Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL417g07ex.3                         87 END     1           1        1                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:7296634.5                      76 END     1           1        1                (no blast hit)
     3   2.0    0Xl3.1-XL439j21ex.3                         58 END     1           1        1                pEg7 [Xenopus laevis]
     4   2.0    0Xl3.1-IMAGE:6639217.5                      55 END     1           1        1                (no blast hit)
     5   2.0    0Xl3.1-XL520b02ex.3                         39 END     8           8       20                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     6   0.0    0Xl3.1-IMAGE:8317666.5.5                    45 PI      82        303      690                (no blast hit)
     7   0.0    0Xl3.1-XL520b02ex.3                         39 PI      77       2264     3335                (no blast hit)

 This cluster: approximate FL confidence score = 59%

 1012837805 Xl3.1-xl280e12.5.5 - 95 ESTs
                                                                       ...-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xl280e12.5.5                                                                                                                                                                                                                                                              GAGGTGGCTATCTAGTTTGCAGTTACGGAGATATAAGTGAAAGTTGCTCGGGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCAGCCCTTACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGACTTTACGTGCCCGCGTCAGCTCAAAGTGCCCCCCTACCTGGCCTACCGCTTCCTGGGAGAGAAGGACTGTGGCGCTCCCTGTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAGGAGGAGGAGGTGCGCTTCGCCCGGCTCTGGGTGGGTATCTGGGCGATCCTGTGCTGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCGGCGCTTCAGTTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGGCTTACACTGCGGGCTTCCTGCTGGAGGAGCGGGCGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACAGTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGTTCCATCTGGTGGGTGATCCTGTCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGCGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCCTCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACTGAGAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCACACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTAATGACCATGATCGTGGGCATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGAGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACGTGGGGCAACACCTACTGGACTTAAAGGGACTTTTCATTTTACTGCTACTCACGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGTTTTTTTTTTCCTTTGTACCTGTAGCACTAACAGCTGCTAAACTACAACTCCCAGGATGTTGCTCAACAAGTGCAGGGTTCACGTTGCTCANCTGATCGTTGTTGGTTAGTTAGTTAAGTGGGGCCGGTTTTACACAGATACAGTAGCAGGGAAGAGAGGACTAAAGAAGAAATGTGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCGCTTGCATTATGTCTCACAGCAGGAGATAAAGGAACACTAATCCCAAAAGCCGATAACATTCCGAGCAAGCTCACAAATGTGTGTATACATGTAAATGTCTTCATACAATGGCAGATAGCATGGTATCTCACAACGCAAGCACATGAACTCTTTGTCTCCCTGCAATGTATTATTCTGTTATCCCTTTATTTGCTTTTTAGACTTTTCATACAGGAAGTCTGATAAGGGCAACAAATACTTCCCTCCATGATCACATCTGCCTTCTAATGCATTTTCTTCCAGCTCAGGTTTCTGTGAGTGTATATGCACATTTGTGTTTGCTACAGCTCTCTCACTGACTTGTATTTAGCGCTCTCAGCCCTTTGTTTGGCTTGCAGTGACTATCACATTGCCTGAGAAATGGATTGATATTAGCAGTGATAGGGGTGCCACATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTGCTCAGCTGCTAGGCTTAGGGATGTTTCGTGTTTACCTAACAGATCAAGGCTTGTGGATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGCCCCCCCCCCTTCCTTCCCCTTTTTCTCCATTCCAAATTTTTTTTTTAACATTAGCATTATTGATCAGCTATTCTTTGTGGAATTAAGGTGTTGACACTTGTTAACTGGGTCCAGCAGTGAAGAGGTTTTAGCCTTCCTTTATAAGAAATATTTCTCAGATACTGTATTTAATCAATTTGTGCCTGTATAGCCAGCGGCTTGTTGGTCCGTGCCTGCAAATGTATCCTATAATGCAGTGTTGGAAAATTCTTTTGGTATGAAAGATAGCAGATTTCATTCAGTTTTCAATTTCATGTTTATTCTCACATTAAATGCATAATACCGAGTTGATCTGCTAAATAAAACCTCATGCCTTCCCCCAATTGTGTTGTATAATATTAGGAGGTTGATATGCATAGCCATTTCTTTGGCAGATCAACTCCATCTGAACAATTGCTATAGTGAAGGGAATTTTGGCATACAAGTTGCTTTTTTTTTTTTTTTTTTAAATGAGCCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGANACC
                                                  Xl3.1-CHK-1012722756                                                                                                                                                                                                                                                                    GCTATCTAGTTTGCAGTTACGGAGATATAAGTGAAAGTTGCTCGGGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCAGCCCTTACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGACTTTACGTGCCCGCGTCAGCTCAAAGTGCCCCCCTACCTGGCCTACCGCTTCCTGGGAGAGAAGGACTGTGGCGCTCCCTGTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAGGAGGAGGAGGTGCGCTTCGCCCGGCTCTGGGTGGGTATCTGGGCGATCCTGTGCTGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCGGCGCTTCAGTTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGGCTTACACTGCGGGCTTCCTGCTGGAGGAGCGGGCGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACAGTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGTTCCATCTGGTGGGTGATCCTGTCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGCGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCCTCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACTGAGAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCACACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTAATGACCATGATCGTGGGCATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGAGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACGTGGGGCAACACCTACTGGACTTAAAGGGACTTTTCATTTTACTGCTACTCACGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGTTTTTTTTTTCCTTxxxxCCTGTAxxxxxxACAGCTGCTAAACTACAACTCCCAGGATGTTGCTCAACAAGTGCAGGGTTCACGTTGCTCANCTGATCGTTGTTGGTTAGTTAGTTAAGNGGGGCCGGTTTTACACAGATACAGTAGCAGGGAAGAGAGGACTAAAGAAGAAATGTGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCGCTTGCATTATGTCTCACAGCAGGAGATAAAGGAACACTAATCCCAAAAGCCGATAACATTCCGAGCAAGCTCACAAATGTGTGTATACATGTAAATGTCTTCATACAATGGCAGATAGCATGGTATCTCACAACGCAAGCACATGAACTCTTTGTCTCCCTGCAATGTATTATTCTGTTATCCCTTTATTTGCTTTTTAGACTTTTCATACAGGAAGTCTGATAAGGGCAACAAATACTTCCCTCCATGATCACATCTGCCTTCTAATGCATTTTCTTCCAGCTCAGGTTTCTGTGAGTGTATATGCACATTTGTGTTTGCTACAGCTCTCTCACTGACTTGTATTTAGCGCTCTCAGCCCTTTGTTTGGCTTGCAGTGACTATCACATTGCCTGAGAAATGGATTGATATTAGCAGTGATAGGGGTGCCACATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTGCTCAGCTGCTAGGCTTAGGGATGTTTCGTGTTTACCTAACAGATCAAGGCTTGTGGATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGCCCCCCCCCCTTCCTTCCCCTTTTTCTCCATTCCAAATTTTTTTTTTAACATTAGCATTATTGATCAGCTATTCTTTGTGGAATTAAGGTGTTGACACTTGTTAACTGGGTCCAGCAGTGAAGAGGTTTTAGCCTTCCTTTATAAGAAATATTTCTCAGATACTGTATTTAATCAATTTGTGCCTGTATAGCCAGCGGCTTGTTGGTCCGTGCCTGCAAATGTATCCTATAATGCAGTGTTGGAAAATTCTTTTGGTATGAAAGATAGCAGATTTCATTCAGTTTTCAATTTCATGTTTATTCTCACATTAAATGCATAATACCGAGTTGATCTGCTAAATAAAACCTCATGCCTTCCCCCAATTGTGTTGTATAATATTAGGAGGTTGATATGCATAGCCATTTCTTTGGCAGATCAACTCCATCTGAACAATTGCTATAGTGAAGGGAATTTTGGCATACAAGTTxxTTTTTTTTTTTTTTTTTTAAATGAGCCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGACAxCCTCACT
                                                      consensus depths                                                                                                                                                                                                                                                                   2     4     3     6     7     9     8    14    10    16    10    16    10    16    10    16    11    17    11    17    11    17    11    17    12    17    12    17    13    18    13    18    13    18    13    18    14    19    14    19    15    20    14    19    18    19    18    19    18    19    18    19    18    18    20    20    20    20    19    20    19    20    19    20    19    20    20    21    20    21    20    22    20    22    20    22    19    22    18    21    17    20    17    20    17    20    16    19    16    19    16    19    16    19    16    19    16    19    16    19    15    18    13    16    13    16    13    16    13    16    12    16    12    16    12    15    12    15    10    15    10    15    10    15    10    15    10    15    10    14     9    14     8    13     8    13     8    13     8    13     8    13     8    15     9    15     9    14     8    11     9    12     9    10     9    10     9    10     9    11    10    11    10    11    10    11     9    10     8    10     9    11    10    13     8    11     8    12     7    12     8    11     8    11     8    10     8    11    10    13    11    13    11    13    11    13    11    13    11    13    10    12    11    12    11    12    11    12    11    12    11    12    13    14    12    14    13    14    12    14    12    14    13    14    13    14    12    14    14    14    13    14    14    14    14    14    13    14    14    14    14    14    13    15    14    14    14    14    12    13    14    14    14    14    14    14    11    14    13    13    13    13    13    13    13    13    13    14    13    14    13    14    12    14    13    14    14    15    13    15    13    14    12    14    14    15    14    15    13    14    14    16    14    16    15    17    14    16    14    15    14    15    14    15    14    16    14    15    14    15    14    15    15    16     9    16     9    16     9    15     9    15    10    15    10    16    10    17    10    16    11    16    11    16    12    17    12    17    12    17    12    17    12    17    12    17    11    17    11    17    10    16    10    16     7    16     4    15     7    15     7    15     6    14     6    13     6    13     5    12     5    12     6    13     8    14     7    14     5    14     6    15     8    14     8    14     8    13     8    13     7    12     6    10     6    10     6    10     4    10     4     8     5     8     6     8     6     8     4     7     5     7     4     7     5     7     5     7     5     6     5     6     5     6     4     6     5     6     5     6     5     6     4     6     5     6     5     5     4     4     4     4     3     4     4     4     5     5     6     6     5     6     5     5     6     6     7     7     7     7     7     7     7     7     8     8     8     8     8     9     7     8     8     8     8     8     9     9     9     9    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11     7     9     7     9     7     9     7     9     8    10     6     8     5     9     4     9     5     9     6     9     7     9     6     9     6     9     7     9     7     9     5     7     6     9     7     9     8     9     8     9     8    10     8    10     8    10     8    10     8    10     8    10     7    10     7    10     6    10     7    10     6    10     7    11     5    11     5    11     5    11     5    11     5    12     5    12     5    12    18    21     5    20    12    19    17    21    17    21    16    21    17    22    15    22    18    22    18    20    16    20    18    19    16    19    16    19    17    19    17    19    17    19    17    19    16    18    16    18    15    17    15    17    14    17    14    17    13    16    14    16     9    15
