Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6959198.5.5                    33 PI      90         50     2026                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012837811 Xl3.1-IMAGE:5085118.5.5 - 45 ESTs
                                                                       .......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:5085118.5.5                                                TCTCGCTGGTTCTCCTCTTCTAGCTTCTGCTCGTGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATTACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAAACTGCCAGGGAGTGGTTCCTGAATTCTGCCAAAGATGCATCTGCAGTGGCCAAACATTTTGTTGCCCTGTCCACCAATGCACCTAAAGTTAAAGATTTTGGAATAGACACCGCAAATATGTTTGAATTCTGGGATTGGGTTGGTGGTCGTTACTCTTTGTGGTCAGCCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATAACTTTGAAAAGCTTTTGGCAGGAGCCCACTGGATGGACAATCACTTTTACAAAACTCCACTAGAGAATAATGTCCCTGTAATACTGGCCATGCTGGGTATTTGGTACATCAACTTTTATGGATGTGAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTGCAAACCTGGTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTTGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAATGTCTGTTTACATAATTAAAAAAAAAAAAAATAAA
                                                  Xl3.1-CHK-1012721843                                                      TGGTTCTCCTCTTCTAGCTTCTGCTCGTGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATTACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAAACTGCCAGGGAGTGGTTCCTGAATTCTGCCAAAGATGCATCTGCAGTGGCCAAACATTTTGTTGCCCTGTCCACCAATGCACCTAAAGTTAAAGATTTTGGAATAGACACCGCAAATATGTTTGAATTCTGGGATTGGGTTGGTGGTCGTTACTCTTTGTGGTCAGCCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATAACTTTGAAAAGCTTTTGGCAGGAGCCCACTGGATGGACAATCACTTTTACAAAACTCCACTAGAGAATAATGTCCCTGTAATACTGGCCATGCTGGGTATTTGGTACATCAACTTTTATGGATGTGAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTGCAAACCTGGTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTTGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAATGTCTGTTTACATAATTAAAAAAAAAAAAAxTAxxAAAAAA
                                                      consensus depths                                                     3     3     3     3     5     6    12    12    14    14    16    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    18    18    18    18    17    18    18    18    18    18    17    17    17    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    18    19    19    19    19    19    19    18    19    19    19    18    19    18    19    19    19    18    20    17    19    17    19    18    19    19    19    18    19    16    17    16    17    16    17    15    17    17    17    17    17    16    17    14    17    14    17    13    16    15    17    13    16    11    15    11    15    12    16    11    15    10    14     9    14     9    13     9    13     9    12     8    12     8    12     8    12     9    13     9    12     8    12     7    12     8    13     8    12     6    12     6    12     7    12     7    11     7    10     6    10     6    10     5    10     5     9     5     8     5     7     5     7     5     8     5     6     6     6     6     6     6     6     7     7     7     7     8     8     8     9     9    10     9    10     8    10     9    11     9    11     9    11     9    12     9    12    10    13    10    13    10    13    10    13    10    13     9    13     9    13    10    13    10    13    11    13    11    13     9    14     9    14     9    14    10    14    10    14    10    14     9    13     9    13    10    15    11    15    11    16    11    16    13    16    13    16    14    17    14    17    13    17    13    17    14    17    16    18    15    18    15    18    15    18    15    18    15    18    14    18    15    18    15    18    13    17    13    17    13    17    13    17    13    17     9    16    13    16    13    16    13    16    12    16    11    16    11    15    10    15    13    18    13    17    14    17    14    17    14    17    14    17    14    17    14    16    13    15    13    15    13    15    13    15    13    14    12    14    10    12    10    12     7     9     7     8     3     5
