGCCGGGCTGCTCATGTATGAGGAGATCACTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTACCCTGGAGGGGTTCAAAGTCATGAGAGAAGTGATCAGTATTATGGAAGATGATGTTGCTCATTTTAAGTCAAGTATTCTCAAACAGATTGTTTGTGTTAAAGATAAAGCTTCTCATGGGCGCTTCCCCGATTTATCGGCCGAGCTGAAGAGATGGGATACGTCCTTTGATCACNAGAAAGCCCGCAAGACCGGTGTGATCACTCCAAAAGCGGGTTTCGATCCGGATTACGACGAAGCGTTGAAAGATGTCAAACNAGCCGAGCAAGATCTTAACGAGTATTTGGACNAACAACGCAAACGACTCGGCTGTANAACCGTCGTCTATTGGGGGACGGCCAAGAACCGATATCAAATGGAAATTCCCGAGAACATCGCTGACCGCAATCTGCCTGAAGAGTACACGCTAAAATCCACCAAAAAAGGGTTCAAGCGCTACTGGACCAAGGCAATTGAAAAGATGTTTGGAGACCTGGTGAACGCAGAGGAACGTANGGATGCCGCGCTTAAGGACTGCATGAGGAGGCTCTTCTATAACTTTGATAANAACTACAAGGAATGGCAGACTGCTGTGGAATGCTTTGCCGTGTTANATGTTCTGATAAGTTTATCTCANTACAGTCAAGGAGGGGACGGGCCGGTGTGCA
  5   1   2       bld Ga15      in                       XL497n11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATAGCCGGGCTGTCATGTATGAGGAGATCACTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTACCCTGGAGGGGTTCAAAGTCATGAGAGAAGTGATCAGTATTATGGAAGATGATGTTGCTCATTTTAAGTCAAGTATTCTCAAACAGATTGTTTGTGTTAAAGATAAAGCTTCTCATGGGCGCTTCCCCGATTTATCGGCCGAGCTGAAGAGATGGGATACGTCCTTTGATCACGAGAAAGCCCGCAAGACCGGTGTGATCACTCCAAAAGCGGGTTTCGATCCGGATTACGACGAAGCGTTGAAAGATGTCAAACAAGCCGAGCAAGATCTTAACGAGTATTTGGACAAACAACGCAAACGACTCGGCTGTAAAACCGTCGTCTATTGGGGGACGGCCAAGAACCGATATCAAATGGAAATTCCCGAGAACATCGCTGACCGCAATCTGCCTGAAGAGTACACGCTAAAATCCACCAAAAAAGGGTTCAAGCGCTACTGGACCAAGGCAATTGAAAAGATGTTTGGAGACCTGGTGAACGCAGAGGAACGTAGGGATGCCGCGCTTAAGGACTGCATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAGGAATGGCAGACTGCTGTGGAATGCTTTGCCGTGTTAGATGTTCTGATAAGTTTATCTCAGTACAGTCAAGGAGGGGACGGGCCGGTGTGCAGACCANAAGATAGTGCTACAGGAAAATGGGTCGCCGTTTTTGG
  5   1   2       bld Egg1                               PBX0159B11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACGAGGGAAGCGTTGAAAGATGTCAAACAAGCCGAGCAAGAGCTTAACGAGTATTTGGACAAACAACGCAAACGACTCGGCTGTAAAACCGTCGTCTATTGGGGGACGGCCAAGAACCGATATCAAATGGAAATTCCCGAGAACATCGCTGACCGCAATCTGCCTGAAGAGTACACGCTAAAATCCACCAAAAAAGGGTTCAAGCGCTACTGGACCAAGGCAATTGAAAAGATGTTTGGAGACCTGGTGAACGCAGAGGAACGTAGGGATGCCGCGCTTAAGGACTGCATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAGGAATGGCAGACTGCTGTGGAATGCTTTGCCGTGTTAGATGTTCTGATAAGTTTATCTCAGTACAGTCAAGGAGGGGACGGGCCGGTGTGCAAACCAGAGATAGTGCTACAGGAAAATGGGTCGCCGTTTTTGGAGCTGAAAGGTTCACGACACCCCTGCATCACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTTGTTGGCTGCAAGGAGGAGGATTCTGTTGACGGCAGTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAG
  5   1   2       bld Ga15                               XL470k18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCGTTGAAAGATGTCAAACAAGCCGAGCAAGATCTTAACGAGTATTTGGACAAACAACGCAAACGACTCGGCTGTAAAACCGTCGTCTATTGGGGGACGGCCAAGAACCGATATCAAATGGAAATTCCCGAGAACATCGCTGACCGCAATCTGCCTGAAGAGTACACGCTAAAATCCACCAAAAAAGGGTTCAAGCGCTACTGGACCAAGGCAATTGAAAAGATGTTTGGAGACCTGGTGAACGCAGAGGAACGTAGGGATGCCGCGCTTAAGGACTGCATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAGGAATGGCAGACTGCTGTGGAATGCTTTGCCGTGTTAGATGTTCTGATAAGTTTATCTCAGTACAGTCAAGGAGGGGACGGGCCGGTGTGCAGACCAGAGATAGTGCTACAGGAAAATGGGTCGCCGTTTTTGGAGCTGAAAGGTTCACGACACCCCTGCATCACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTTGTTGGCTGCAAGGAGGAGGATTCTGATGACGGCAGTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACNACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTT
  5   1   2       bld Bla1                            IMAGE:3381187.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACTACAAGGAATGGCAGACTGCTGTGGTTTGCTTTGCCGTGTTAGATGTTCTGATAAGTTTATCTCAGTACAGTCAAGGAGGGGACGGGCCGGTGTGCAGACCATAGATAGTGCTACAGGAAAATGGGTCGCCGTTTTTGGAGCTGAAAGGTTCACGACACCCCTGCATCACAAAAACCTTGTCTGTGGATGATTACATTCCAAATGACATTCTTGTTGGCTGCAAGGAGGATGATTCTGATGACGGCAGTGATGAGGCTCACTGTGTGCTCATCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGATACACGCGGGTGTCGCAACTGCTATAGCCCACACGGTGATGACCGCTCTGTGTGAATCCTGCTTACTGACTGCTAGTCGCCGTTTT
  5   1   2       chi Ga15      in                       XL472k07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTACTGGACCAAGGCAATTGAAAAGATGTTTGGAGACCTGGTGAACGCAGAGGAACGTAGGGATGCCGCGCTTAAGGACTGCATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAGGAATGGCAGACTGCTGTGGAATGCTTTGCCGTGTTAGATGTTCTGATAAGTTTATCTCAGTACAGTCAAGGAGGGGACGGGCCGGTGTGCAGACCAGAGATAGTGCTACAGGAAAATGGGTCGCCGTTTTTGGAGCTGAAAGGTTCACGACACCCCTGCATCACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTTGTTGGCTGCAAGGAGGAGGATTCTGATGACGGCAGTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCCGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTC
  5   1   2       bld Te2                             IMAGE:7209802.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAATGGCAGACTGCTGTGGAATGCTTTGCCGTGTTAGATGTTCTGATAAGTTTATCTCAGTACAGTCAAGGAGGGGACGGGCCGGTGTGCAGACCAGAGATAGTGCTACAGGAAAATGGGTCGCCGTTTTTGGAGCTGAAAGGTTCACGACACCCCTGCATCACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTTGTTGGCTGCAAGGAGGAGGATTCTGTTGACGGCAGTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCATGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCGGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACATCACGTTCCTTACAAGTCATTAAGGNNGCGTGTCTA
  5   1   2       bld Egg1                               PBX0045F05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGTTCTGATAAATTTATCTCAGTACAGTCAAGGAGGGGACGGTCCGGTGTGCAGACCAGATATAGTGCTACAGGAAAATGGGTCGCCGTTTTTGGAGCTGAAAGGCTCACGACACCCCTGCATCACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTTGTTGGCTGCAAGGAGGAGGATTCTGATGACGGCAGTGATGACGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGCTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCATACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAG
  5   1   2       bld Skin      in                    IMAGE:8640365.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCAGGAGGGGACGGGCCGGTGTGCAGACCAGAGATAGTGCTACAGGAAAATGGGTCGTCGTTTTTGGAGCTGAAAGGTTCACGACACCCCTGCATCACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTTGTTGGCTGCAAGGAGGAGGATTCTGATGACGGCAGTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCCGGTGCGGTGGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTCATTAGGGGGCGTGTCCTAAAGCTACNGCTTTACGCTGCCAGCTGGCTCACATCTGACGAATTTATCAGTCGCATCAAAGCAGAGATCNGGATCTACCTTCCTCACTCTCAAGACTGTCTCCATGACACGTCCCGAGCTCCTCCACACGTGATGCC
  5   1   2       bld Ga18      in                      xlk152a01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCACGACACCCCTGCATCACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTTGTTGGCTGCAAGGAGGAGGATTCTGATGACGNCNNNNTGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGNCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCCGGTGCNNNTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGNGGAAAACGAATGCGAGGNTCCGAGTCAGGAGANCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGNTGGNTCACATTCCTGACGAAANTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGNTCTTCAGAGAACTCTTCCTCGCACTGGACAACGNNTCCCCCGAG