  5   1   2       e50                                 Xl3.1-xl280e12.5                                                                                                                                                                                                                                                              GAGGTGGCTATCTAGTTTGCAGTTACGGAGATATAAGTGAAAGTTGCTCGGGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCAGCCCTTACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGACTTTACGTGCCCGCGTCAGCTCAAAGTGCCCCCCTACCTGGCCTACCGCTTCCTGGGAGAGAAGGACTGTGGCGCTCCCTGTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAGGAGGAGGAGGTGCGCTTCGCCCGGCTCTGGGTGGGTATCTGGGCGATCCTGTGCTGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCGGCGCTTCAGTTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGGCTTACACTGCGGGCTTCCTGCTGGAGGAGCGGGCGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACAGTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGTTCCATCTGGTGGGTGATCCTGTCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGCGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCCTCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACTGAGAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCACACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTAATGACCATGATCGTGGGCATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGAGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACGTGGGGCAACACCTACTGGACTTAAAGGGACTTTTCATTTTACTGCTACTCACGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGTTTTTTTTTTCCTTTGTACCTGTAGCACTAACAGCTGCTAAACTACAACTCCCAGGATGTTGCTCAACAAGTGCAGGGTTCACGTTGCTCANCTGATCGTTGTTGGTTAGTTAGTTAAGTGGGGCCGGTTTTACACAGATACAGTAGCAGGGAAGAGAGGACTAAAGAAGAAATGTGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCGCTTGCATTATGTCTCACAGCAGGAGATAAAGGAACACTAATCCCAAAAGCCGATAACATTCCGAGCAAGCTCACAAATGTGTGTATACATGTAAATGTCTTCATACAATGGCAGATAGCATGGTATCTCACAACGCAAGCACATGAACTCTTTGTCTCCCTGCAATGTATTATTCTGTTATCCCTTTATTTGCTTTTTAGACTTTTCATACAGGAAGTCTGATAAGGGCAACAAATACTTCCCTCCATGATCACATCTGCCTTCTAATGCATTTTCTTCCAGCTCAGGTTTCTGTGAGTGTATATGCACATTTGTGTTTGCTACAGCTCTCTCACTGACTTGTATTTAGCGCTCTCAGCCCTTTGTTTGGCTTGCAGTGACTATCACATTGCCTGAGAAATGGATTGATATTAGCAGTGATAGGGGTGCCACATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTGCTCAGCTGCTAGGCTTAGGGATGTTTCGTGTTTACCTAACAGATCAAGGCTTGTGGATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGCCCCCCCCCCTTCCTTCCCCTTTTTCTCCATTCCAAATTTTTTTTTTAACATTAGCATTATTGATCAGCTATTCTTTGTGGAATTAAGGTGTTGACACTTGTTAACTGGGTCCAGCAGTGAAGAGGTTTTAGCCTTCCTTTATAAGAAATATTTCTCAGATACTGTATTTAATCAATTTGTGCCTGTATAGCCAGCGGCTTGTTGGTCCGTGCCTGCAAATGTATCCTATAATGCAGTGTTGGAAAATTCTTTTGGTATGAAAGATAGCAGATTTCATTCAGTTTTCAATTTCATGTTTATTCTCACATTAAATGCATAATACCGAGTTGATCTGCTAAATAAAACCTCATGCCTTCCCCCAATTGTGTTGTATAATATTAGGAGGTTGATATGCATAGCCATTTCTTTGGCAGATCAACTCCATCTGAACAATTGCTATAGTGAAGGGAATTTTGGCATACAAGTTGCTTTTTTTTTTTTTTTTTTAAATGAGCCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGA
  5   1   2       e50                              Xl3.1-xlk133j16ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTTTTTTTTTTTTTTTTTAAATGAGCCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGACAGCCTCATTTNTCTTGTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                  ACGTACTTTGCAGTTACGGAGACATAAGAGAAAGTTCCTTGGCTCTCGCATGTATATGAGCGGGAATACGGGCGCCCTGAGCTCCAGTGTCTGTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                  TGCTTAAAGGAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                              ACGAATCTGCCAGTTTGGAGCCACCAGTATCAGCCGATTTCTGCTCACTCCGCGGCCCCGCTGATATTCACCTGTTGCTGCCGGGGTGTCGGCATGTTGGCTCCGGTGTCGCTGCTGTTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACACCTACTGGAGATCTAGGGACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTCTTTTTACT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTACTGCTACTAAACTTGCCTGGGGACATTCCTCCTCTTAATGCACATTATTTCTAGTAGCCATGGAACAAGGCTTCTATATGAAGAGCTTGGGCTGACCCAGTCTGGGCAATAGGGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTATTTCCT
                                                                   SNP                                                                                                                                                                                                                                                                                                              --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T-------
                                               BLH MIN     216     341                                                                                                                                                                                                                                                              
                                               BLH MPR       3     341                                                                                                                                                                                                                                                              
                                               BLH OVR     234      14                                                                                                                                                                                                                                                              
                                               EST CLI      25      11                                                                                                                                                                                                                                                              
                                               ORF LNG     234       3                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 4e-115     NP_492635.1 More Of MS MOM-5, Frizzled homolog (62.9 kD) (mom-5) [Caenorhabditis elegans] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 1e-150     NP_524812.1 CG17697-PA [Drosophila melanogaster] ----------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 4e-158     NP_001071791.1 frizzled receptor [Ciona intestinalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 1e-179     XP_001193885.1 PREDICTED: similar to Frizzled homolog 7b [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Bt ---- 0          NP_001094518.1 frizzled homolog 1 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dr ---- 0          NP_571214.1 frizzled homolog 7a; frizzled homolog 7 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Gg ---- 0          NP_989552.1 frizzled homolog 7 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Cf ---- 0          XP_545599.2 PREDICTED: similar to frizzled 7 isoform 1 [Canis familiaris] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 0          NP_032083.3 frizzled 7 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 0          NP_003498.1 frizzled 7; frizzled (Drosophila) homolog 7; Frizzled, drosophila, homolog of, 7[Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 0          AAZ06130.1 frz7 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 0          NP_001079354.1 frizzled homolog 7 [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-xl280e12.5.5                                                                                                                                                                                                                                                                          TAG------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------ATG---ATG------------------------------------------------------------------------------------------------------------TGA------------------------TAA---------------------------------------------------------------------------------------------------ATG------------TGA---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------TGA---------------TAG------------------------------TAG---------------TAA---------------TAA------------------------------------------ATG---------------TAA------------------------TAA---------------------------------------------------ATG---------ATG---------------------TGA------------------ATG------------------------------TAG------------------------------------------------------------------ATG------------------------------------------------------------------TGA---------------------------------------TGA------------------------------------------------------------------------TAA------------------------------TAG---TAG------------------TAA---------------------TAA---------------TAA------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------TAA---TAG------TGA------------------------------------------------------TGA---------------------TAA------------------------TAA---------------------------------------------------------TAA---------------------------------TAG------------------------------------------------------------TGA---------TAA------ATG---------------------TAA---TAG---------ATG---------------------------------------------TAGTGA---------------------------------------------TGA------------------------------------------------------------TGA---------TGA---------------------------------------------------TAA---------------ATG---------------------------------ATG---------------TGA------------------------------TAA------------------------------------ATG------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2       