  5   1   2       e>1                            Xl3.1-IMAGE:5085118.5                                                  TCGCTGGTTCTCCTCTTCTAGCTTCTGCTCGTGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATTACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAAACTGCCAGGGAGTGGTTCCTGAATTCTGCCAAAGATGCATCTGCAGTGGCCAAACATTTTGTTGCCCTGTCCACCAATGCACCTAAAGTTAAAGATTTTGGAATAGACACCGCAAATATGTTTGAATTCTGGGATTGGGTTGGTGGTCGTTACTCTTTGTGGTCAGCCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATAACTTTGAAAAGCTTTTGGCAGGAGCCCACTGGATGGACAATCACTTTTACAAAACTCCACTAGAGAATAATGTCCCTGTAATACTGGCCATGCTGGGTATTTGGTACATCAACTTTTATGGATGTGAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGC
  5   1   2       e50                            Xl3.1-IMAGE:6957345.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGCAAATATGTTTGAATTCTGGGATTGGGTTGGTGGTCGTTACTCTTTGTGGTCAGCCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATAACTTTGAAAAGCTTTTGGCAGGAGCCCACTGGATGGACAATCACTTTTACAAAACTCCACTAGAGAATAATGTCCCTGTAATACTGGCCATGCTGGGTATTTGGTACATCAACTTTTATGGATGTGAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTG
  5   1   2       e>1                            Xl3.1-IMAGE:5506162.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTGCAAACCTGGTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTTGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAATGTCTGTTTACATAATTAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------C----
                                               BLH ATG      75    1807                                                
                                               BLH MIN      60     372                                                
                                               BLH OVR      75      40                                                
                                               EST CLI      20      23                                                
                                               ORF LNG      75       6                                                
  5   1   2       e>1                            Xl3.1-IMAGE:5085118.5                                                  TCGCTGGTTCTCCTCTTCTAGCTTCTGCTCGTGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATTACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAAACTGCCAGGGAGTGGTTCCTGAATTCTGCCAAAGATGCATCTGCAGTGGCCAAACATTTTGTTGCCCTGTCCACCAATGCACCTAAAGTTAAAGATTTTGGAATAGACACCGCAAATATGTTTGAATTCTGGGATTGGGTTGGTGGTCGTTACTCTTTGTGGTCAGCCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATAACTTTGAAAAGCTTTTGGCAGGAGCCCACTGGATGGACAATCACTTTTACAAAACTCCACTAGAGAATAATGTCCCTGTAATACTGGCCATGCTGGGTATTTGGTACATCAACTTTTATGGATGTGAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGC
                                                  Xl3.1-CHK-1012689085                                                        GTTCTCCTCTTCTAGCTTCTGCTCGTGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATTACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAAACTGCCAGGGAGTGGTTCCTGAATTCTGCCAAAGATGCATCTGCAGTGGCCAAACATTTTGTTGCCCTGTCCACCAATGCACCTAAAGTTAAAGATTTTGGAATAGACACCGCAAATATGTTTGAATTCTGGGATTGGGTTGGTGGTCGTTACTCTTTGTGGTCAGCCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATAACTTTGAAAAGCTTTTGGCAGGAGCCCACTGGATGGACAATCACTTTTACAAAACTCCACTAGAGAATAATGTCCCTGTAATACTGGCCATGCTGGGTATTTGGTACATCAACTTTTATGGATGTGAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATT
  5   1   2       bld Eye1 5g3  in                    IMAGE:6948829.5p CGGAATTCCTGCGGATAGAGCGATCAGTATAAGAGCTGCTACTCCTGTCTCGCTGGTTCTCCTCTTCTAGCTTCTGCTCGTGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCGTAACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCCTATTCTAAAAGAGGACCTCGTGTGTGGTTTTGTATCGAACATTGATGGCACTCACATTTGCCAAAACTCTGGGCTGAAACTGAAACCCTGAAAACTACACCTCTTCCATTATTGGCATTCAAAGGACTTTTTTACCACCCCAGGGAAAACCATTAACTAAATGGCCTGAAAACCTGGCCAGGGGAAGGGGGTTTCCCTGGAATTCCTGCCCAAAAGAATGCCATCCTGCCAGGGGGGCACAAAACATTTTTGGTTGGCCCCTGGGCCCCACCAAAT