  3   1   2       bld Ga18      in                      xlk152a01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGANACCCTGCANCNNAAAANNTTTTTGGGGATGATTTCNNNNAAATGACATTCTTGTTGGCTGCAAGGAGGAGGATTCTGATGACGGCAGTGATGAGGCTCNCTGTGTGCTCGTCACCGGNCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGNNACAGCTATAGCCGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCNNNAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCGAGGCCTCGCTCTCCACAAGNGGCTGAAGTTGCTCCAATANNNNNCCCACTGCTTTGTTTACTCANA
  3   1   2       chi DMZ       out                        xl254b17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACGGGCCGGTGTGCAGACCAGAGATAGTGCTACAGGAAAATGGGTCGCCGTTTTTGGAGCTGAAAGGTTNCACGACACCCCTGCATCACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTTGTTGGCTGCAAGGAGGAGGATTCTGTTGACGGCAGTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCATGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTT
  3   1   2       bld Skin      in                    IMAGE:8640365.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGCTGAAGGAAGAGATTTGATGACGCAGGATGAGCTCCATTTTGTTCGTCCCGGGCCAACAGGGGAGGCAGTCGACCCTTTTGAGACAGGCGGTCTCCAGGTGGTATGGCCCAGTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTTGAGGTATATTGGCAGCAGCCACAGGAACAATTCTCCCTCGTGTTTCTAGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCCGGTGCGGTGGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGGGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTGTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTGTTACTCACACACGGGCTCACNANAACNNNAAAAA
  3   1   2       bld DMZ  5g3  out                        xl231b13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAGGAGGATTCTGTTGACGNCAGTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCATGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCGGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTACTCA
  5   1   2       bld Egg1                               PBX0120F01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGATTCTGATGACGGCAGTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCGGGTGCGGTGGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTNCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTATGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGTGAGGATCCGAGTCA
  5   1   2       bld Gas8                   IMAGE:3516101-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCACACAGTGAGCCTCATCACTGCCGTCATCAGAATCCTCCTCCTTGCAGCCAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCGGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGGTCGGCCATCAAAAAG
  5   1   2       bld Gas8                            IMAGE:3516101.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACACAGTGAGCCTCATCACTGCCGTCATCAGAATCCTCCTCCTTGCAGCCAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCGGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGTTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCATGAGACCATCACGTTCCTTTACACGTTCATTAAGGCGGCGTTGTCTAAAAACTACGGCTTTAACGCTGCCAGGCTTGCTTACATTACTGACGAAATTATTCAT
  3   1   2      seed DMZ  5g3  out                        xl235f18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCAGTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCATGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCGGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTT
  3   1   2       bld DMZ  5g3  out                        xl288l23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGATGAGGCTCACTGTGTGCTCGTCACCGGGCCAAANCATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATANTGCAGCATGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCGGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTG
  3   1   2       bld DMZ       in                         xl338o21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTGTGCTCGTCACCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGTTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCGGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGTGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTT
  3   1   2       bld DMZ       in                         xl292n19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCACCGGGCCAAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGCGGGTCTCCAGGTTGTTATGGCCCAGTTGGGATGNTACGTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGNTATAGCGGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCNCAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGTGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTNGCTCCAATAACGTGTCCCAC
  3   1   2       chi Ga15      in                       XL472k07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCTGCAAGGAGGGAGGATTNTGATGACGGCAGTGATGAGGCTCACTGTGTGCTCGTCNCCGGGCCAAACATGGGAGGCAAGTCGACCCTTTTGAGACAGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCACGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCCGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTACTCACACACG
  3   1   2       bld Ga12 5g3  out                        XL209g21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGCCGGCAGACTCCTGCAGACTGACTCCTGTCGACCGGGTCTTCACACGACTCGGAGCATCTGACAGAATCATGGCCGGTGAAAGCACGTTTTTCGTGGAATTGAGTGAAACGTCGAGTATACTGCAGCATGCAACGGAACATTCCCTCGTGCTTCTCGATGAACTTGGAAGAGGCACGGCTACATTTGATGGCACAGCTATAGCGGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCATCTAATAAACT
  3   1   2       bld Ga15      in                       XL497n11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGCATTCCCTCGTGCTTCTCGANGAAGNTTGGAAGAGGCACGGNTACATTTGATGGCACAGNTATANCCGGTGCGGTTGTGAAGGAACTGTCTGAAAGCATCAAATGCCGAACTTTATTTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGTCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCC
  5  -1   2       add Tail                            IMAGE:8545112.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGATAGCAGAGGATCCAGATCTCCAAACAGAGTAAATGGCTTCCTGTCCTATTGCAATGTANTAGGTGATGGGGAATCACTGACATCACAAACAGANNGTAANNAATTGTCCCACTTTCNTTCCCCATCCNTAATTACATCGCAACTAGGACTCTGTCGGTATTTGGCTAATCTTTCATGAAGGATCCGGCTGATCAGTGGATTGGGTGCACCCCTACATGATGATGGAAGTCTTGAGCCAATCACTGCTCTGTCTGATCATGGTGTGAGTTTGGCCCCGACATTCAGATGAATAATGGGGGGTCGGGGCGAATGTAACTGTTGTGGCAGATGATGGTGGGACTTTGTTGAATGTTCTTTGTCTAATTGTCTTCTCCTGGCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCATCTAATAAACTTTATTTTTTAAAAATGACCATATTTCCAtttttttttttttctttcctaggaaattaaacttttttttttttGTTTGTTTAAATTCATACCTAGCCGCTACATAATGGTTATTGAATACTCCACAATATATTAAGTCTAGATGTTCTGGTACATGCATAAACTGTCAGGCTCTTGGACTCACCCACTGTCACCAATACATAGAAATGGGGGAGGAACTGAAATATATATCACAGGCCTGTGTAGAAGATTTGCTCGGCTTCATCAGGAAATCTCTCTATTCCCAGCAAGGTCGACGCTGTTCAATAAAAT
  3   1   2       bld Emb1                            IMAGE:3401172.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTATTTTCCACACACTACCACTCCATGGAGGAGAATCACTATCACAGTCAGTCTGTACGTATCGGGCAAATGGCTTGTATGGTGATAAACAAATGCGAGGATCCGAGTCAGGAAACCATCACGTTCCTTACAAAGTTCATTAAGGGGGCGTGTCCTAAAAGATACGGCTTAAACGCTGCCAGGCTGGCTCACATTCCTGAAGAAATTATCCAGGTCGGCCATCAAACAGCAAGAAAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTTTTCCTCGCAATGGACAACGGTTCCCCCGAGGGCCTCGCTATCCACAAACGGCTGAAGTTGC