e50                                 Xl3.1-xl280e12.5                                                                                                                                                                                                                                                              GAGGTGGCTATCTAGTTTGCAGTTACGGAGATATAAGTGAAAGTTGCTCGGGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCAGCCCTTACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGACTTTACGTGCCCGCGTCAGCTCAAAGTGCCCCCCTACCTGGCCTACCGCTTCCTGGGAGAGAAGGACTGTGGCGCTCCCTGTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAGGAGGAGGAGGTGCGCTTCGCCCGGCTCTGGGTGGGTATCTGGGCGATCCTGTGCTGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCGGCGCTTCAGTTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGGCTTACACTGCGGGCTTCCTGCTGGAGGAGCGGGCGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACAGTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGTTCCATCTGGTGGGTGATCCTGTCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGCGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCCTCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACTGAGAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCACACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTAATGACCATGATCGTGGGCATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGAGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACGTGGGGCAACACCTACTGGACTTAAAGGGACTTTTCATTTTACTGCTACTCACGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGTTTTTTTTTTCCTTTGTACCTGTAGCACTAACAGCTGCTAAACTACAACTCCCAGGATGTTGCTCAACAAGTGCAGGGTTCACGTTGCTCANCTGATCGTTGTTGGTTAGTTAGTTAAGTGGGGCCGGTTTTACACAGATACAGTAGCAGGGAAGAGAGGACTAAAGAAGAAATGTGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCGCTTGCATTATGTCTCACAGCAGGAGATAAAGGAACACTAATCCCAAAAGCCGATAACATTCCGAGCAAGCTCACAAATGTGTGTATACATGTAAATGTCTTCATACAATGGCAGATAGCATGGTATCTCACAACGCAAGCACATGAACTCTTTGTCTCCCTGCAATGTATTATTCTGTTATCCCTTTATTTGCTTTTTAGACTTTTCATACAGGAAGTCTGATAAGGGCAACAAATACTTCCCTCCATGATCACATCTGCCTTCTAATGCATTTTCTTCCAGCTCAGGTTTCTGTGAGTGTATATGCACATTTGTGTTTGCTACAGCTCTCTCACTGACTTGTATTTAGCGCTCTCAGCCCTTTGTTTGGCTTGCAGTGACTATCACATTGCCTGAGAAATGGATTGATATTAGCAGTGATAGGGGTGCCACATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTGCTCAGCTGCTAGGCTTAGGGATGTTTCGTGTTTACCTAACAGATCAAGGCTTGTGGATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGCCCCCCCCCCTTCCTTCCCCTTTTTCTCCATTCCAAATTTTTTTTTTAACATTAGCATTATTGATCAGCTATTCTTTGTGGAATTAAGGTGTTGACACTTGTTAACTGGGTCCAGCAGTGAAGAGGTTTTAGCCTTCCTTTATAAGAAATATTTCTCAGATACTGTATTTAATCAATTTGTGCCTGTATAGCCAGCGGCTTGTTGGTCCGTGCCTGCAAATGTATCCTATAATGCAGTGTTGGAAAATTCTTTTGGTATGAAAGATAGCAGATTTCATTCAGTTTTCAATTTCATGTTTATTCTCACATTAAATGCATAATACCGAGTTGATCTGCTAAATAAAACCTCATGCCTTCCCCCAATTGTGTTGTATAATATTAGGAGGTTGATATGCATAGCCATTTCTTTGGCAGATCAACTCCATCTGAACAATTGCTATAGTGAAGGGAATTTTGGCATACAAGTTGCTTTTTTTTTTTTTTTTTTAAATGAGCCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGA
                                                  Xl3.1-CHK-1012685894                                                                                                                                                                                                                                                                    GCTATCTAGTTTGCAGTTACGGAGATATAAGTGAAAGTTGCTCGGGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCAGCCCTTACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGACTTTACGTGCCCGCGTCAGCTCAAAGTGCCCCCCTACCTGGCCTACCGCTTCCTGGGAGAGAAGGACTGTGGCGCTCCCTGTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAGGAGGAGGAGGTGCGCTTCGCCCGGCTCTGGGTGGGTATCTGGGCGATCCTGTGCTGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCGGCGCTTCAGTTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGGCTTACACTGCGGGCTTCCTGCTGGAGGAGCGGGCGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACAGTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGTTCCATCTGGTGGGTGATCCTGTCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGCGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCCTCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACTGAGAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCACACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTAATGACCATGATCGTGGGCATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGAGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACGTGGGGCAACACCTACTGGACTTAAAGGGACTTTTCATTTTACTGCTACTCACGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGTTTTTTTTTTCCTTxxxxCCTGTAxxxxxxACAGCTGCTAAACTACAACTCCCAGGATGTTGCTCAACAAGTGCAGGGTTCACGTTGCTCANCTGATCGTTGTTGGTTAGTTAGTTAAGNGGGGCCGGTTTTACACAGATACAGTAGCAGGGAAGAGAGGACTAAAGAAGAAATGTGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCGCTTGCATTATGTCTCACAGCAGGAGATAAAGGAACACTAATCCCAAAAGCCGATAACATTCCGAGCAAGCTCACAAATGTGTGTATACATGTAAATGTCTTCATACAATGGCAGATAGCATGGTATCTCACAACGCAAGCACATGAACTCTTTGTCTCCCTGCAATGTATTATTCTGTTATCCCTTTATTTGCTTTTTAGACTTTTCATACAGGAAGTCTGATAAGGGCAACAAATACTTCCCTCCATGATCACATCTGCCTTCTAATGCATTTTCTTCCAGCTCAGGTTTCTGTGAGTGTATATGCACATTTGTGTTTGCTACAGCTCTCTCACTGACTTGTATTTAGCGCTCTCAGCCCTTTGTTTGGCTTGCAGTGACTATCACATTGCCTGAGAAATGGATTGATATTAGCAGTGATAGGGGTGCCACATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTGCTCAGCTGCTAGGCTTAGGGATGTTTCGTGTTTACCTAACAGATCAAGGCTTGTGGATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGCCCCCCCCCCTTCCTTCCCCTTTTTCTCCATTCCAAATTTTTTTTTTAACATTAGCATTATTGATCAGCTATTCTTTGTGGAATTAAGGTGTTGACACTTGTTAACTGGGTCCAGCAGTGAAGAGGTTTTAGCCTTCCTTTATAAGAAATATTTCTCAGATACTGTATTTAATCAATTTGTGCCTGTATAGCCAGCGGCTTGTTGGTCCGTGCCTGCAAATGTATCCTATAATGCAGTGTTGGAAAATTCTTTTGGTATGAAAGATAGCAGATTTCATTCAGTTTTCAATTTCATGTTTATTCTCACATTAAATGCATAATACCGAGTTGATCTGCTAAATAAAACCTCATGCCTTCCCCCAATTGTGTTGTATAATATTAGGAGGTTGATATGCATAGCCATTTCTTTGGCAGATCAACTCCATCTGAACAATTGCTATAGTGAAGGGAATTTTGGCATACAAGTTGCTTTTTTTTTTTTTTTTTTAAATGAGCCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGA
  5  -1   2       bld Tbd7                                 XL082l22.5p CCCCCCCACCCATCCTTCAATCTCCTTCAATCCAGACACAAGCACAGCCAATCACGAGACAAGCGCCGAGGCAAAACAAAGGCTCTCATTGGCCTGCGGTCAGACGCCCAAGTCACGCCCCTTCTCTATACTCGGCCACGCTTTGTGAATGGGGGATCCAGTGACGGGACTGGGATAATGGGCGGGTCCACAGAGTTTAATACACGGCACGCCCTTTCTGTTGATACTCTCTTAAAAGGAGAGCGTTGTGGATGAGGGACGAGTTTATGAGAGGCTGTGGGAAGTGATTACGTACTTTGCAGTTACGGAGACATAAGAGAAAGTTCCTTGGCTCTCGCATGTATATGAGCGGGAATACGGGCGCCCTGAGCTCCAGTGTCTGTTGCGCTTAAAGGAGACGAATCTGCCAGTTTGGAGCCACCAGTATCAGCCGATTTCTGCTCACTCCGCGGCCCCGCTGATATTCACCTGTTGCTGCCGGGGTGTCGGCATGTTGGCTNCCGGTGTCGCTGCTGTTNCTGTNCTATTNCCTGCAGCTNCTGCCCGTNCCGCCCAGCAGTACCACGGGGAGAAGGG
  5   1   2       bld Oo1  5x                         IMAGE:6643782.5p                                                                                                                                                                                                                                                  GCATTGCTGGTGGAGGTGGCTATCTAGTTTGCAGTTACGGAGATATAAGTGAAAGTTGCTCGGGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCNCATCTGCTCGGACACACCAACCAGNAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAAGTTCAGTGTTCCCCCGAAGCTGCGCCTCCTTCTGGGGCTCCATGTACGCCGCCGGTTTGCACCGTGTTGGGAACAGGCCATccccccccTGCCCGTTCCCTGTTGCGAAAAAACCCCGGAAGGGGTTTGCAAAGCCCCTCCTTGAACAAGTTTCGGGCTTCCCAGGGGGCCCAAAAGGGGTTTGCCTTTTGGAAAAAATTTCCCCGGAACCCggggggggggggggaaaatttgggggggggaaaaaaaaccctttccaaaaaaaaagacccgtgttgggggccccccccGGGTTGGGGGCCCAAACCCTTTTATCTTTGGCGGGGAAAAGATATTTACCCTTTTTTAAGGCGGGGAGcccccccccACCGGGGGGAATTTTTTATTGGGGCGCCCCCGCGCGTTCTCTCTTAAGAGGGGGCCCCCCCTTCTCTCTGGGG
  5   1   2       bld Emb1 5g                         IMAGE:6634218.5p                                                                                                                                                                                                                                                         TGGTGGAGGTGGCTATCTAGTTTGCAGTTACGGAGATATAAGTGAAAGTTGCTCGGGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCAGATAACAGCCCGGTCCGGccccccccGCTCGGGCCCAGCCCCTTACCCTGCCCGGGAAAGGTATCACCCTTTCCAGNCCGGCAACCCCCCCACCGGGGGGACCTTTTAACGTTGTGCCCCGCCGGTTCAGGCTTCCAAAAGTGGGGccccccccccTTAACCCTTGGAGCCCTTTACCGGGCTTTTTCCCTC
  5   1   2       bld Ga18      in                      xlk112j08ex.5p                                                                                                                                                                                                                                                             TGGAGGTGNNTATCTAGTTTGCAGTTACGGAGATATAAGTGAAAGTTGCTCGCGTCCTGCGTTTATATGAGCGGGAATACGGCCGCNCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACNANNNNGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGNAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTTGCACCGTGTTGGAACAGGNCATCCCCCCGTGCCGNNGCTGTNNNNNAGANCCAGGCAGNNTGCGAGGNNNTCATGAACAANNCGNNTTCCAGTGGCCCGAGNGCTGCNNTGTGAGAATTTCCCGGTACACGGGCGGGGNNNNCTNCNTGGGNNAGAACACTTCAGA
  5   1   2       bld Neu7 5g                              XL006a12.5p                                                                                                                                                                                                                                                                   GCAGGNAATTCGGCACGAGGCGGAGATATAAGTGAAAGTTGCTCGCGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCT
  5   1   2       bld DMZ  5g                              xl274d22.5p                                                                                                                                                                                                                                                                     CTATCTAGTTTGCAGTTACGGAGATATAAGTGAAAGTTGCTCGCGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTG
  5   1   2       bld Tbd7 5g                              XL097o05.5p                                                                                                                                                                                                                                                                           GGTTTGCAGTTACGGAGATATAAGTGAAAGTTGCTCGGGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTACCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGC
  5   1   2       bld Oo1  5g                         IMAGE:5078469.5p                                                                                                                                                                                                                                                                                GCAGTTACGGAGATATAAGTGAAAGTTGCTCGGGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATG
  3  -1   2       bld Ooc3 5g   out                   IMAGE:3436922.3p                                                                                                                                                                                                                                                                                 CAGTTACGGAGATATAAGTGAAAGTTGCTCGGGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGAGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGGCCACCCATGTGCATCCCTCTGTGCACAGACATCGCCTACAACCATACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGAGGCTGGAGGTGCATCAATTCTACCAGCTGGTGAGAGTGCAGTGAGAACCGGAG
  5   1   2       bld Emb1                            IMAGE:5156168.5p                                                                                                                                                                                                                                                                                       GGGAAGTGATTACGTACTTTGCAGTTACGGAGACATAAGAGAAAGTTCCTTGGCTCTCGCATGTATATGAGCGGGAATACGGGCGCCCTGAGCTCCAGTGTCTGTTGTGCTTAAAGGAGACGAATCTGCCAGTTTGGAGCCACCAGTATCAGCCGATTTCTGCTCACTCCGCGGCCCCGCTGATATTCACCTGTTGCTGCCGGGGTGTCGGCATGTTGGCTCCGGTGTCGCTGCTGTTCTGTCTATTCCTGCAGCTCTGCCCGTCCGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTACCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCGGATAACAGCCCGGCCGGGCCCCACCGCTCGGGCCACCCTTTAACTGGCCGGACAGGTATCACCTTTCCAACCCGCACCCCCCACCGGGGAATTTACGGTGGCCCGCGGTCAGGCTCAAAAGGGGCCCCCCCTTACTTGGGGGTTAACCGCTTTCCCGGGGGCGaaaaaaaaGGACCTGGGGGGCGGCCCCCCCTGGTGGGAT
  5   1   2       bld Emb1                            IMAGE:6630805.5p                                                                                                                                                                                                                                                                                         GAAGTGATTACGTACTTTGCAGTTACGGAGACATAAGAGAAAGTTCCTTGGCTCTCGCATGTATATGAGCGGGAATACGGGCGCCCTGAGCTCCAGTGTCTGTTGTGCTTAAAGGAGACGAATCTGCCAGTTTGGAGCCACCAGTATCAGCCGATTTCTGCTCACTCCGCGGCCCCGCTGATATTCACCTGTTGCTGCCGGGGTGTCGGCATGTTGGCTCCGGTGTCGCTGCTGTTCTGTCTATTCCTGCAGCTCTGCCCGTCCGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTACCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCACCCTTAACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGNACTTCACGTGCCCGCGNTCAGCTCAAAGTGCCCCCCCTACTTGGGGCTACCGCCTTCCTGGGGCCGAAAAGGAACTGTGGCCGCCCCCCTGGTGAGCCCGC
  5   1   2       bld Ga15      out                      XL415a14ex.5p                                                                                                                                                                                                                                                                                         GAAGTGATTACGTACTTTGCAGTTACGGAGACATAAGAGAAAGTTCCTTGGCTCTCGCATGTATATGAGCGGGAATACGGGCGCCCTGAGCTCCAGTGTCTGTTGCGCTTAAAGGAGACGAATCTGCCAGTTTGGAGCCACCAGTATCAGCCGATTTCTGCTCACTCCGCGGCCCCGCTGATATTCACCTGTTGCTGCCGGGGTGTCGGCATGTTGGCTCCGGTGTCGCTGCTGTTCTGTCTATTCCTGCAGCTCTGCCCGTCCGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTACCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCA
  5   1   2       bld Emb4                            IMAGE:5570875.5p                                                                                                                                                                                                                                                                                          AAGTGATTACGTACTTTGCAGTTACGGAGACATAAGAGAAAGTTCCTTGGCTCTCGCATGTATATGAGCGGGAATACGGGCGCCCTGAGCTCCAGTGTCTGTTGTGCTTAAAGGAGACGAATCTGCCAGTTTGGAGCCACCAGTATCAGCCGATTTCTGCTCACTCCGCGGCCCCGCTGATATTCACCTGTTGCTGCCGGGGTGTCGGCATGTTGGCTCCGGTGTCGCTGCTGTTCTGTCTATTCCTGCAGCTCTGCCCGTCCGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTACCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAAAATTTCCCGGTACACGGGGGCGGGGGAAAATCTGCGTGGGAAAGAAAAACTTCTGAGTACAGCCCGGGTCCGGGGCCCTGGCGCTAGGGCCCCCCCAGTATCCCTGGCGGAGACAAGGTGTCCCCTTTGCCGCCGCGCCCCCCCATGTCCGGGAAGTTCTGAGGTGGCCTCCAGATGGGCCCGCTGAGGTCGCCCGCGTCTGCTTTATTGGCTTACGGCGTGTTCCGGTGCACGAAGAGACGAACCTGGGAGTCCCGCCACGCTGTGCTGTGCGCCT
  5   1   2       bld Ga12 5g                              XL147b02.5p                                                                                                                                                                                                                                                                                                  GTGAAAGTTGCTCGCGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACA
  5   1   2       chi Emb1                            IMAGE:6633072.5p                                                                                                                                                                                                                                                                                                    GAAAGTTGCTCGCGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGGTCAGTGTTCCCCCCGGAGCTGCGCTTTCCTCCTGGGGCTCCATGGTACGCGCCGGGTTTGCACCCGTGGTTGGAAACAGGGCCCATTccccccccgtggccgggtccgccttggggccaaaaaaaaCCCAAGGCCAGGGCCTTGGCCAAGGGCGGCCTTCATGGAAAACAAATTTCCGGGGCTTTCCCAAAGGGGGCCCCCCAAACCCGGGGTTGTGCCCCTTTGTGaaaaaaaattttttccccgggggaaaaccacgcgggggccccgggcgggaaaaaaatccttcgcgccggggggggggaaaaaaaaaaaaaaaaCCTTTTTTTCAAAC
  5   1   2       bld Ga12 5g                              XL209b07.5p                                                                                                                                                                                                                                                                                                         TTGCTCGCGTCCTGCGTTTATATGAGCGGGAATACGGCCGCGCGTATGAAGTCGGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAA
  5   1   2      seed DMZ  5g                              xl280e12.5p                                                                                                                                                                                                                                                                                                                                                              GGCGCGCTGAACTACTTTGTGTCTGAATCTGCCAGTTTGTACGAAGTTCGTCAAGGCGAGAATCCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCAGCCCTTACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGACTTTACGTGCCCGCGTCAGCTCAA
  5   1   2       bld Ga12 5g                              XL180l15.5p                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCAGCTTTCTCCTCACTTTCCAGCTCCCCCTGCTGTCCAGAGATCACTTGTTGGAGCCGGCCGGGGAGTCANCATGTCCTCTACAGTCTCGNTGCTGTT
  5   1   2       bld DMZ  5g                              xl273d14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGAGCCGGCCGGGGAGTCAGCATGTCCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCAGCCCTTACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGACTTTACGTGCCCGCGTCAGCTCAAAGTGCCCCCCTACCTGGCCTACCGCTTCCTGGGAGAGAAGGACTGTGGCGCTCCCTGTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAG
  5   1   2       bld Emb1                            IMAGE:6865524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTCTACAGTCTCGCTGCTGTTCTGCTGCCTATTCCTGCAGCTCTGCCCGTCTGCCCAGCAGTACCACGGGGAGAAGGGCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTACCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCAGCCCTTACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGACTTTACGTGCCCGCGTCAGCTCAAAGTGCCCCCCTACCTGGCCTACCGCTTCCTGGGAGAGAAGGACTGTGGCGCTCCCTGTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAGGAGGAGGAGGTGCGCTTCGCCCGGCTCTGGGTGGGTATCTGGGCGATCCTGTGCTGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCGGCGCTTCAGTTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGGCTTACACTGCCGGGCTTCCCTGCCTGGA
  5   1   2       bld DMZ                                  xl300k13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCAGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCAGCCCTTACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGACTTTACGTGCCCGCGTCAGCTCAAAGTGCCCCCCTACCTGGCCTACCGCTTCCTGGGAGAGAAGGACTGTGGCGCTCCCTGTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAGGAGGAGGAGGTGCGCTTCGCCCGGCTCTGGGTGGGTATCTGGGCGATCCTGTGCTGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCGGCGCTTCAGTTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGT
  5   1   2       bld DMZ                                  xl226e08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCATCTCGGTGCCTGACCATGGCTTCTGCCAGCCCATCTCCATCCCTCTGTGCACAGACATCGCCTACAACCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCAGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCAGCCCTTACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGACTTTACGTGCCCGCGTCAGCTCAAAGTGCCCCCCTACCTGGCCTACCGCTTCCTGGGAGAGAAGGACTGTGGCGCTCCCTGTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAGGAGGAGGAGGTGCGCTTCGCCCGGCTCTGGGTGGGTATCTGGGCGATCCTGTGCTGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCGGCGCTTCAGTTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGG
  5   1   2       bld Neu7                                 XL022l20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTACCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCAGCCCTTACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGACTTTACGTGCCCGCGTCAGCTCAAAGTGCCCCCCTACCTGGCCTACCGCTTCCTGGGAGAGAAGGACTGTGGCGCTCCCTGTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAGGAGGAGGAGGTGCGCTTCGCCCGGCTCTGGGTGGGTATCTGGGCGATCCTGTGCTGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCG
  5   1   2       bld Emb3                            IMAGE:3398696.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAACCAGGAGGACGCGGGGCTGGAGGTGCATCAGTTCTATCCGCTGGTGAAGGTTCAGTGTTCCCCGGAGCTGCGCTTCTTCCTGTGCTCCATGTACGCGCCGGTTTGCACCGTGTTGGAACAGGCCATCCCCCCGTGCCGGTCGCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCAGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCAGCCCTTACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGACTTTACGTGCCCGCGTCAGCTCAAAGTGCCCCCCTACCTGGCCTACCGCTTCCTGGGAGAGAAGGACTGTGGCGCTCCCTGTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAGGAGGAGGAGGTGCGCTTCGNCCGGCTCTGNGTGGGTATCTGGGCGATCCTGTGCTGCATCTNCACGCTTCTCACTGTACTCACTTACCTGATGGACATGCGGCGCTTCAGGTACCCCCGAGCAGACCATTCATCTTCCTGTGTCGGGTGTACTTTCATGGTGGCCCGTGGCTTACACTGCAGGCTTCCCTGCTGAAGGACCGGCAGGGTGC
  5   1   2       bld Tbd7                                 XL092a20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTCATGAACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGGGCGGGGGAGATCTGCGTGGGACAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCAGCCCTTACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGACTTTACGTGCCCGCGTCAGCTCAAAGTGCCCCCCTACCTGGCCTACCGCTTCCTGGGAGAGAAGGACTGTGGCGCTCCCTGTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAGGAGGAGGAGGTGCGCTTCGCCCGGCTCTGGGTGGGTATCTGGGCGATCCTGTGCTGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCGGCGCTTCAGTTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGGCTTACACTGCGGGCTTCCTGCTGGAGGAGCGGGCGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACAGTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGC
  5   1   2       bld DMZ                                  xl227f24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGGGGAGATCTGCGTGGGACAGAACACTTCAGATAACAGCCCGTCCGGCCCCACCGCTCGGCCCAGCCCTTACCTGCCGGACAGTATCACCTTCCAGCCGCACCCCCACCGGGACTTTACGTGCCCGCGTCAGCTCAAAGTGCCCCCCTACCTGGCCTACCGCTTCCTGGGAGAGAAGGACTGTGGCGCTCCCTGTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAGGAGGAGGAGGTGCGCTTCGCCCGGCTCTGGGTGGGTATCTGGGCGATCCTGTGCTGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCGGCGCTTCAGTTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGGCTTACACTGCGGGCTTCCTGCTGGAGGAGCGGGCGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACAGTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGTTCCATCTGGTGGGTGATCCTGTCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGGCAGTGCCCGCGGTAAAGACAATCACTATTCTGGCCATGGGGCAAGTGGAC
  5   1   2       bld DMZ                                  xl250o20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCCTGTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAGGAGGAGGAGGTGCGCTTCGCCCGGCATCTGGGTGGGTATCTGGGACGATCCTGTGCTGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCGGCGCTTCAGTTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGGCTTACACTGCGGAGCTTCCTGCTGGAGGAGCGGGCGGTGTGCGTGGAGCGCTTCTCGGANGANAGTTACCGGACAGTGGCGCAAGGCACCAAGAAGGANGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCNGCATGGCCAGTTCCATCTGGTGGGTGATCCTGTCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGAGTGTGTTACGTGGNCATCAACAGCGTGNACTCTCTGCNGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGNTCATCGGCACGTCCTTCCTGCTGGCCGGCTTCG
  5   1   2       bld DMZ                                  xl245p16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCCCTGTTGAGCCGGGCAAAGCCAACGGGCTGATGTACTTTAAGGAGGAGGAGGTGCGCTTCGCCCGGCTCTGGGTGGGTATCTGGGCGATCCTGTGCTGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCGGCGCTTCAGTTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGGCTTACACTGCGGGCTTCCTGCTGGAGGAGCGGGCGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACAGTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGTTCCATCTGGTGGGTGATCCTGTCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACNGGGACGTGCTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCATCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACCNAGACGGAGAANCTGGAGA
  5   1   2       bld DMZ       out                        xl242p06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTTAAGGAGGAGGAGGTGCGCTTCGCCCGGCTCTGGGTGGGTATCTGGGCGATCCTGTGCGGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCGGCGCTTCAGTTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGGCTTACACTGCGGGCTTCCTGCTGGAGGAGCGGGCGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACAGTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGTTCCATCTGGTGGGTGATCCTGGCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGCGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCCTCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACAAAGACTGAGAA
  5   1   2       bld Emb1                            IMAGE:3402608.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGATCCTGTGCGGCATCTCCACGCTCTTCACTGTACTCACTTACCTGGTGGACATGCGGCGCTTCAGTTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGGCTTACACTGCGGGCTTCCTGCTGGAGGAGCGGGCGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACAGTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGTTCCATCTGGTGGGTGATCCTGGCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGCGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCCTCGGCA
  5   1   2       bld DMZ                                  xl316l04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNGGCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGGCTTACACTGCGGGCTTCCTGCTGGAGGAGCGGGCGGTGTGCGTGGANCGCTTCTCGGAGGACAGTTACCGGACAGTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGTTCCATCTGGTGGGTGATCCTGTCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGNGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCATCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACGGANAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGANC
  5   1   2       bld DMZ                                  xl296b02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGGCTTACACTGCGGGCTTCCTGCTGGAGGAGCGGGCGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACAGTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGTTCCATCTGGTGGGTGATCCTGTCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCATCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACGGAGAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCAGACG
  5   1   2       add Ga18      out                     xlk147e13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCCATCATCTTCCTGTCCGGCTGTTACTTCATGGTGGCCGTGNTTACACTGCGGGCTTCCTGCTGGAGGAGCGGGCGGTGTGCGTGNNNNNNCTCGGAGGACAGTTACCGGACAGTGGCGCANNNNNCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGNNGTTCCATCTGGTGGGTGATCCTGGCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGNNAGTGCCGCGGTAAAGACCATCACTATTCTGGCCATGGGNNAAGTGGACGGGGACGTGCTGAGCGGCGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGNTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCCTCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTCTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACTGAGAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGNCNTTCAGGGANACCTGGGAAAAGACCTGGCTGGNTCACACGTGTAAAGGCTACGCGNGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTGANGACTATGATCGNGGGANTCNNCTNCNGCTTTTNG
  5   1   2       bld Ga18      in                      xlk130f13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATGGNGGCCGTGGTTACACTGCGGGCTTCCTGCTGGAGGAGCGGGNGGTGTGCGTGGAGNNTCTCGGAGGACAGTTACCGGACAGTGGCGCAGGNNCCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGNNGTTCCATCTGGTGGGTGATCCTGTCCCTCACCTGGNTCCTGTCGGCGGGAATNAAGNGGGGACACGAGGCTATCNAGGNAAANTCTCAGTACTTCCACTTGGNGGCCTG
  5   1   2       bld Emb1                            IMAGE:6632921.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTTCTCGGAGGACAGTTACCGGACAGTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGTTCCATCTGGTGGGTGATCCTGGCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGCGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCCTCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACTGAGAAGCTGGAGAAGCTGATGGTGCGAATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCACACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGNGTGTTTATGATCAAGTACTTGATGACTATGATCGTGGGAATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCCTGGGCGCAGGTTCTACCACAGAACTGGGGCAATGGGCAGCAAAAGGGGGAAGAACTGCGGGTGGTGGAACAACCCTACC
  5   1   2       bld DMZ                                  xl266p16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACAGTTTACCGGACAGTTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGTTCCATCTGGTGGGTGATCCTGTCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCATCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACGGAGAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCAGACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTAATGACCATGATCGTGGGCATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCANGTTC
  5   1   2       bld DMZ                                  xl266d01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGACAGTTACCGGACAGTGGCGCAGGGCACCAAGAAGGAGGGCTGTACCATTCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGTTCCATCTGGTGGGTGATCCTGTCCCTCACCTGGTTCCTGTCGGCGGGAATGAAGTGGGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCATCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACGGAGAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCAGACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTAATGACCATGATCGTGG
  5   1   2       bld DMZ       out                        xl229k12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGCGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCCTCGGCACGTCCTTCCTGCTGGNCGGCTTCGTGTCGCTCTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACTGAGAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCACACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTGATGACTATGATCGTGGGAATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCANGTTCTACCACAGACTGGGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACACCTACTGGAGAACACTTGttttttctttttACTGCTACTAAACTTGCCTGGGGACATTCCTCCTCTTAATGCACATTATTTCTAGTANC