  5   1   2       bld Sp1  5g                         IMAGE:5511859.5p                                    CTGCTGCTCCTGTCTCGCTGGTTCTCCTCTTCTAGCTTCTGCTCGTGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATAACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAACTCTGGCTGACTGAACCCTGAAACTACACTCTTCATATTGCATCAAGACTTTTACACCCAGGAAACCATACTATGCTAA
  5   1   2       bld Ooc3 5g                         IMAGE:3436389.5p                                               GTCTCGCTGGTTCTCCTCTTCTAGCTTCTGCTCGTGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGTTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACAGGTCAAATACACCAATCCCGCTGGATGGTTAAGATGTCATGCCTGAAGTTAATGCAGAATTGGAGAACATGAAAGCT
  5   1   2       bld Ov1  5g                         IMAGE:8332596.5p                                                                     AGCTTCTGCTCGTGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGTTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACAGGTCAAATACACCAATCCCGCTGGATGGTAAAGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATTACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAAACTGAACCTGAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGAAACCATAACTATGCTGAAACTGCCAGGGAGTGTTTCTGCATT
  5   1   2      seed Egg3 5g                IMAGE:3377875-IMAGp.IMAGp                                                                      TTTCCCCGGGGGGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGTTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAAAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACAGGTCAAATACACCAATCCCGCTGGATGGTAAAGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATTACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAAACTGCCAGGGAGTGGTTCCTGAATTCTGCCAAAGATGCATCTGCAGTGGCCAAACATTTTGTTGCCCTGTCCACCAATGCACCTAAAGTTAAAGATTTTGGAATAGACACCGCAAATATGTTTGAATTTCTGGGATTGGGTTGGTCGTCGTTACTCTTTGTGGGTCAGCCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATAACTTTGGAAAAGCTTTTGGGCAGGAGCCCACTGGGATGGACAATCACT
  5   1   2       bld Li1  5g                         IMAGE:3397212.5p                                                                       CTTCTGCTCGTGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAAATGAAAGCTGTCTGCCAAAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACNGAAAAACCATAACTGATGTTGTTAACAATTGCATTAGTGGCTCTGACCTAGGACCTGTTATGGTAACTGAATCGCTGAAACCCTATTCTAAAAGAAGACCTCGTGTATAGTTTGTATCGGACATTTATAACGCTCACATTGCCCAAAGC
  5   1   2       bld Sp1  5g3  in                    IMAGE:4968964.5p                                                                            CCACGCGTCCGGTGCAGCGCTGAACTTCGCCCCTTGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACATTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGTTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAAAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACAGGTCAAATACACCAATCCCGCTGGATGGTAAAGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATTACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGNGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAAC
  5   1   2       bld Ov1  5g                         IMAGE:8330996.5p                                                                            GCTCGTGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGTTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACAGGTCAAATACACCAATCCCGCTGGATGGTAAAGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGANAAGCCATTACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCAAAGAC
  5   1   2       bld Egg3 5g3  in                    IMAGE:3377875.5p                                                                             CCGGGGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGTTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAAAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACAGGTCAAATACACCAATCCCGCTGGATGGTAAAGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATT
  5   1   2       bld Sp1  5g                         IMAGE:5511664.5p                                                                             CTCGTGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATTACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCANAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAAACTGCCAGGGAGTGGTTCCTGATTCTGCNAAGATGCTCTGCAGTGGCAAACATTTTGTTGTCCTGTCACATGC
