Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl287n02.3                           19 END     1           3        5                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL504h24ex.5.5                       18 PI      85         17     1351                forkhead box I1 [Xenopus tropicalis]
     3   0.0    0Xl3.1-IMAGE:4682602-IMAGp.5                 6 PI      78        392      676                forkhead box I1 [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012837809 Xl3.1-IMAGE:3402349-IMAGp.5.5 - 27 ESTs
                                                                       ...-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580
 ?   ?   ?    ?    ?     ?    ?   ? 
                                         Xl3.1-IMAGE:3402349-IMAGp.5.5                                                                                                                                                                                                                                                                                                                                                        AGAAGCCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCACCCAGTTACAGCCCTACCCCTGCCCCTTACATACCCCCTGCCTTCAGCGCCCCCCAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGTGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATCTGAGACCAACAACATTAAAATCGCTAAGAGGGAAGAGGATCACGTGAGCCCAAAAGGCAAAGAAAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCTGTCTCCCACAGGCCATAGCAAGTGCCCATCTCCCCCAACTGTCACCTACACCCCCTGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTATCTCAGAGGAACCTCAATGGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTCTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCCTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAATTTCCCCTTGCAAGTTGGGGGAGAAAACATGAGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAGGGACATCTGTAGCAAGGAGATTTTTTTCTTCTTCAAATGGGTGGCTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGGTGTGACTTGCGC
                                                  Xl3.1-CHK-1012722299                                                                                                                                                                                                                                                                                                                                                              CGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCACCCAGTTACAGCCCTACCCCTGCCCCTTACATACCCCCTGCCTTCAGCGCCCCCCAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGTGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATCTGAGACCAACAACATTAAAATCGCTAAGAGGGAAGAGGATCACGTGAGCCCAAAAGGCAAAGAAAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCTGTCTCCCACAGGCCATAGCAAGTGCCCATCTCCCCCAACTGTCACCTACACCCCCTGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTATCTCAGAGGAACCTCAATGGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTCTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCCTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAATTTCCCCTTGCAAGTTGGGGGAGAAAACATGAGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAGGGACATCTGTAGCAAGGAGATTTTTTTCTTCTTCAAATGGGTGGCTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGGTGTGACxxxxGCGCATCA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                            11    14    13    14    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    16    14    16    14    16    14    16    14    16    14    16    14    16    15    16    14    16    14    16    14    16    14    16    14    16    14    16    14    16    14    16    15    16    14    16    14    16    14    16    14    16    14    16    15    16    13    16    13    16    11    17    14    17    13    17    13    17    13    16    12    16    14    16    12    15    13    15    13    15    13    15    14    15     9    12     8    11     7     8     6     7     6     7     4     6     4     6     4     6     4     6     4     6     3     6     3     6     3     8     3     8     4     8     4     8     5     9     9    12     8    10     8    10     7     9     7     8     7     7     7     8     8     9     8     9     8     9     8     9     9     9     8     9     8     9     9     9     8     9     8    10     9    10    10    10    10    10     8    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     8     9     7     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     6    10     6    10     6    10     6    10     5    10     5    10     5    10     4     9     4     9     3     8
  5   1   2      ests                      Xl3.1-IMAGE:3402349-IMAGp.5                                                                                                                                                                                                                                                                                                                                                        AGAAGCCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCACCCAGTTACAGCCCTACCCCTGCCCCTTACATACCCCCTGCCTTCAGCGCCCCCCAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGTGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATCTGAGACCAACAACATTAAAATCGCTAAGAGGGAAGAGGATCACGTGAGCCCAAAAGGCAAAGAAAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCTGTCTCCCACAGGCCCATAGCAAGTGCCCATCTCCCCCCACTGTCACCTACACCCCCTGTCTAGTCTAACCCAACGCAGCATGACTG