  5   1   2       bld DMZ       out                        xl324c01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGACACGAGGCTATCGAGGCAAACTCTCAGTACTTCCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGCGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCCTCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTCTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACTGAGAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCACACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTGATGACTATGATCGTGGGAATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCANGTTCTACCACAGACTGGGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACACCTACTGGAGAACACTTGttttttctttttACTGCTACTAAACTTGCCTG
  5   1   2       bld Emb1                            IMAGE:6630887.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACTTGGCGGCCTGGGCAGTGCCCGCGGTAAAGACCATCACTATTCTGGCCATGGGGCAAGTGGACGGGGACGTGCTGAGCGGCGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTACCTGTTCCTCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACTGAGAAGCTGGAGAAGCTGATGGTGCGAATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCACACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTGATGACTATGATCGTGGGAATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGGGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACACCTACTGGAGATCTAGGGACACTTGttttttctttttACTGCTACTAAACTTGCCTGGGGACATTCCTCCTCTTAATGCACATTATTTCTAGTAGCCATGGAACAAGGCTTCTATATGAAGAGCTTGGGCTGACCCAGTCTGGGCAATAGGGTTACTAGCGGCAAGTGGCTTTGGATCTGATGGGGCAGACTTGGCATCATTCAAAACAATGGTTTTTATTTCCTTTGCCCTTTATGGGTACCTATTCCTGTAGCGCCACCGCTGCTCAACTTACAGCTCTCAGCATCATCCAGGGAAACNTTGGGGGGTTGGTTACTTCAACAT
  5   1   2       bld Neu7      out                        XL035i14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGGACGGGGACGTGCTGAGCGGCGTGTGTTACGTGGGCATCAACAGCGTGGACTCTCTGCGGGGCTTCGTGCTGGCCCCCCTGTTCGTGTNCCTGTTCCTCGGCACGTCCTTNCTGCTGGCCGGCTTCGTGTNGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACAAAGACTGAGAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTNCACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTNTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCACACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACT
  5   1   2       bld DMZ       out                        xl244l10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGTACCTGTTCCTCGGCACGTCCTTCCTGCTGGCCGGCTTCGTGTCGCTGTTCCGCATCAGGACCATCATGAAACACGACGGCACAAAGACTGAGAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCACACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTGATGACTATGATCGTGGGAATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGGGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACACCTACTGGAGATCTAGGGACACTTCttttttctttttACTGCTACTAAACTTGCCTGGGGACATTCCTCCTCTTAATGCACATTATTTCTAGTAGCCATGGAACAAGGCTTCTATATGAAGAGCTTGGGCTGACCCAGTCTGGGCAATAGGGTTACTAGCGGCAAGTGCTTTGGATCTGATGGGCAGGACTTGGCATCATTCAAAACAAATGTTTTTTATTTCCTTTGTCCTTTATGGTTACATATCCTGTAGCGCCACCGCTGCTCAACTACAGCTCTCAGCATCATCCAAGGAAGC
  5   1   2       bld Em10                            IMAGE:8320772.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTTCCGCATCAGGACCATCATGAAACACGACGGCACCAAGACTGAGAAGCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCACACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTGATGACTATGATCGTGGGAATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCATGGCGCAGGTTCTACCACAGACTGGGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACACCTACTGGAGAACACTTGttttttctttttACTGCTACTAAACTTGCCTGGGGACATTCCTCCTCTTAATGCACATTATTTCTAGTAGCCATGGAACAAGGCTTCTATATGAAGAGCTTGGGCTGACCCAGTCTGGGCAATAGGGTTACTAGCAGCAAGTGCTTTGGATCTGATGGGCAGGACTTGGCATCATTCAAAACAAATGTTTTTTATTTCCTTTGTCCTTTATGGTTACATATCCTGTAGCACCACCGCTGCTCAACTACAGCTCTCAGCATCATCAAGGAAGCTGGGGGTTGTACTCAACACTGGAGGCTCGGGTCGAGACTGATAGTGGTGGTAATTGGGGCAGTGCAAGTACTACGCAGGAACCAGAGTAAGAGAAGTGCTGATTGTATGTAACTAGCATCGCTCTCCCTCTGCTAGTTCACAGAAT
  5   1   2       bld Egg3                            IMAGE:6326898.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGGCCAGACGGAGATTCTGGAGAAGCTGATGGTGCGCATCGGGGTGTTCAGTGTGATGTACACGGTGCCGGCCACCATCGTGCTGGCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCAGACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTAATGACCATGATCGTGGGCATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGAGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACGTGGGGCAACACCTACTGGACTTAAAGGGACTTTTCATTTTACTGCTACTCAAGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGtttttttttCCTTTGTATCCTGTAGCACTACAGCTGCTAAACTACAACTCCCAGGATGTTGCTCAACAAGTGCAGGGTTCACGTTGCTCAGCTGATCGTTGNTGGTTAGTTAGTTAAGTGGGGCCGGTTTTACACAGATACAGTAGCAGGGAAGAGAGGACTAAAGAAAAATGTGGCCTTAATATGTAACTTTTGGCATCCGTTTATTCATTGGCCCCGGCTTGCATTTATGTCTCCACAGCCAGGAGGATAAAGGGAACCCCTAAATCCCCCAAAAGCCCGGAATAAACT
  5   1   2       bld Ga18      in                      xlk109n14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACACGGTGCCGGCCACCATCGTGCTGNCGTGTTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCAGACGTGTAAAGGCTACNNNNCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTAATGACCATGATCGTGGGCATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGAGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACGTGGGGCAACACCTACTGGACTTAAAGGGACTTTTCATTTTACTGCTACTCACGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGNCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGttttttttttCTTTGTATCCTGTAGCACTACNNCTGCTAAACTACAACTCCCAGGATGNNGCTCAACAAGTGCAGGGTTCACGNTGCTCAGCTGATCGTTGTTGGTTAGTNAGTTAAGTGGGGCCGGGTTTTACACAGATACAGTAGCAGGGAAGAGAGGNNTANAGAAGANATGTGGCTT
  5   1   2       bld Ga15                               XL500n15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTACTTCTACGAGCAGGCCTTCAGGGACACCTGGGAAAAGACCTGGCTGGTTCAGACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTAATGACCATGATCGTGGGCATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGAGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACGTGGGGCAACACCTACTGGACTTAAAGGGACTTTTCATTTTACTGCTACTCACGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGttttttttttCCTTTGTATCCTGNANCACTACAGCTGCTAAACTACAACTCCCAGGATGTTGCTCAACAAGTGCAGGGTTCACGTTGCTCANCTGATCGTTGTTGGTTANTTANTTAAGTGGGGCCGGTTTTACACANATACANTANCAGGGaaaaaaggactaaanaaaaaaTGTGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCNCTTGCATTATGTCTC
  5   1   2       bld Ga12      in                         XL219n03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGGGAAAAAGACCTGGCTGGTTCAGACGTGTAAAGGCTACGCCGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTAATGACCATGATCGTGGGCATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGAGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACGTGGGGCAACACCTACTGGACTTAAAGGGACTTTTCATTTTACTGCTACTCACGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGtttttttttCCTTTGTATCCTGTAG
  5   1   2       bld Ga15                               XL490g20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTGTTTATGATCAAGTACTTAATGACCATGATCGTGGGCATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGAGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACGTGGGGCAACACCTACTGGACTTAAAGGGACTTTTCATTTTACTGCTACTCACGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGttttttttttCCTTTGNATCCTGTANCACTACAGCTGCTAAACTACAACTCCCAGGATGTTGCTCAACAAGTGCAGGGTTCACGTTGCTCANCTGATCGTTGTTGGTTAGTTAGTTAAGNGGGGCCGGTTTTACACANATACAGTACCAGGGaaaaaaggactaaanaaaaaaTGTGGCTTAATATGTAACTTTGGCATCTGTTATTCNTTGCCCCGCTTGCATTATGTCTCACAG
  5   1   2       bld Ga15      out                      XL491g20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACTTCACGGTGTTTATGATCAAGTACTTAATGACCATGATCGTGGGCATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGAGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACGTGGGGCAACACCTACTGGACTTAAAGGGACTTTTCATTTTACTGCTACTCACGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGttttttttttCCTTTGAATCCTGAANCACTACANCTGCTAAACTACAACTCCCAGGATGTTGC
  5   1   2       bld DMZ                                  xl313k20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTCACGGTGTTTATGATCAAGTACTTAATGACCATGATCGTGGGCATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGAGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACGTGGGGCAACACCTACTGGACTTAAAGGGACTTTTCATTTTACTGCTACTCACGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGttttttttttCCTTTGTATCCNGTAGCACTACAGCTGCTAAACTACAACTCCCAGGATGTTGCTCAACAAGTGCAGGGTTCACGTTGCTCANCTGATCGTTGTTGGTTAGTTAGTTAAGTGGGGCCGGTTTTACACAGATACAGTANCAGGGAANANAGGACTAAAGAANAAATGTGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCGCTTGCATTATGTCTCACAGCAGGAGATAAAGGAACACTAATCCCAAAAGCCGATAACATTGCGAGCAAGC
  5   1   2       bld Ga18      out                     xlk136e03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGACTATGATCGTGGGAATCACCTCCAGCTTTTGGATCTGGTCGGGCAAAACCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGGGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACACCTACTGGAGATCTAGGGACACTTGttttttctttttACTGCTACTAAACTTGCCTGGGGACATTCCTCCTCTTAATGCACATTATTTCTAGTAGCCATGGAACAAGGCTTCTATATGAAGAGCTTGGGCTGACCCAGTCTGGGCAATAGGGTTACTAGCAGCAAGTGCTTTGGATCTGATGGGCAGGACTTGGCATCATTCAAAACAAATGTTTTTTATTTCCTTTGTCCTTTATGGTTACATATCCTGTAGCACCACCGCTGCTCAACTACAGCTCTCAGCATCATCCAAGGAAGCTGGGGGTTGTTACTCAACAACTGGAGGCCTCAGGTCGGAGAACTGATAGTTGGTGGNTAATTGGGGGCCAGTGCAAGGGTACATACAGCAGGGAANCCAGGAGTAAAGTAGNNNGTGCCTGAATATGTTAATGTATAACTATGCCATCTGTCATTCATTCCCCCTCTTGCATTATGTCTCACAGCAGGAGANCTAGAGCTGCTAAACCTACAACATTCCAAGCAAACCCACAAATGTGTGTGTATATGTACAGTAAATGTCTTCATACAAACGCAGATAGTGTAGNNTCTCAACACAAGTACATNGNTTCTTTNNCTCTGTNNA
  5   1   2       bld Ga15                               XL499j24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCTACAGTCCTGGCGCAGGTTCTACCACAGACTGAGCAATGGCAGCAAAGGGGAGACTGCGGTGTGAACGTGGGGCAACACCTACTGGACTTAAAGGGACTTTTCATTTTACTGCTACTCACGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGttttttttttCCTTTGNATCCTGTANCACTACAGCTGCTAAACTACAACTCCCAGGATGTTGCTCAACAAGTGCAGGGTTCACGTTGCTCACCTGATCGTTGTTGGTTAGTTAGTTAAGNGGGGCCGGTTTTACACAAATACAGTACCAGGGAAAANAGGACTaaaaaaaaaaTGNGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCNCTTGCATTATGTCTCACANCAGGAAATAAAGGACCACTAATCCCAAAAGCCNATAACATTCCAAGCAANCTCACAAATGTGTGTATACATGTAAATGTCTTCATACAATGGCAAAT
  5   1   2       bld Ga15                               XL496b03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAAGGGGAGACTGCGGTGTGAACGTGGGGCAACACCTACTGGACTTAAAGGGACTTTTCATTTTACTGCTACTCACGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCACACTTGGNATCATTTAAA
  5   1   2       bld Tbd5                            IMAGE:3581726.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTACTGCTACTCAAGTTTGGCTGGGGACATTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGtttttttttCCTTTGTATCCTGTAGCACTACAGCTGCTAAACTACAACTCCCAGGATGTTGCTCAACAAGTGCAGGGTTCACGTTGCTCAGCTGATCGTTGTTAGTTAGTTAAGTGGGGCCGGTTTTACACAGATACAGTAGCAGGGAAGAGAGGACTAAAGAAGAAATGTGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCGCTTGCATTATGTCTCACAGCAG
  5   1   2       bld Ga18      in                        xlk3k10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGGCTGGNNNNNTCATGGAAAGCCCTCTCAATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGNCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGtttttttttCCTTTGTATCCTGTAGCACTACAGCTGCTAAACTACAACTCCCAGGATGTTGCTCAACAAGTGCAGGGTTCACGTTGCTCAGCTGATCGTTGTTGGTTAGTTAGTTAAGTGGGGCCGGTTTTACACAGATACAGTAGCAGGGAAGAGAGGACTAAAGAAGAAATGTGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCGCTTGCATTATGTCTCACAGCAGGAGATAAAGGAACACTAATCCCAAAAGCCGATAACATTCCGAGCAAGCTCACAAATGTGTGTATACATGTAAATGTCTTCATACAATGGCAGATAGCATGGTATCTCACAACGCAAGCACATGAACTCTTTGTCTCCCTGCAATGTATTATTCTGTTATCCCTTTATTTGCTTTTTAGACTTTTCATACAGGAAGNCTGATAAGGGCNACAAATACTTCCCTCCATGATCACATCTGCCTTCTAATGCATTTTCTTCCAGCTCAGGTTTCTGTGAGTGTATATGCACATTTGTGTTTNCTACANNTCTCTCACTGACTTGTATTTAGCGCTCTCAGNCCTTTGNTTNGCTTNNAGTGACTA
  5   1   2       bld Ga12                                 XL202n04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGGGGACATTCATGGAAAGCCCTCTCATGCACATTATTTCTAGCCATCAAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGtttttttttCCTTTGTATCCTGTAGCACTACAGCTGCTAAACTACAACTCCCAGGATGTTGCTCAACAAGTGCAGGGTTCACGTTGCTCAGCTGATCGTTGTTAGTTAGTTAAGTGGGGCCGGTTTTACACAGATACAGTAGCAGGGAAGAGAGGACTAAAGAAGAAATGTGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCGCTTGCATTATGTCTCACAGCAGGAGATAAAGGAACACTAATCCCAAAAGCCGATAACATTCCGAGCAAGCTCACAAATGTGTGTGTATACATGTAAATGTCTTCATACAATGGCAGATAGCATGGTATCTCACAACGCAAGCACATGAACTCTTTGTCTCCCTGCAATGTATTATTCTGTTATCCCTTTATTTGCTTTTTAGACTTTTCATACAGGAAGTCTGATAAGGGCAACAAATACTTCCCTCCATGATCACATCTGCCTTCTAATGCATTTTCTTCCAGCT
  5   1   2       bld Ga15                               XL485f21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACTATTCTTCCAAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACGAGCTGCAAGTGGGTTGGATTTGATGGGGAGGGTGTTCTGCAGACTTGGCATCATTTAAAGCAAATGttttttttttCCTTTGTATCCTGNAGCACTACAGCTGCTAAACTACAACTCCCAGGATGTTGCTCAACAAGTGCAGGGTTCACGTTGCTCANCTGATCGTTGTTGGTTAGTTAGTTAAGNGGGGCCGGTTTTACACANATACAGTAGCAGGGAANANAGGACTAAANAAAAAATGTGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCGCTTGCATTATGTCTCACAGCAGGAGATAAAGGAACACTAATCCCAAAAGCCGATAACATTCCNAGCAAGCTCACAAATGNGTGTATACATGTAAATGTCTTCATACAATGGCANATAGCATGGNATCTCACAACNCAAGCACATGAACTCTTTGTCTCCCTGCAATGNATTATTCTGTTATCCCTTTATTTGCTTTTTAAACTTTTCATACAGGAANTCTGATAAGGGCAACAAATACTTCCCTCCATGATCACATCTGCCTTCNAATGCATTTTCTTCCACCTCAGGTTTCT
  5   1   2       bld Tbd3                            IMAGE:3548553.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTAAGTGGGGGCCGGTTTTACACAGATACAGTAGCAGGGAAGAGAGGACTAAAGAAGAAATGTGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCGCTTGCATTATGTCTCACAGCAGGAGATAAAGGAACACTAATCCCAAAAGCCGATAACATTCCGAGCAAGCTCACAAATGTGTGTATACATGTAAATGTCTTCATACAATGGCAGATAACATGGTATCTCACAACGCAAGCACATGAACTCTTTGTCTCCCTGCAATGTATTATTCTGTTATCCCTTTATTTGCTTTTTAGACTTTTCATACAGGAAGTCTGATAAGGGCAACAAATACTTCCCTCCATGATCACATCTGCCTTCTAATGCATTTTCTTCCAGCTCAGGTTTCTGTGAGTGTATATGCACATTTGTGTTTGCTACAGCTCTCTCACTGACTTGTATTTAGCGCTCTCAGCCCTTTGTTTGGCTTGCAGTGACTATCACATTGCCTGAGAAATGGATTGATATTAGCAGTGATAGGGGTGCCACATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTGCTCAGCTGCTAGGCT
  5   1   2       bld DMZ                                  xl333a19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGCCGGTTTTACACAGATACAGTAGCAGGGAAGAGAGGACTAAAGAAGAAATGTGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCGCTTGCATTATGTCTCACAGCAGGAGATAAAGGAACACTAATCCCAAAAGCCGATAACATTGCGAGCAAGCTCNCAAANGTGTGTATACATGTAAATGTCTTCATACAANGGCAGATAGCATGGTATCTCACAACGCAAGNACATGAACNCTTTGTCTCCCTGCAATGTATTATTCTGTTATCCCTTTATTTGCTTTTTAGACTTTTCATACAGG
  5   1   2       bld DMZ       ?                          xl324i13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTAAAGAAGAAATGTGGCTTAATATGTAACTTTGGCATCTGTTATTCATTGCCCCGCTTGCATTATGTCTCACAGCAGGAGATAAAGGAACACTAATCCCAAAAGCCGATAACATTCCGAGCAAGCTCACAAATGTGTGTGTATACATGTAAATGTCTTCATACAATGGCAGATAGCATGGTATCTCACAACGCAAGCACATGAACTCTTTGTCTCCCTGCAATGTATTATTCTGTTATCCCTTTATTTGCTTTTTAGACTTTTCATACAGGAAGTCTGATAAGGGCAACAAATACTTCCCTCCATGATCACATCTGCCTTCTAATGCATTTTCTTCCAGCTCAGGTTTCTGTGAGTGTATATGCACATTTGTGTTTGCTACAGCTCTCTCACTGACTTGTATTTAGCGCTCTCAGCCCTTTGTTTGGCTTGCAGTGACTATCACATTGCCTGAGAAATGGATTGATATTAGCAGTGATAGGGGTGCCACATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTGCTCAGCTGCTAGGCTTAGGGATGTTTCGTGTTTACCTAACAGATCAAGGCTTGTGGATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGAC
  5  -1   2       bld Ooc3      out                   IMAGE:3436920.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAGGAAGTCTGATAAGGGCAACAAATACTTCCCTCCATGATCACATCTGCCTTATAATGCATTTTCTTCCAGCTCAGGTTTCTGTGAGTGTATATGCACATTTGTGTTTGCTACAGCTCTCTCACTGACTTGTATTTAGCGCTCTCAGCCCTTTGTTTGGCTTGCAGTGACTATCACATTGCCTGAGAAATGGATTGATATTAGCAGTGATAGGGGTGCCACATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTGCTCAGCTGCTAGGCTTAGGGATGTTTCGTGTTTACCTAACAGATCAAGGCTTGTGGATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCA
  5   1   2       bld Tbd7                                 XL070i20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGACTTGTATTTAGCGCTCTCAGCCCTTTGTTTGGCTTGCAGTGACTATCACATTGCCTGAGAAATGGATTGATATTAGCAGTGATAGGGGTGCCACATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTGCTCAGCTGCTAGGCTTAGGGATGTTTCGTGTTTACCTAACAGATCAAGGCTTGTGGATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCTTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGccccccccccttccttcccctttttctccattccaaattttttttttAACATTAGCATTATTGATCAGCTA
  5   1   2       bld Ga12                                 XL205n24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTAGCGCTCTCAGCCCTTTGTTTGGCTTGCAGTGACTATCACATTGCCTGAGAAATGGATTGATATTAGCAGTGATAGGGGTGCCACATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTGCTCAGCTGCTAGGCTTAGGGATGTTTCGTGTTTACCTAACAGATCAAGGCTTGTGGATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCTTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGccccccccccttccttcccctttttctccattccaaattttttttttAACATTANCATTATTGATCAGCTATTCTTTGGGGAATTAAG
  5   1   2       bld Emb1                            IMAGE:6630708.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACATTGCCTGAGAAATGGATTGATATTAGCAGTGATAGGGGTGCCACATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTGCTCAGCTGCTAGGCTTAGGGATGTTTCGTGTTTACCTAACAGATCAAGGCTTGTGGATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGccccccccccttccttcccctttttctccattccaaattttttttttAACATTAGCATTATTGATCAGCTATTCTTTGTGGAATTAAGGTGTTGACACTTGTTAACTGGGTCCAGCAGTGAAGAGGTTTTAGCCTTCCTTTATAAGANATATTTCTCAGATACTGTATTTAATCAATTTGTGCCTGTATAGCCAGCGGCTTGTTGGTCCGTGCCTGCAAATGTATCCTATAATGCAGTGTTGGAAAATTCTTTTGGTATGAAAGATAGCAGATTTCATTCAGTTTTCAATTTCATGTTTATTCTCACATTAAATGCATAATACCGAGTTGATCTGCTAAATAAACCTCATGCCTTCCCCCCAATGTGTTGTATAATATTAGGAGGGTGATATGCATAGCCATTTTCTTTGGCAGATCAACTCCATCCTGACCAATTGCTATAGTGGAAGGGGAA
  5   1   2       bld Ga18      in                      xlk133j16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAGAAATGGATTGATATTAGCAGTGATAGGGGTGCCACATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTGCTCAGCTGCTAGGNTTAGGGATGTTTCGTGTTTACCTAACAGATCAAGGCTTGTGGATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGccccccccccccNT
  5   1   2       bld Ga12                                 XL197e05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGTAACATTCCTGCATCTGTCATTTGCTCAGCTGCTAGGCTTAGGGATGTTTCGTGTTTACCTAACAGATCAAGGCTTGTGGATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATANGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGccccccccccttccttcccctttttctccattccaaattttttttttAACATTANCATTATTGATCAGCTATTCTTTGNGGAATTAAGGNGTTGACNCTTGTTAACTGGGNCCANCAGTGAAAAGGTTTTANCCTTCCTTTATAAAAAATATTTCTCANATACTGTATTTAATCAATTTGTGCCTGT
  5   1   2       bld Ga18      in                      xlk135i09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCATCTGTCATTTGCTCAGNTGCTNNNNTAGGGATGTTTCGTGTTTACCTAACAGATCAAGGCTTGTGGATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGcccccccccccNT
  5   1   2       bld Egg3                            IMAGE:6322966.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGGGGATAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGccccccccccccttccttcccctttttctccattccaaattttttttttAACATTAGCATTATTGATCAGCTATTCTTTGTGGAATTAAGGTGTTGACACTTGTTAACTGGGTCCAGCAGTGAAGAGGTTTTAGCCTTCCTTTATAAGAAATATTTCTCAGATACTGTATTTAATCAATTTGTGCCTGTATAGCCAGCGGCTTGTTGGTCCGTGCCTGCAAATGTATCCTATAATGCAGTGTTGGAAAATTCTTTTGGTATGAAAGATAGCAGATTTCATTCAGTTTTCAATTTCATGTTTATTCTCACATTAAATGCATAATACCGAGTTGATCTGCTAAATAAAACCTCATGCCTTCCCCCAATTGTGTTGTATAATATTAGGAGGTTGATATGCATAGCCATTTCTTTGGCAGATCAACTCCATCTGAACAATTGCTATAGTGAAGGGAATTTTGGCATACAAGTTGCttttttttttttttttttAAATGAACCCCTAATATGTTTGTCTGCACAACCCATCAAGTGGCGtttttttctgaaaggcttttcttttttGTGGATGGGGGGAAAGTTGC
  5   1   2       bld Egg1                               PBX0022D07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACGAGGGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTTTTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGccccccccccttccttcccctttttctccattccaaattttttttttAACATTAGCATTATTGATCAGCTATTCTTTGTGGAATTAAGGTGTTGACACTTGTTAACTGGGTCCAGCAGTGAAGAGGTTTTAGCCTTCCTTTATAAGAAATATTTCTCAGATACTGTATTTAATCAATTTGTGCCTGTATAGC
  5   1   2       bld Tbd7                                 XL055d14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTTCTTCTGAATAGGGCTTCACCTAACCAACAGCTGGGCAAATAATGCCTTTTGCTTGAGACTGGCCCCCACTGTTATGTCAACAAGGCATCATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGccccccccccttccttcccctttttctccattccaaattttttttttAACATTAGCATTATTGATCAGCT