  5   1   2       bld Ov1  5g                         IMAGE:6317132.5p                                                                              TCGTGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGTTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACAGGTCAAATACACCAATCCCGCTGGATGGTAAAGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATTACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGNGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTANAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCCTGAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGGAAACCATAACTAATGCTGAAACTGCCCANGGAGTGGTTTCCTGCATTTCTGCCCAAGAATGCATTCTGCCAGTGGCCAAAACCATTTTTGTTGCCCCTGTTCAACCCAATGCCACCCTAAAAGTTTAAAGGATTTTTGGGAATTAAGACCACCGCCAAATTATGGNTTTGAAATTTCTTGGGGAATTGGGGTTTGGGTGGGCTCGGTTACACCCTCTTTGGGGGGCCAACGCCCATTTGGGGGTTATATCCAATTTGGCAACCTTACATTGGTCCGGGGGTTTTTGAATAACCTCTTTTGAAAAAAAGCTT
  5   1   2       bld Ov1  5g                         IMAGE:6317880.5p                                                                                GTGTTTAGTGCAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATTACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGNACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAACTGGCCCAGGGAGTGGTTCCTGAATTCTGCCAAAGATGCATCTGCAGTGGCCCAAACATTTTTGTTGCCCCTGTCACCAATGCACCTAAAAAGTTAAAAGATTTTTGGAATAGACACCCCAAAATATGTTGGAAATTCTTGCGGAAAAATGTGGGGTTTTGGCGGGGCCCCTTTAACCTCCTTTTT
  5   1   2       bld Oo1  5g                         IMAGE:5085118.5p                                                                                          CAGCGCTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATAACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAAACTGCCAGGGAGTGGTTCCTGAATTCTGCCAAAGATGCATCTGCAGTGGCCAAACATTTTGTTGCCCTGTCCACCAATGCACCTAAAGTTAAAGATTTTGGAATAGACACCGCAAATATGTTTGAATTCTGGGATTGGGGTTTGGTGGTCCTTTACTCCTTTGGGGTCAGCCATTTGGGTTATCCATTGCACCTTCATGGCGGGGGTTTTGAATAACCTTTGAAAAGCTTTTTGGCCAGGT
  5   1   2       bld Sp1  5g3  in                    IMAGE:4174960.5p                                                                                               CTGAACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATA
  5   1   2       bld Oo1  5g                         IMAGE:5077903.5p                                                                                                  AACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATAACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGNGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTA
  5   1   2       bld Oo1  5g                         IMAGE:6638677.5p                                                                                                  AACTTCGCCCCTAGTATAAGCCCAGCAATGGCACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCGAAGAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATAACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAAACTGCCAGGGAGTGGTTCCTGAATTCTGCCAAAGATGCATCTGCAGTGGCCAAACATTTTGTTGCCCTGTCCACCAATGCACCTAAAGTTAAAAGATTTTTGGGAATAGACACCCGCAAAATATGTTTTGAAATTTCCTGGGAATTGGGGTTTGGGTGGGTCGTTTAACCTCTA
  5   1   2       bld Egg3                            IMAGE:3378333.5p                                                                                                                                  ACTCACCTGCGACCCAGTGTACCAGAAGCTGAGTCAGTGGTACGAAGCCCACCATGCCGGCCTTAACATGAGGCAGATGTTTGAAGCTGACAAGGACAGGTTCAGCAAATACAGTAAAACACTTGTGACTGATGATGGCAATATTCTA
  5   1   2       bld Egg6      in                    IMAGE:4434744.5p                                                                                                                                                                                                                   CGAAGCTGACAAGGACAGGTGCAACAAATACAGCAAAACACTTGTGACTGATGATGGCGATATTCTGCTTGACTACTCCAAGAACCTTATTAATGAAGATGACCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACATAAGATGGTCTCTGCTGAGAATATAATCTTCGCTGATAACCGGGCTGTTCTGCACATTGTTCTTCGCAACCGAGCAAATACAACAATCCCACTGGATGGGAAGGATGTCGTGCCTGAAGCTAATGCTGACTTGGAGAATATGAAAGCTTTCTGCCATAAAGTCCGCAGTGGGGACTGGAACGGTTACAACGGAAAAGCCATAACTGATGAGGTTAACATTGGCATTGATGGCTCTGACCTGTGATCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGAGTGAGGTTTGTATCCAACGTTGATGGCACTCACATTGCCAGAACTCTGATTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCC
  5   1   2       bld Spl                             IMAGE:8464303.5p                                                                                                                                                                                                                                                                                                    GAACCTTATTAATGAAGATGTCCTGAAGCTTCTGATAGAACTGGCCCGCTCAAGAGGTGTTGAGAGTGCAAGACAGAAGATGTTCTCTGCTGAGAAGATAAACTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATAACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAAACTGCCAGGGAGTGGTTCCTGAATTCTGCCAAAGATGCATCTGCAGTGGCCAAACATTTTGTTGCCCTGTCCACCAATGCACCTAAAGTTAAAGATTTTGGAATAGACACCGCAAATATGTTTGAATTCTGGGAATGGGTTGGTGGCCGCTACTCTTTGTGGTCAGCCATTGGGTTACCCATTGCCCTTCATGTCGGGGTTGATAACTTTGAATAGCTTTTGGAGGAGCCCACTGGATGGAAAATACTTTTACAAACTCCCTAAAGATAATGTCCTGTAATCTGCCTTGG
  5   1   2       bld Egg4      in                    IMAGE:3744286.5p                                                                                                                                                                                                                                                                                                                                                                                                          CTTCACTGAGAACCGGGCTGTTCTGCACATTGCTCTTCGCAACCGGTCAAATACACCAATCCCGCTGGATGGTAAGGATGTCATGCCTGAAGTTAATGCAGTCTTGGAGAAGATGAAAGCTTTCTGCCAGAAAGTCCGCAGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATTACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAAACTGCCAGGGAGTGGTTCCTGAATTCTGCCAAAGATGCATCTGCAGTGGCCAAACATTTTGTTGCCCTGTCCACCAATGCACCTAAAGTTAAAGAATTTTGGAATAGACACCGCAAATATGTTTGAATTCTGGGATTGGGTTGGTGTCGATACTCTTGGTGGTCAACCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATTACTTTGAAAAGGCTTTGGGCAGAACCCACTGG
  5   1   2       bld Int2                            IMAGE:8825202.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACATTAATCAATAAACACAATCCCTACATTTTACAAAATTCGTCCCGTGGGGACTGGAAGGGTTACAACGGAAAAGCCATAACTGATGTGGTTAACATTGGCATTGGTGGCTCTGACCTGGGACCTTTGATGGTAACTGAATCGCTAAAGCCCTATTCTAAAGGAGGACCTCGTGTGTGGTTTGTATCGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAAACTGCCAGGGAGTGGTTCCTGAATTCTGCCAAAGATGCATCTGCAGTGGCCAAACATTTTGTTGCCCTGTCCACCAATGCACCTAAAGTTAAAGATTTTGGAATAGACACCGCAAATATGTTTGAATTCTGGGATTGGGTTGGTGGTCGTTACTCTTTGTGGTCAGCCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATAACTTTGAAAAGCTTTTGGCAGGAGCCCACTGGATGGACAATCACTTTTACAAAACTCCACTAGAGAATAATGTCCCTGTAATACTGGCCATGCTGGGTATTTGGTACATCAACTTTTATGGATGTGAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAAGGTGATATGGAATCAATGGGAAGTATATCACTAAAACAGGGCTCGTGTGAACTACAACACCCGTCCTGTGGTGTGGGGGAGCCAGGACCAATGTACAGCATGCATTCTATCACTCATACATCAGAACTCGCAAAATTCCTTGTGACTTCTGATTCCTGTTGCAGAACCCGAATTCCAATTAGAACGGCTGCATCCCACAGATTCCTTTCTATTCCAACCTTCTGGCTAGACGAAAGTCCCCTCATGAAGCAAATTCCCACACGATGAAGCCATAG
  5   1   2       bld Panc                            IMAGE:8736154.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAACATTGATGGCACTCACATTGCCAAAACTCTGGCTGAACTGAACCCTGAAACTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAAACTGCCAGGGAGTGGTTCCTGAATTCTGCCAAAGATGCATCTGCAGTGGCCAAACATTTTGTTGCCCTGTCCACCAATGCACCTAAAGTTAAAGATTTTGGAATAGACACCGCAAATATGTTTGAATTCTGGGATTGGGTTGGTGGTCGTTACTCTTTGTGGTCAGCCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATAACTTTGAAAAGCTTTTGGCAGGAGCCCACTGGATGGACAATCACTTTTACAAAACTCCACTAGAGAATAATGTCCCTGTAATACTGGCCATGCTGGGTATTTGGTACATCAACTTTTATGGATGTGAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGCTTGCATCACAGGATTCTTCTATCAACTCTGCTCAGAACGAAGCCCTCATGAGAAATCCACAGAATGAGCAAAAGATTGCAGGCTTCGGACTCATGGGAGCTGGACAATGCTCCCTCCAAGGTTTTGAGAACAGACCCACCAATTCCA