  5   1   2      ests                                 Xl3.1-xl319d23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTGCCCATCTCCCCCAACTGTCACCTACACCCCCTGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTATCTCAGAGGAACCTCAATGGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTCTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCCTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAATTTCCCCTTGCAAGTTGGGGGAGAAAACATGAGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAGGGACATCTGTAGCAAGGAGATTTTTTTCTTCTTCAAATGGGTGGCTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGGTGTGAC
  5   1   2      ests                                 Xl3.1-xl274a06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTGTCTCAGAGGAACCTCAATGGCTTGAGCAGCTTCATCTCAGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTCTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCGTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAACTTCCCCTTGCAAGTTGGGGGAGAAAACATGGGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAAGAAGATTTTTTTTTCCTTCAGATGGGTGGTTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGTTGTGACTTGCGCATCACCCGGTTCTGTATTTATAACTGTATTTAATAAAGAAAAGAAAACCAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATTTTTTTTTCCTTCAGATGGGTGGTTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAGACAAAAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------G----
                                               BLH ATG      17    1045                                                                                                                                                                                                                                                                                                                                                        
                                               BLH MIN      17     143                                                                                                                                                                                                                                                                                                                                                        
                                               BLH OVR      17     135                                                                                                                                                                                                                                                                                                                                                        
                                               EST CLI      -8      76                                                                                                                                                                                                                                                                                                                                                        
                                               ORF LNG      17       9                                                                                                                                                                                                                                                                                                                                                        
                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 9e-032     NP_496411.1 UNCoordinated locomotion UNC-130, forkhead box D1 (37.3 kD) (unc-130)[Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 2e-034     NP_524202.1 crocodile CG5069-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ag ---- 1e-035     XP_314703.4 AGAP008606-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 7e-048     XP_001181648.1 PREDICTED: similar to forkhead transcription factor I [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 7e-059     NP_001071713.1 transcription factor protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Mm ---- 8e-075     NP_076396.2 forkhead box I1; forkhead homolog 10 (Drosophila) [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Hs ---- 1e-077     NP_036320.2 forkhead box I1 isoform a; forkhead (Drosophila)-like 10; Forkhead, drosophila,homolog-like 10; forkhead-related activator 6; hepatocyte nuclear factor 3forkhead homolog 3; HNF-3/fork-head homolog-3 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Bt ---- 5e-078     XP_587178.2 PREDICTED: similar to forkhead box I1 isoform 1 [Bos taurus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Cf ---- 2e-079     XP_546245.2 PREDICTED: similar to forkhead box I1 isoform a isoform 1 [Canis familiaris] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Gg ==== 9e-084     XP_425185.1 PREDICTED: similar to Hypothetical protein MGC75815 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Dr ---- 1e-098     XP_001918833.1 PREDICTED: hypothetical protein [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 0          CAJ81516.1 forkhead box I1 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 0          NP_001081617.1 fork head protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                         Xl3.1-IMAGE:3402349-IMAGp.5.5                                                                                                                                                                                                                                                                                                                                                                         ATG---------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------ATG------ATG------------------------------------------------------TGA---------------------------------------TGA---------------TAG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2      