  3   1   2       bld Tbd1                                 AW782370.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTCCACACACTACCACTCCCTGGTGGAGGATCACTCTCACAGCCAGTCTGTACGTCTCGGGCACATGGCTTGTATGGTGGAAAACGAATGCGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCATCTAATAAACTTTATTTTTTAAAAATGAAA
  5   1   2       bld Gas5      in                    IMAGE:3748056.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGAGGATCCGAGTCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCAT
  3   1   2       bld Gas5      in                    IMAGE:3748056.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATCACGTTCCTTTACAAGTTCATTAAGGGGGCGTGTCCTAAAAGCTACGGCTTTAACGCTGCCAGGCTGGCTCACATTCCTGACGAAATTATCCAGGTCGGCCATCAAAAAGCAAGAGAATTCGAGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCATCTAATAAACTTTATTTTTTAAA
  5   1   2       bld Ga15      in                       XL500o05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCATCTAATAAACTTTATTTTTTaaaaatgaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL500o05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACAC
  3   1   2       bld Ga15                               XL501p05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGTCTTACCCTTTCCCTCAAGCTCTTCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGGCCTCGCTCTCCAGCAAGCGGCTGAAGTTGCTCCAATAANCGTGTCCCA
  3   1   0       add Ga15      out                      XL489m05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCCCCCCCGTTTTTTTTTTTTTGTTTGTTTAAATTCATACCTAGCCGCTACATAATGGTTATTGAATACTCCACAATATATTAAGTCTAGATGTTCTGGTACATGCATAAACTGTCAGGCTCTTGGACTCACCCNCTGTCACCAATACATAGAAATGGGGGAGGAACTGAAATATATATCNCAGGCCTGTGTAGAAGATTTGCTCGGCTTCATCAGGAAATCTCTCTATTCCCAGCAAGGTCGACGCTGTTCAATAAAATNTGANCGGCAATAAAGGAGCATTTGTGGGGGGTTNTTACAGTNAAACTAAAAGCAGTGNTCGGGGGTGAGGAGGGGAGATCCACATTCGGCTTCAGTCTCGACAGACGANC
  5  -1   2      4-98                                Xl3.1-xlk4p04ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACCACTTAGGAAGTACTTTTTTCCTTCTTCCCAACCCTAATTTGAATATGTAAATTAGGGGTGGGAAGGGAAATCACATGACCATCACAAAACTAGGAATTAAACAATTTGTCCCCACTTTTTCTTCCCCATCCCTAATTTCAATATTTAAATTAGGGGTGGGAAGGGAAATCACATGACCATCACAAAACTAGGAAGTAAAAATTTACTCCCTTTTTTTTTCTTTCCTGTGCCTAATTTGAATATGTAAATTAGGGTGGGAAGGGAAATCACATGACCATCATAAAACAAGGGAGTAAACAATTTCCTTTTCTTTCCTGTGCCTAATTTCCATATGCAAACTAAGATTCATCACTCATACTTTTTTTTTCTTCCCCAGCCCTAATTTGAATATGTAAATTAGGGAAGGGAAATCACATGACCATCACAAAACAAAGCAATAAACAATTTGTCCCCATCCCTAATTTCAATATGTAAATTAGGGCAGGAAGGGAAATCACACGACTTCTTCACAAAACAAGGAAGTAAAAATGTGTCCTTCCCTGTCCCTAATTCGCATATGTAAATTAGGGGTGGAATGGGAAATCACATGACCATCACAAAACAAGGAAGTAAAAAAATTTGTCCCCACTTTTTCCTTCCCCATCCCTAATTTACATCTGCAAACTAGGACTCTGTTCGGTATTTGGCTAAATCTTTCATGAAGGATCCGGCTGATTAGTGGATTGGGTGCACCCCTACATGATGATGGAAGGCTTGAGCCAATCACTGCTCTGTCTGATCATGGTGTGAGTTTGGCCCCGACATTCAGATGAATAATGGGGGGTCGGGGCGAATGTAACTGTTGTGGCAGATGATGGTGGGACTTTGTTGAATGTTCTTTGTCTAATTGTCTTCTCCTGGCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCATCTAATAAACTTTATTTTTTAAAA