  5   1   2       bld Brn3                            IMAGE:8539437.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTACACTCTTCATTATTGCATCAAAGACTTTTACCACCCAGGAAACCATAACTAATGCTGAAACTGCCAGGGAGTGGTTCCTGAATTCTGCCAAAGATGCATCTGCAGTGGCCAAACATTTTGTTGCCCTGTCCACCAATGCACCTAAAGTTAAAGATTTTGGAATAGACACCGCAAATATGTTTGAATTCTGGGATTGGGTTGGTGGTCGTTACTCTTTGTGGTCAGCCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATAACTTTGAAAAGCTTTTGGCAGGAGCCCACTGGATGGACAATCACTTTTACAAAACTCCACTAGAGAATAATGTCCCTGTAATACTGGCCATGCTGGGTATTTGGTACATCAACTTTTATGGATGTGAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTGCTCAGACAGAGCCCTCATGAAGGAAAATCACAGATGAAGCCAAAANGAAATGCAGCTCTGACTCCTGGGAAGCTTTGACAATGCTCCTCACAGTTTTGAAGAACGA
  5   1   2       e50                            Xl3.1-IMAGE:6957345.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGCAAATATGTTTGAATTCTGGGATTGGGTTGGTGGTCGTTACTCTTTGTGGTCAGCCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATAACTTTGAAAAGCTTTTGGCAGGAGCCCACTGGATGGACAATCACTTTTACAAAACTCCACTAGAGAATAATGTCCCTGTAATACTGGCCATGCTGGGTATTTGGTACATCAACTTTTATGGATGTGAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTG
                                                  Xl3.1-CHK-1012704449                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATATGTTTGAATTCTGGGATTGGGTTGGTGGTCGTTACTCTTTGTGGTCAGCCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATAACTTTGAAAAGCTTTTGGCAGGAGCCCACTGGATGGACAATCACTTTTACAAAACTCCACTAGAGAATAATGTCCCTGTAATACTGGCCATGCTGGGTATTTGGTACATCAACTTTTATGGATGTGAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAA
  5   1   2      seed Ov1       in                    IMAGE:5074011.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACGCGTCCGCTGTCCACCAATGCACCTAAAGTTAAAGATTTTGGAATAGACACCGCAAATATGTTTGAATTCTGGGATTGGGTTGGTGGTCGTTACTCTTTGTGGTCAGCCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATAACTTTGAAAAGCTTTTGGCAGGAGCCCACTGGATGGACAATCACTTTTACAAAACTCCACTAGAGAATAATGTCCCTGTAATACTGGCCATGCTGGGTATTTGGTACATCAACTTTTATGGATGTGAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACT
  5   1   2       bld Bone                            IMAGE:8742324.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGCAAATATGTTTGAATTCTGGGATTGGGTTGGTGGTCGTTACTCTTTGTGGTCAGCCATTGGGTTATCCATTGCACTTCATGTCGGGTTTGATAACTTTGAAAAGCTTTTGGCAGGAGCCCACTGGATGGACAATCACTTTTACAAAACTCCACTAGAGAATAATGTCCCTGTAATACTGGCCATGCTGGGTATTTGGTACATCAACTTTTATGGATGTGAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCACGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAAGTTTTTGAAGAAACAGACCAACAAATTCCATTGTATTTACAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGAGTGTGTGGACATAAACAGTATGACCCATGGGGTGTGAGCTGGAACACTGCAAAGAAAATGGAGCCTGACTGATCTGATGCACTATAACATCTCATGATGCTCACAATGGACTCATCACCTCATCAGAAGCCAAGAAGCTAAACTGATCAGTCAGCTACAAACCCTGGGTTAACCGGTG
  5   1   2      skin Eye1      in                    IMAGE:6957345.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCGGATGTCCCTGTAATACTGGCCATGTTGCGGTATTTGGTACATCAACTTTTATGGATGTGAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATTACATCTCCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTGCCAAACCTGGGTGGTTATCGTGGCCCCTTTCTTGGCCTTTCTGCAAAAAACCACCTTCCCTATTTGAAAGTTGGTTCCCCTTGGTAAATGGTAACCCGGTTGTGTTGG
  5   1   2       bld Te2N                            IMAGE:7766626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGACTCATGCCCTTCTTCCCTATGATCAGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCCCAATGGATCATCACTTCATCAAGAGCACAGAACTAAACTGATCAGTTCAGCTACAACCTGGTGTATCGTGCCTTTATCTGCTTCTGCAAAAGCACTTCCCTATGAGTGTCTCTGNATGAACTGTGTGGTCTC
  5   1   2      skin Eye1      in                    IMAGE:4757560.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCGCTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACCGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCCTTTTGGGAGCTCTATTGCTATGTATAAACATAAAACCCTCCTTCAAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGGGTTGCACTTTGGGAAACAACTGCGAAAGAAATTTGACCCCTGACTGGATCTGCATGCACCATAACATCCCATGGTGGCTCC