ests                      Xl3.1-IMAGE:3402349-IMAGp.5                                                                                                                                                                                                                                                                                                                                                        AGAAGCCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCACCCAGTTACAGCCCTACCCCTGCCCCTTACATACCCCCTGCCTTCAGCGCCCCCCAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGTGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATCTGAGACCAACAACATTAAAATCGCTAAGAGGGAAGAGGATCACGTGAGCCCAAAAGGCAAAGAAAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCTGTCTCCCACAGGCCCATAGCAAGTGCCCATCTCCCCCCACTGTCACCTACACCCCCTGTCTAGTCTAACCCAACGCAGCATGACTG
                                                  Xl3.1-CHK-1012691117                                                                                                                                                                                                                                                                                                                                                              CGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCACCCAGTTACAGCCCTACCCCTGCCCCTTACATACCCCCTGCCTTCAGCGCCCCCCAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGTGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATCTGAGACCAACAACATTAAAATCGCTAAGAGGGxAxxxGATCACGTGAGCCCAAAAGGCAAAGAAAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCTGTCTCCCACAGGCCxxxxxxAAGTGCCCATCTCCCCCAACTGTCACCTACACCCCCTGTCTAxxCxAxxCxxxxGCAGCATGACTGCCGTGG
  5   1   2       bld Ga15      out                      XL442n18ex.5p                                                                                                                                                                                                                                                                                                                                CACCTTGAAGCTTCAAGGTGCTGCTGGAAAAGATTATGAACTCCATTCACCTTCCATCTCATCAGAGAACTTCAGCATCGAGCCTACACCAGCATCACCCTAAGGGTGCTCAGGAAGCCTCTGAAATGGCAGTTTACTGTGACAATTTCAGCATGTACCACCAGCAAAATCTACACTCTTCTCAGAGGGCACCCAACTACGGGATTGGAGATTATGCGCCCCCTACTAACCCTTACTTGTGGCTTGGAGGTCCTGGAGTGAGCAATTCATCCAGCTATCTGCATGGAAACAACCCTACTTCTTTTATGTCTCCATCCTATGGATCCCAAAGGCAGTTCCTATCAAATTCCTCCAGTTTTTGCGGGACAGATCTGAGTTGGCTTTCTGTAGCATCACAAGAAGAACTTCTCAAAGTGGTGAGGCCTCCATATTCCTACTCAGCTCTAATAGCCATGGCCATACAAAATGCACCGGAGAAGAAGTTAACGCTGAGTCAGATTTACCAGTATGTGGCAGAAAATTTTCCTTTCTACAAGAGAAGTAAAGCAGGGTGGCAGAACTCCATCCGGCACAATCTGTCCCTGAATGACTGCTTTAAGAAGGTCCCAAGAGATGAAGATGATCCAGGTAAGGGGAATTACTGGACTCTGGACCCCAACTGTGAGAAGATGTTTGACAATGGAAACTTCCGCAGAAAGAGAAAGCGC
  5   1   2       bld DMZ  5g3  in                         xl297h01.5p                                                                                                                                                                                                                                                                                                                                            CCTCGTGCCGAATCGGCACGAGGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTcacccagttacagccctacccctgccccttacataccccctgccttcagcgccccccAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGTGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCC
  5   1   2       bld Emb1 5g                IMAGE:3402349-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                              GGGAAAGAGCAGAAGCCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTcacccagttacagccctacccctgccccttacataccccctgccttcagcgccccccAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATCTGAGAACAACAACATTAAAATCGCTAAGAGGGGAAGAGGATCACGTGAGCCCGAAAGGCAAAGAAAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCTGTCTCCCACAGGCCATAGCAAGTGCCCATCTCCCCCAACTGTCACCTACACCCCCTGTCTAACCAACCTTCATTGGGCAGCATGACTGCCGTGGAACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATG
  5   1   2       bld DMZ  5g3  in                         xl264j06.5p                                                                                                                                                                                                                                                                                                                                              GGGAAAGAGCAGAAGCCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTcacccagttacagccctacccctgccccttacataccccctgccttcagcgccccccAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCTGAATGCGACCGACNAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGTGCAAAGCANGCTGGNAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCG
  5   1   2      seed DMZ  5g3  in                         xl264m01.5p                                                                                                                                                                                                                                                                                                                                              GGGAAAGAGCAGAAGCCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTcacccagttacagccctacccctgccccttacataccccctgccttcagcgccccccAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGTGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCC
  5   1   2       bld Emb1 5g3  in                    IMAGE:3402349.5p                                                                                                                                                                                                                                                                                                                                                GAAAGAGCAGAAGCCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCAcccagttacagccctacccctgccccttacataccccctgccttcagcgccccccAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTNCCTTTCTACAAGAAGAGCANAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTNCAAGAAGATGCCAAGGGATGAGAATGATCCANGAANAGGANACTACTGGACTTCTGACTCCAACTGCCGAGAGATGTTTGACAATGGTAATTTTNCGTCTGAAAGAGATAGCCCTAAATCTGAG
  5   1   2       bld Ga18 5g                           xlk111m20ex.5p                                                                                                                                                                                                                                                                                                                                                GAAAGAGCAGAAGNCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCAcccagttacagccctacccctgccccttacataccccctgccttcagcgccccccAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGNAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACNAGAAGTGCNAANNNNNTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGNNNNTTGACAATGNNAATTTCCNCCGGAAGAGAAAGCCCAAATCTGAGACCANNAACATTAAATCCGCTAAGANGNA
  5   1   2       bld DMZ  5g3  in                         xl243d13.5p                                                                                                                                                                                                                                                                                                                                                GAAAGAGCAGAAGCCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCAcccagttacagccctacccctgccccttacataccccctgccttcagcgccccccAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATCTGA
  5   1   2       bld Emb1 5g                         IMAGE:6636396.5p                                                                                                                                                                                                                                                                                                                                                 AAAGAGCAGAAGCCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCACCCAGTTACagccctacccctgccccttacataccccctgccttcagcgccccccAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATTGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATCTGAGACCAACAACATTAAAATCGCTAAGAGGGAAGAAGATCACGTGAGCCCCAAAAGCAAAGAAAGCCCACCCATGATTACTCCCTCCCTCCCCCGAGAGAGCTGTCTCCCACCAGCCATAGCAAGTGCCCCATCTCCCCCAACTGGTCACCTACACCCCCCCTGTCTAACCCAACTTCATTGGCCAACATGAACTGCCGGTGGAACTCAAGC
  5   1   2       bld Emb1 5g                IMAGE:6637080-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                 AAAGAGCAGAAGCCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCACCCAGTTACagccctacccctgccccttacataccccctgccttcagcgccccccAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGTGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATC
  5   1   2       bld Emb1 5g                         IMAGE:6637080.5p                                                                                                                                                                                                                                                                                                                                                  AAGAGCAGAAGCCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCACCCAGTTACagccctacccctgccccttacataccccctgccttcagcgccccccAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGTGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGGAAGAGAAGCCCAAATCTGAGACCAACAACATTAAAATCGCTAAGAGGGGAAGAGGATCACGTGAGCCCAAAAGGCAAAGAAAGCCCACCCATGATTACTCCCTCCTCCCCCGAAGAGCTGTCTCCCCACAGCCATAGCAAGTGCCCATCTCCCCCCACTGTCACCTACACCCCCTGTCTAACCAACTCATTGGCAGCATGACTGCCGTGAACTCACCTACAATGACAGACAGGGCCCCCTGGGGCTTCC
  5   1   2       bld DMZ  5g3  in                         xl319d23.5p                                                                                                                                                                                                                                                                                                                                                   TCGATTCGAGCCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCACCCAGTTACagccctacccctgccccttacataccccctgccttcagcgccccccAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGTGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATCTGAGACCAACAACATTAA
  5   1   2       bld Emb1 5g3  in                    IMAGE:3401358.5p                                                                                                                                                                                                                                                                                                                                                    GAGCAGAAGCCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCACCCAGTTACagccctacccctgccccttacataccccctgccttcagcgccccccAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATTGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAAATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCANGGCTGGCAGAACTNCATCAGGCACAACCTGTCCCTCAATGACTGCTTC