                                                  Xl3.1-CHK-1012708253                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCATCACACCACTTAGGAAGTACTTTTTTCCTTCTTCCCAACCCTAATTTGAATATGTAAATTAGGGGTGGGAAGGGAAATCACATGACCATCACAAAACTAGGAATTAAACAATTTGTCCCCACTTTTTCTTCCCCATCCCTAATTTCAATATTTAAATTAGGGGTGGGAAGGGAAATCACATGACCATCACAAAACTAGGAAGTAAAAATTTACTCCCTTTTTTTTTCTTTCCTGTGCCTAATTTGAATATGTAAATTAGGGTGGGAAGGGAAATCACATGACCATCATAAAACAAGGGAGTAAACAATTTCCTTTTCTTTCCTGTGCCTAATTTCCATATGCAAACTAAGATTCATCACTCATACTTTTTTTTTCTTCCCCAGCCCTAATTTGAATATGTAAATTAGGGAAGGGAAATCACATGACCATCACAAAACAAAGCAATAAACAATTTGTCCCCATCCCTAATTTCAATATGTAAATTAGGGCAGGAAGGGAAATCACACGACTTCTTCACAAAACAAGGAAGTAAAAATGTGTCCTTCCCTGTCCCTAATTCGCATATGTAAATTAGGGGTGGAATGGGAAATCACATGACCATCACAAAACAAGGAAGTAAAAAAATTTGTCCCCACTTTTTCCTTCCCCATCCCTAATTTACATCTGCAAACTAGGACTCTGTTCGGTATTTGGCTAAATCTTTCATGAAGGATCCGGCTGATTAGTGGATTGGGTGCACCCCTACATGATGATGGAAGGCTTGAGCCAATCACTGCTCTGTCTGATCATGGTGTGAGTTTGGCCCCGACATTCAGATGAATAATGGGGGGTCGGGGCGAATGTAACTGTTGTGGCAGATGATGGTGGGACTTTGTTGAATGTTCTTTGTCTAATTGTCTTCTCCTGGCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCATCTAATAAACTTTATTTT
  3  -1   2       bld Ga15      in                       XL401n06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTCATCACACCACTTAGGAAGTACTTTTTTCCTTCTTCCCAACCCTAATTTGAATATGTAAATTAGGGGTGGGAAGGGAAATCACATGACCATCACAAAACTAGGAATTAAACAATTTGTCCCCACTTTTTCTTCCCCATCCCTAATTTCAATATTTAAATTAGGGGTGGGAAGGGAAATCACATGACCATCACAAAACTAGGAAGTAAAAATTTACTCCCTTTTTTTTTCTTTCCTGTGCCTAATTTGAATATGTAAATTAGGGTGGGAAGGGAAATCACATGACCATCATAAAACAAGGGAGTAAACAATTTCCTTTTCTTTCCTGTGCCTAATTTCCATATGCAAACTAAGATTCATCACTCATACTTTTTTATCTTCC
  3  -1   2      seed Ga18      in                        xlk4p04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCACACAACTAGGAAGTACTTTTTTCCTTCTTCCCAACCCTAATTTGAATATGTAAATTAGGGGTGGGAAGGGAAATCACATGACCATCACAAAACTAGGAATTAAACAATTTGTCCCCACTTTTTCTTCCCCATCCCTAATTTCAATATTTAAATTAGGGGTGGGAAGGGAAATCACATGACCATCACAAAACTAGGAAGTAAAAATTTACTCCCTTTTTTTTTCTTTCCTGTGCCTAATTTGAATATGTAAATTAGGGTGGGAAGGGAAATCACATGACCATCATAAAAGAAGGGAGTAAACAATTTCCTTTTCTTTCCTGTGCCTAATTTGCATATGCAAACTAAGATTCATCACTCATACTTTTTTTTTCTTCCCCAGCCCTAATTTGAATATGTAAATTAGGGAAGGGAAATCACATGACCATCACAAAACAAAGCAATAAACAATTTGTCCCCATCCCTAATTTCAATATGTAAATNAGGGCAGGAAGGGAAANCACACGACTTCTTCACAAAACAAGGAAGTAAAAATGTGTCCTTCCCTGTCCCTAATTCGCATATGTNANNTAGGGGTGGAATGGGAAANCACATGACCATCANNAACAAGGNNGNAAAAAANTTNTCCCCACTTTTCCTNCCCCATNCCTAATTANATCTGCAACTAG
  5  -1   2       bld Ga15      in                       XL401n06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAATTTGAATATGTAAATTAGGGNGGGAAGGGAAATCACATGACCATCATAAAACAAGGGAGTAAACAATTTCCTTTTCTTTCCTGTGCCTAATTTCCATATGCAAACTAAGATTCATCACTC
  5  -1   1       add Ga18      in                        xlk4p04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCNNAAAGANNGANTAAACAATTNNCTTTTNTNCCTGTNNCTAATTNNNATATGCAAANNAAGATTCATNNCTCATNCtttttttttCTTCCCCAGCCCTAATTTGNATATGTAAATTAGGGAAGGGAAATCACATGACCATCACAAAACAAAGCAATAAACAATTTGTCCCCATCCCTAATTTCAATATGTAAATTAGGGCAGGAAGGGAAATCACACGACTTCTTCACAAAACAAGGAAGTAAAAATGTGTCCTTCCCTGTCCCTAATTCGCATATGTAAATTAGGGGTGGAATGGGAAATCACATGACCATCACAAAACAAGGAAGTAAAAAAATTTGTCCCCACTTTTTCCTTCCCCATCCCTAATTTACATCTGCAAACTAGGACTCTGTTCGGTATTTGGCTAAATCTTTCATGAAGGATCCGGCTGATTAGTGGATTGGGTGCACCCCTACATGATGATGGAAGGCTTGAGCCAATCACTGCTCTGTCTGATCATGGTGTGAGTTTGGCCCCGACATTCAGATGAATAATGGGGGGTCGGGGCGAATGTAACTGTTGTGGCAGATGATGGTGGGACTTTGTTGAATGTTCTTTGTCTAATTGTCTTCTCCTGGCAGAGAACTCTTCCTCGCACTGGACAACGGTTCCCCCGAGGCCTCGCTCTCCACAAGCGGCTGAAGTTGCTCCAATAACGTGTCCCACTGCTTTGTTTACTCACACACGGGTCTCATCTAATAAACTTTATTTTTTAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)