  5   1   2       e>1                            Xl3.1-IMAGE:5506162.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTGCAAACCTGGTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTTGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAATGTCTGTTTACATAATTAAAA
                                                  Xl3.1-CHK-1012690933                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTACAAACCTGTTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTTGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAATGTCTGTTTACATAATTAAAAAAAAAA
  5   1   2       chi Skin                            IMAGE:8644894.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTACATGCATCGCTTTGCTGCCTATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTACAAACCTGGTGTTATCGTGCCCTTTTCTTGGGCTTCTGCAAAAGCACTTTCCTATGNAGTTNNGTCTCTGAATGAACTGTGTGTGTCTCTAGTTGAGCATCTGGGAGAGCTACGTCAAGACATCGTCGTCAATTCGGAAACTGTCTGTACATCACCTATTCTAACGAATATTCTT
  5   1   2       chi Ov1                             IMAGE:6316220.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTACCCGTCCGATTTTCAGCAGGGTGATATGGAATCAAATGGGAAGTATATCACTAAAACAGGGGCTCGTGTGAACTACAACACCGGCCCTGTGGTGTGGGGGGAGCCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAAGTTATGACCAATGGGGGTGTTGAGCCTTTGGGAAACAAACTGGGCaaaaaaaaaaTTGAAGCCCTGAACCTGGGAAATCTTGGATTGGCCACCTAATTAAACCATCCCTCCTTTGGATGGGGCCTTCCCCACCCCAATTGGGGAACCTCCTTTTCAACCTTTCTCATTTCCAAGGAAAGGCCCCCCGGAAAAAGCCTTAAAAACCCTTGGAATTCAAGGTTTTCCAAGCCTTaaaaaaaaaccttggggggggtttaatccccgggcccccccctttttttcttttggggccctttttcgggccaaaaaaaaaaGCCCCCTTTTTCCCCATATTGGGGAAAAGGATGGGGGGTCCCCCCTGGGGAAACATTGGTAAAACCGTGGTTAGGGCGGGGCCCC
  3   1   2       bld Eye1      in                    IMAGE:6957345.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCGTGTGTGAAAGTTAAACACCCCACGCGGCCCAATTGTGATTTGCGGGGGGGGAGTCCCAGGGGAACCCAAAGGGACACAGCCGTCCATTTTTACTCAGACTCAATACGGTCCAAGGAAACCTCGCAAAAAATTCCATGGAAATTTTGCTAGATTCCCGGGGGCAAGACCCCAGAATCCCAATTAGGAAAACGGGCTTGCATCCACAAAGTTTTTTTTATCCCAACTTTCCTTGCTTCAGACAGAAGGCCTTCCATAAAGGGAAAATCCCCCAGATGGGGCCAAAAAGGATTGGCAGGTTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGCCCAACAAAATTCCTTTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTGCAAACCTGGTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTTGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACTTGGATACCCATATTATTATGATTCTCTTTTACGTACCNATGATTATTGGAAATGTCCGGTACAA
  3   1   2       bld Eye1 5g3  in                    IMAGE:6948829.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCCCCTGTGGTTTGGGGGGACCCCAGGAAACCAATGGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCTTGGTGACTTCTTGATTCCTGTGCAGACCCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTACAAACCTGGTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTCGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTAATTTTTTTTTTCATC
  5   1   2       bld Sp1                             IMAGE:5506162.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGGAACCAATGGACAGCATGCATTCTATCAGCTCATACATCAAGGAACTCGCAAAATTCCTTGTGACTTCTTGATTCCTGTGCAGACCCAGAATCCAATTAGAAACGGCTTGCATCACAAGATTCTTCTATCCAACTTCCTTGCTCAGACAGAAGCCCTCATGAAGGGAAAATCCACAGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGATACAAACCTGTTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTTGGGACAAACATGTCCTGGTAGCCATGCACCCTCC
  3   1   2       bld Egg4      in                    IMAGE:3744286.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTCCACTTCCTTGGTTCAGGACAGAGGCCTTCATGAAGGGAAAATCACAGATTGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTGCAAACCTGGTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCCTATGGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTTTAAAGACAATCTGTCTGTCCAGATGTCGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTTTTTTACATTCAATGATTATTGTGAAATGTCTGTTTACATAATTAAAAAAAAAAAAAAAAAAA
  3   1   2      seed Egg2                            IMAGE:5278775.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGATGAGGCCAAAAAGGAATTGCAGGCTTCTGGACTCACTGGGGAAGCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTGCAAACCTGGTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTCGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4968964.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTTTGGACAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTACAAACCTGTTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTTGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAATGTCTGTTTACATAATTAAAAAAAAAAAAAAG