  5   1   2       bld Gas5 5g3  in                    IMAGE:3749436.5p                                                                                                                                                                                                                                                                                                                                                        AGAAGCCGCTGATCAGGATGAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTCACCCAGTTACagccctacccctgccccttacataccccctgccttcagcgccccccAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGANAACTTCCCTTTCTACAAGAAGTGCACAGCAGGCTGGCAGAACTCCATCATGCACAACCTGTACCTCAATGACTGCTTCAAGAAGATGCCAAAGGATGAGAATGATCCAAGAAAA
  5   1   2       bld Emb1                            IMAGE:6862729.5p                                                                                                                                                                                                                                                                                                                                                                           GAACCCGGTGCAACAACCCGCCCAGCACAAGTGTCCGGCCTCCAGTCTGAACCCGCCGCACCCTAAACGCGCCCAGGAGGCTCCGGACATGGGACTTTATTGTGACAACTTCATGTACCAACAGCACAACCTGCACCCCAGCCACAGGGCGACCAACTTCAGCATCGGGGACTTCACCCACCAAGCGAACCCTTACTTATGGCTGGGGGGCCCTGGGGTCAACAACTcacccagttacagccctacccctgccccttacataccccctgccttcagcgccccccAGCGGCAGTTCCTGGCCAACTCTGCAGCCTTTGGTGGAGCCGATCTGGGCTGGATGTCGGCGGCCTCCCAGGAGGAGCTTCTGAAGAGGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCTATGTCCATCCAGAATGCGACCGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGTGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATCTGAGACCAACAACATTAAAATCGCTAAGAGGGAAGAGGATCACGTGAGCCCAAAAGGCAAAGAAAGCCCACCCATGATTACTCCCTCCTCCCCCAAGGAGCTGTCTCCCACAGGCCATAACAAAGTGCCCATCTCCCCCCAACTTGTCACCTTACACCCCCCTGGTCTAAAACAACTTTCATTTGGCAAGCCATGC
  5   1   2       bld Egg5                            IMAGE:3431124.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGACAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATCTGAGACCAACAACATTAAAATCGCTAAGAGGGAAGAGGATCACGTGAGCCCAAAAGGCAAAGAAAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCTGTCTCCCACAGGCCATAGCAAGTGCCCATCTCCCCCAACTGTCACCTACACCCCCTGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTATCTCANAGGAACCTCAATGGCTTGAGCAGCTTCATCTCAGGCTCCACAGTTGATCAGAGCCCTGAGTATCANGACANTAACCTGTTCTATAACAGAANCCCCTACTACAGCTCCTTACCCACCTCTAACCAGAAACAGCCACCCTTCCTTCANCAGCTCCATCCCCAACAGTCTCCTCTATACCAGAGAAAGTAC
  5   1   2      ests                                 Xl3.1-xl319d23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTGCCCATCTCCCCCAACTGTCACCTACACCCCCTGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTATCTCAGAGGAACCTCAATGGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTCTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCCTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAATTTCCCCTTGCAAGTTGGGGGAGAAAACATGAGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAGGGACATCTGTAGCAAGGAGATTTTTTTCTTCTTCAAATGGGTGGCTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGGTGTGAC
                                                  Xl3.1-CHK-1012699221                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATCTCCCCCAACTGTCACCTACACCCCCTGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTATCTCAGAGGAACCTCAATGGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTCTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCCTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAATTTCCCCTTGCAAGTTGGGGGAGAAAACATGAGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAGGGACATCTGTAGCAAGGAGATTTTTTTCTTCTTCAAATGGGTGGCTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGGTGTGACTTGCGC
  5   1   2       bld Ga12      in                         XL173b03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGGATTNTTCCTGTTAACAGCACATGTATCCCTTAATATCTTGGaattaaaaaatatataaatacataaatataaataatGGATGTACATTGCAAAAGTGCTTAGGATAGCCTCCTCATCAATTTTACATTCATTTAATTTAAAGGTTTACTTATCCTTTAAACATAGGAATGGGAGCTGCCATTTTGCTTGCTACCTTTTCTGCATACTATTACCCAATCCACATACGTTCCTGTATTTAAGGTAACTGGAAGGTAGACCCTATGTATGAACGAGTAGGACCAACCCCTGGTTATGTATTTTGACCCTTGGGAGTTCAAGTAGTCAATGAAACAAACGGGCTTTATAAATAGAGTATTTATACGTGtttttttttCCCTCCCTTTCTCTGTAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGTAATTTCCGCCGGAAGAGAAAGCCCAAATCTGAGACCAACAACATTAAAATCGCTAAGAGGGAAGAGGATCACGTGAGCCCAAAAGGCAAAGAAAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCTGTCTCCCACAAGCCATAGCAAGTGCCCATCTCCCCCAACTGTCACCTACACCCCCTGTCTAACCAACTTCATTGGCAGCATGACTGCC
  3   1   2       bld DMZ  5g3  in                         xl297h01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGCCATAGCAAGTGCCCATCTCCCCCCAACTGTCACCTACACCCCCTGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTATCTCAGAGGAACCTCAATGGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTCTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCCTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAATTTCCCCTTGCAAGTTGGGGGAGAAAACATGAGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAGGGACATCTGTAGCAAGGAGATTTTTTTCTTCTTCAAATGGGTGGCTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGGTGTGACTTGCGCATCACATGGTTCTTATTAA
  3   1   2       bld DMZ  5g3  in                         xl319d23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCATAGCAAGTGCCCATCTCCCCCAACTGTCACCTACACCCCCTGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTATCTCAGAGGAACCTCAATGGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTCTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCCTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAATTTCCCCTTGCAAGTTGGGGGAGAAAACATGAGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAGGGACATCTGTAGCAAGGAGATTTTTTTCTTCTTCAAATGGGTGGCTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGGTGTGACTTGCGCATCACCATGGTTCTTATT