  5   1   2       bld Egg1                               PBX0134A04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCATACAATATATTTTAATTCCGTATCTCCCAAGTGTTAATGCAGACAAACTTTCCCCTATACATTTTATTTTTGGAGTATTTGCACTGCAGTGGGTATGACCTTGCTGGGAAACTGTGTTATGCCCAAGccccccccccttccttcccctttttctccattccaaattttttttttAACATTAGCATTATTGATCAGCTATTCTTTGTGGAATTAAGGTGTTGACACTTGTTAACTGGGTCCAGCAGTGAAGAGGTTTTAGCCTTCCTTTATAAGAAATATTTCTCAGATACTGTATTTAATCAATTTGTGCCTGTATAGCCAGCGGCTTGTTGGTCCGTGCCTGCAAATGTATCCTATAATGCAGTGTTGGAAAATTCTTTTGGTATGAAAGATAGCAGATTTCATTCAGTTTTCAATTTCATGTTTATTCTCACATTAAATGCATAATACCGAGTTGATCTGCTAAATAAAACCTCATGCCTTCCCCCAATTGTGTTGTATAATATTAGGAGGTTGATATGCATAGCCATTTCTT
  5   1   2       bld Egg1                               PBX0064H07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGGTTATGCCCAAGcccccccccccccttccttcccctttttctccattccaaattttttttttAACATTAGCATTATTGATCAGCTATTCTTTGTGGAATTAAGGTGTTGACACTTAACTGGGTCCAGCAGTGAAGAGGTTTTAGCCTTCCTTTATAAGAAATATTTCTCAGATACTGTATTTAATCAATTTGTGCCTGTATAGCCAGCGGCTTGTTGGTCCGTGCCTGCAAATGTATCCTATAATGCAGTGTTGGAAAATTCTTTTGGTATGAAAGATAGCAGATTTCATTCAGTTTTCAATTTCATGTTTATTCTCACATTAAATGCATAATACCGAGTTGATCTGCTAAATAAAACCTCATGCCTTCCCCCAATTGTGTTGTATAATATTAGGAGGTTGATATGCATAGCCATTTCTTTGGCAGATCAACTCCATCTGAACAATTGCTATAGTGAAGGGAATTTTGGCATACAAGTTGCtttttttttttttttttAAATGAGCCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCT
  5   1   2       bld Ga15      in                       XL431m20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAACATTAGCATTATTGATCAGCTATTCTTTGTGGAATTAAGGTGTTGACACTTGTTAACTGGGTCCAGCAGTGAAGAGGTTTTAGCCTTCCTTTATAAGAAATATTTCTCAGATACTGTATTTAATCAATTTGTGCCTGTATAGCCAGCGGCTTGTTGGTCCGTGCCTGCAAATGTATCCTATAATGCAGTGTTGGAAAATTCTTTTGGTATGAAAGATAGCAGATTTCATTCAGTTTTCAATTTCATGTTTATTCTCACATTAAATGCATAATACCGAGTTGATCTGCTAAATAAAACCTCATGCCTTCCCCCAATTGTGTTGTATAATATTAGGAGGTTGATATGCATAGCCATTTCTTTGGCAGATCAACTCCATCTGAACAATTGCTATAGTGAAGGGAATTTTGGCATACAAGTTGCttttttttttttttttttAAAAGGAC
  5   1   2       bld Ga18      in                      xlk127j05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTATTCTTTGTGGAATTAAGGTGTTGACACTTGTTAACTGGGTCCAGCAGTGAAGAGGTTTTAGCCTTCCTTTATAAGAAATATTTCTCAGATACTGTATTTAATCAATTTGTGCCTGTATAGCCAGCGGTTGTTGGTCCGTGCCTGCAAATGTATCCTATAATGCAGTGTTGGAAAATTCTTTTGGTATGAAAGATAGCAGATTTCATTCAGTTTTCAATTTCATGTTTATTCTCACATTAAATGCATAATACCGAGTTGATCTGCTAAATAAAACCTCATGCCTTCCCCCAATTGTGTTGTATAATATTAGGAGGNTGATATGCATAGNCATTTCTTTGGCAGATCAACTCCATCTGAACAATTGCTATAGTGAAGGGAATTTTGGCATACAAGTTGCttttttttttttttttttAAATGAGCCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAAACTTCCAGGNNTCTTGGNAATTNCTGCATAAAATGTATTTTTTAAAGNCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGNTTATATATTTTTTGNATATAACTGTACTATTTTGNACGANGATNNNNATATGTATTTNTGTTTCTACTTTTTGNCANNGAAAAGACAGCCTCNCTTNNNC
  5   1   2       bld Ga15      in                       XL402l04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGTTGACACTTGATTAACTGGGTCCAGCAGATGAAGAGGTTTTAGCCTTCCTTTATAAGAAATATTTCTCNNATACTGTATTTAATCANTTTGTGCCTGTATAGCCAGCGGCTTGTTGGTCCGNGCCTGCNAATGTATCCTATAATGCAGNGTTGGAAAATTCTTTTGGTATGAAAGATAGCAGATTTCATTCAGTTTTCAATTTCATGTNTATTCTCACATTAAATGCATAATACCGAGGTTGATCTGCTAAATAAAACCTCATGCCTTCCCCCAATTGTGTTGTATAATATTAGGAGGTTGATATGCATAGCCATTTCTTTGGCAGATCAACTCCATCTGAACNATTGCTATAGNGAAGGGAATTTTGGCATACNAGTTGCtttttttttttttttANA
  5   1   2       add Ga18      in                       xlk76b21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCGTTGNTGGCCGTGCCTGCAAATGTATCCTATAATGCAGTGTTGGAAAATTCTTTTGGTATGAAANATAGCAGATTTCATTCAGTTTTCNATTTCATGTTTATTCTCACATTAAATGCATAATACCGAGNTGATCTGCTAAATAAAACCTCATGCCTTCCCCCAATTGTGTTGTATAATATTAGGAGGTTGATATGCATNGNCATTTCTTTGGNNGATCAACTCNATCTGAACAATTGCTATAGTGAAGGGAATTTTGGCATACANGTTGCttttttttttttttttttAAATGAGCCCTANT
  5   1   2       bld Gas7                   IMAGE:3751490-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCTTGTTGGTCCGTGCCTGCAAATGTATCCTATAATGCAGTGTTGGAAAATTCTTTTGGTATGAAAGATAGCAGATTTCATTCAGTTTTCAATTTCATGTTTATTCTCACATTAAATGCATAATACCGAGTTGATCTGCTAAATAAAACCTCATGCCTTCCCCCAATTGTGTTGTATAATATTAGGAGGTTGATATGCATAGCCATTTCTTTGCCAGATCAACTCCATCTGAACAATTGCTATAGTGAAGGGAATTTTGGCATACAAGTTGCttttttttttttttttttAAATGAGCCCTAATATGTTGTCTGCACCACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGAGGGGAAAAGTGACCACAAAAAACTTCCAGGGATCTGGGAAATTGCTGCATAAAG
  5   1   2       e50                              Xl3.1-xlk133j16ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTTTTTTTTTTTTTTTTTAAATGAGCCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGACAGCCTCATTTNTCTTGTGT
                                                  Xl3.1-CHK-1012690473                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTTTTTTTTTTTTTAAANGAGCCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGANA
  3   1   2       bld Ga18      in                      xlk133j16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTGGTNNGAAANAAANNAGANTTCATTCAGTTTTNAATTTCATGTTTATTNTNNCATNAAANGNATAANNNNGAGNNGNNCTGCTAAATAAANCNNATGCCTTCCCCCAANTGTGTTGTATAATATTAGGAGGNNGANNNNNANAGNCANTTCTTTGGCAGATNAACTCCATCNGAACAATTGCNATAGTGAAGGGAANTNTGGCATACAANTTNNTTTNTTTTTTTTTTTTTTTTTTTTTTTTAAANGAGNCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGANACCTCNCTTTNTCTTGTGTACNGT
  3   1   2       bld Ga18                              rxlk66c23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGNANAATATTAGGAGGTTNATANGNNNANCCATTTCTTTGGCANNNNNNCTCCANNTGAACAATTGCNANAGNGAAGGGAANTNTGGNATTTNNTTTTTTTTTTTTTTTTTTTTTTTNANTGAGCCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGANNNNNCACTTTNTCTTGTGTACNGTCAC
  3   1   2       bld Ga15                               XL413j03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCNTTTTTTGGNNGNNCNNCCCCCTTTGNNCNANTGNTNTAGGGNNGGGNANTTNGGCNNNCNAGGNGNNTTTTTTTTTTTTTTTTNATTATTTAAATGAGCCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTnCTATTTnGTACGAAGATATATATATGTATTTATGnTTCTNCTTTTTGACAAATGAAAAGACAGCCTCACTT
  3   1   2      seed Ga18      in                      xlk112j08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CNATAGNGAAGGGAATTTTGGCNTNNNNNTTTTTTTTTTTTTTTTTTTTTNNATNATTNAAATGAGCCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGANACCTCNCTNTNNCT
  3   1   2       bld Ga18      in                        xlk3k10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGGGANNNNNGGCANNCAATTTTTTTTTTTTTTTTTTTTTTTTTTAAANGAGNCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGANACCTCNCTTTNNCTTGNG
  3   1   2       bld Ga18      in                      xlk135i09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTNNTTTTTTTTTTTTNTTNNNNNNAANNGANCCCNNNTNTGTTGTCTGCACAACCCATNAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGANACCTCACTTTNTCTTGNGTA
  3   1   2       bld Ga12      in                         XL219n03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTTTTTTTNNACTAAATAAATGAGCCNTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGNCCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTnnGTnCGAAGATATATATATGTATTnANG
  3   1   2       bld Ga18      in                      xlk130f13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTTTTTTTTTTTTTTTTAAANGANNCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGACANCTCNCTTTNTCTTGNGTA
  3   1   2       bld Ga18                               rxlk3j08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTTTTTTTTTTTTTTTTAAAANANNNNNAATATGTTGTCTGCACAACCCATNAAGNGNGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGANNNNTCACTTNNCTTG
  3   1   2       bld Ga18                              rxlk64g14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTTTTTTTTTTTTTTTTTAANNNANNNCNAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGACACCTCANTTNNCTNGNGNA
  3   1   2       bld Ga18      in                      xlk109n14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTTTTTTTTTTTTTTTAAANNANCCCTAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGANACCNCNNNNNTCTNGNG
  3   1   2       add Ga15      in                       XL402l04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GNGNTTTTTTTTTTTTTTTNCAAANGAGCCCNAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTNTGNAGGCTTTCTTTTTGCGATGGGGAAAGNGTCCACANAAAACTTCCAGGGATCTNGGCAATTGCCGCATAAAATGTATTTTTTAAAGTCNGATNCTATGTACGAAANTAAAGATTATTCTAATANAATTNTTGTGCATGTCATCATACAGCAAACGAAGANTGCACTCTGTTCTATATATNT
  3   1   2       add Ga18                             rxlk136i09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTTTTTTTTTTTTTTTNAAANGANNCNNAATATGTTGTCTGCACAACCCATNAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGNGNCCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAANTTTTGTGCATGNCATCATACAGCAAATGAAGNCTACATTGTTTATATATTTTTTGTATATAnCTGTACTATTTTGTnCGAAGATATATATATGTATNTATGTTTCTACTTTTTNNNNNNNGAA
  3   1   2       add Ga15      out                      XL403l04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGNTTTTTTTTTTTTTNTCAAATGAGCCCNAATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCNGNAGGCTTTCTTTTTGNGATGGGGAAAGNGNCCACANAAAACTTCCAGGGATCTNGGCAATNGCCGCATAAAATGTATTTNTTNAAGTCCGATGCTATGTACGAAANTAAAGANTATTCNANTANAATTTTTGTGCATGTCATCATACAGCNA
  3   1   2       add Ga18      in                       xlk76b21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TNTTNTATTNNNANNGANCCCTNNTNTGTTGTCTGCACAACCCNTNAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTNTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCNGCATAAAATGTATTTTTNAAAGTCAGATNCTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGNCNNCANACAGCAAATGAAGACTACATTGTTTATATATTTTTTGNANATAACTGTACTATTTTGTACGAAGATANATANATGTATTTATGTTTCTACTTTNTGACAAATGAAAAGANACCTCNCTNTATCTTGNG
  3   1   2       bld Ga18      in                      xlk127j05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATATGTTGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGANACCTCNCTTTNTCTTGNG
  3   1   2       bld Ga18                               rxlk3l12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTCTGCACAACCCATCAAGTGCGTTTTTTCTGAAGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATANGNANNTATGTTTCTACTTTTTGACAAATGAAAAGACANCTCNNTNNTCT
  3  -1   2       bld Ga15      in                       XL431m20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TNCTGANGGCTTTCTTTTTGTGATGGGGAAAGTGACCACAAAAAACTTCCAGGGATCTTGGCAATTGCTGCATAAAATGTATTTTTTAAAGTCAGATACTATGTATGAAATTAAAGATTATTTTAATAAAATTTTTGTGCATGTCATCATACAGCAAATGAAGACTACATTGTTTATATATTTTTTGTATATAACTGTACTATTTTGTACGAAGATATATATATGTATTTATGTTTCTACTTTTTGACAAATGAAAAGACAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTAGGTAAAAAAAAAAAACCnAAAAAAACCAAAAAAAAAAAAAAGGGGGGGNCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)