  3   1   2       bld Egg6                            IMAGE:4434534.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAAAATTGTCTCCCTCAAAGGGTTTTGAAGGAAAAAAGGCCCACAAAGTTCAATTGGGATTTCGAGACTTTAATCCATTCATTTTGGGAGGTTTAATGGCGATGGATGAACATAAAATTTTGTTCAGGGAGGTGGGGGGGACATAAACAGGTATGGCCAAATGGGGGTTGAGCTTGGGAAACAACGGGCAAAGAAAATTGAGCCTGAACTGGAATCGGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTGCAAACCTGGTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTTGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTA
  3   1   2       bld Ov1       in                    IMAGE:5074011.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAATTGCTCCCTCACAAGGTTTTTGAAGGAAACAGACCAACAAATTCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTGCAAACCTGGTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTCGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAATGTCTGTTTACATAATTAAAAAAAAAAAAAAAG
  3   1   2       bld Egg3 5g3  in                    IMAGE:3377875.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAAGGTTTTTGAAGGAACCAGACCACCCAATTCCATTGTATTTAAAGACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAATCTTCGTCAGGGAGTTGTTGGGACATAAACAGTTATCACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGCTACAAACCTGTTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTACTGTTGTGTGTCTTCTAGTTTTAACCAGTCTTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTTGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAATGTCTGTTTACATAATTAAAAAA
  3   1   2       bld Egg6      in                    IMAGE:4434744.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTGAAGGAAACAGGCCAACAAATTCCCATTGTATTTACAAAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGATACAAACCTGTTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTTGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAAGGT
  3   1   2       bld Egg6                            IMAGE:4436040.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACTTAATCCATTCATTTTGGGAGCTCTAATTGCTATGTATGAACATAAAATCTTCGTTCAGGGAGTTGTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATTTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGATACAAACCTGTTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTTGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAATGTC
  3   1   2       bld Eye1      in                    IMAGE:4757560.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGTGGGACATAAACAGTTATGACCAATGGGGTGTTGAGCTTGGGAAACAACTGGCAAAGAAAATTGAGCCTGAACTGGAATCTGATGCAACTATAACATCTCATGATGGCTCCACCAATGGACTCATCAACTTCATCAAGAAGCACAGAAGCTAAACCTGATCAGTTCAGATACAAACCTGTTGTTATCGTGCCCTTTTCTTGGCTTTCTGCAAAAAAGCACTTTCCTATTGTAGTTTGTTCTCTTGTAATTGTAACTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTTGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAATGTCTGTTTACATAATTAAAAAAAAAAAAAATAAAAAAAAAAA
  5   1   2       bld Ov1       in                    IMAGE:5074601.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACCCACGCGGCCGCTTCTAGTTTGAAGCAGTCTGGGGATGTAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTCGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAATGTCTGTTTACATAATTaaaaaaaaaaaaattatcaaaaaaattaaaaaaaG
  3   1   2       bld Sp1  5g3  in                    IMAGE:4174960.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGTTGTGTGTCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTCGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAATGTCTGTTTACATAATTAAAAAAAAAAAATATGCA
  3   1   2       bld Ov1       in                    IMAGE:5074601.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACGCGTCCGCTTCTAGTTTGAAGCAGTCTGGGGATGAAGCTACTGTCTAAAGACAATCTGTCTGTCCAGATGTCGGGACAAACATGTCCTGTTAGCCATGCACCCTCAGTTTCCTAAAAACCGAGAATAGTGTCCTTTTAAGTCACCTGAATACCCATATTATTATGTTTTTCTTTTACATTCAATGATTATTGTGAAATGTCTGTTTACATAATTAAAAGAAAAAAAAATAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)