  3   1   2      seed DMZ  5g3  in                         xl264m01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTATCTCAGAGGAACCTCAATGGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTCTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCCTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAATTTCCCCTTGCAAGTTGGGGGAGAAAACATGAGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAGGGACATCTGTAGCAAGGAGATTTTTTTCTTCTTCAAATGGGTGGCTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGGTGTGACTTGCGCATCAC
  3   1   2       bld DMZ  5g3  in                         xl264j06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTATCTCAGAGGAACCTCAATGGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTNTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCCTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTNCCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAATTTCCCCTTGCAAGTTGGGGGAGAAAACATGAGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAGGGACATCTGTAGCAAGGAGATTTTTTTCTTCTTCAAATGGGTGGCTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTCTTCATTGTGNAGCGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGGTGTGACNTGCGCATCAC
  3   1   2       bld Ga12      in                         XL173b03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTATCTCAGAGGAACNTCAATGGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTCTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCCTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAATTTCCCCTTGCAAGTTGGGGGAGAAAACATGAGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAGGGACATCTGTAGCAAGGAGATTTTTTTCTTCTTCAAATGGGTGGCTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGGTGNACTTGCGCATCACA
  3   1   2       add Gas5 5g3  in                    IMAGE:3749436.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGAACGTGTAANCTGTAAATATATATATATATATTGTTTGTCATTCATATGGTGTGACTTGCGCATCACATGGTTCTTTATTTATAACTGTATTTAATAAAGAAAAGAAAAACATCAAA
  5   1   2      ests                                 Xl3.1-xl274a06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTGTCTCAGAGGAACCTCAATGGCTTGAGCAGCTTCATCTCAGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTCTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCGTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAACTTCCCCTTGCAAGTTGGGGGAGAAAACATGGGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAAGAAGATTTTTTTTTCCTTCAGATGGGTGGTTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGTTGTGACTTGCGCATCACCCGGTTCTGTATTTATAACTGTATTTAATAAAGAAAAGAAAACCAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012709712                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTGTCTCAGAGGAACCTCAATGGCTTGAGCAGCTTCATCTCAGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTCTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCGTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAACTTCCCCTTGCAAGTTGGGGGAGAAAACATGGGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAAGAAGATTTTTTTTTCCTTCAGATGGGTGGTTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGTTGTGACTTGCGCATCACCCGGTTCTGTATTTATAACTGTATTTAATAAAGAAAAGAAAACCAAAAAAAAAAA
  3   1   2      seed DMZ       out                        xl274a06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTGTCTCAGAGGAACCTCAATGGCTTGAGCAGCTTCATCTCAGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTCTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCGTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAACTTCCCCTTGCAAGTTGGGGGAGAAAACATGGGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAAGAAGATTTTTTTTTCCTTCAGATGGGTGGTTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGTTGTGACTTGCGCGTCACA
  3   1   2       bld DMZ  5g3  in                         xl243d13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGGGCCCCCTGGGGCTTCTCAATGAATTGTCTCAGAGGAACCTCAATGGCTTGAGCAGCTTCATCTCAGGCTCCGCAGTTGATCAGAGCCCTGAGCATCAGGACAGTAGCCTGTTCTATAACAGAAGCCCCTACTACAGCTCCTTGCCCACCTCTAACCAGAAGCAGCCACCGTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAACTTCCCCTTGCAAGTTGGGGGAGAAAACATGGGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAAGAAGATTTTTTTTTCCTTCAGATGGGTGGTTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCAACCTCTGGCTTTATCTTTGTTATAAGACAAAAGAATGAGCATTTTNTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGT
  3   1   1       add Emb1 5g3  in                    IMAGE:3401358.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACCTCCATTGCTTGACACGCTTCTCCTCGGGCTCTCACGTTGACAGAACCCTTGAGCATCAGGACAGTAGCCTGTTCTATTCCAGAAGCCCGTACTACAGCTCCGTTGCCACCTCTATCCAGAAGCCGCCACCGTACCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTACCAGGGAAGGTACTGACGTGTAGTTCTACGTGAGATTTGTAGGAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATTTTAGCAATTTCCCCTTGCAAGTTGGGGGAGAAAACATGGGAGTACTGTGAACTACAAATACTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAAGGAGATTTTTTTTTTCTTCAAATGGGTGGCTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCGCCCTCTGGCTTTATCTCTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTAAATATATATATATATTGTTTGTCATTCATATGGTGTGACTTGCGCGTCACATGGTTCTTTATTTATAACTGTATTTAATAAAGAAAAGAAAAACATCAAAAAAA
  3   1   1       add Emb1 5g3  in                    IMAGE:3402349.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCACCTCTACCCAGAACCAGCCACCCTTCCTTCAGCAGCTCCATCCCCAGCAGTCTCCTCTGTCCCAGGGAAGGTCCTGACGTGTAGTTCTACGTGAGATTAGTAGAAAAAGACTGGGAGTGGACATGACGCTTATGGAGCCCAGAACTGAAATCTTAGCAATTTCCCCTTGCAAGTTGGGGGAGAAAACATGAGAGTACTGTGAACTACAAATACCATCACCCATAGCTGGCTGAGGATGCTGGGAGCTGTAGTTCAGGTTACCAAGGAGATTTTTTTTTCCTTCAGATGGGTGGTTGCCTGAGCATGCTGGGAGTTGTATGTCAACAAGCGATAGAAAGTCGCCCTCTGGCTTTATCTCTGTTATAAGACAAAAGAATGAGCATTTTTTTCATTGTGGACGTGTAAGCTGTAAATATATATATATATTGTTTGTCATTCATATGTTGTGACTTGCGCATCACCCGGTTCTGTATTTATAACTGTATTTAATAAAGAAAAGAAAACCAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)