Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL458c14ex.5                         87 PI      76        795     1384                (no blast hit)
     2   0.0    0Xl3.1-XL446k06ex.5.5                       72 PI      78        907     1395                Zinc finger protein ZIC 1 (Zinc finger protein of the cerebellum 1)(ZIC-related-1 protein) (ZIC-R1) (ODD-paired-like)
     3   0.0    0Xl3.1-XL420f16ex.5                         43 PI      79       1147     1384                similar to zinc finger protein of the cerebellum 2 [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012837825 Xl3.1-XL518h07ex.3.5 - 68 ESTs
                                                                       .........-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-XL518h07ex.3.5                                                                                                                                                                TGAGCAGTGAGTGATTGACTTTATCAGTCCAAGGACTTACTCAGTTGGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCAGAGGAGATATTTTCGGACGTCCAGATCCTTATAGGGCAGTGCCCAGCCCGAGGACAGATCATTATGCTGCTGCCCAATTCCATAATTATAATCACATGAATATGAGCATGAATGTAGCTGCTCACCATGGCCCTGGGGCTTTCTTTAGGTACATGAGGCAACCCATCAAACAAGAGTTATCTTGTAAGTGGCTTGAGGAATCACCAATGAACCGTCCTCAGAAAACCTGTGACAGGACATTTAGCAGCATGCATGAACTGGTTACACATATGACAATGGAACATGTTGGGGGTCCAGAACAAAGTAATCACATATGTTACTGGGAGGAATGTCCCAGAGGAGGTAAATCTTTTAAAGCAAAGTATAAACTAGTGAATCATATCAGGGTGCATACCGGAGAAAAACCCTTTCCATGCCCCTTCCCTGGATGTGGGAAAATCTTTGCACGTTCAGAAAATCTCAAGATCCACAAAAGAACTCATACAGGTGAGAAGCCATTCAAGTGTGAGTTTGAAGGCTGCGATAGAAGGTTTGCAAACAGCAGCGACAGGAAAAAACATATGCATGTGCACACGTCAGATAAGCCATATATCTGCAAAGTGTGTGATAAATCCTACACTCACCCCAGCTCCCTAAGAAAGCACATGAAGGTTCATGAATCACAAGGGTCTGATTCTTCCCCTGCTGCCAGCTCAGGGTACGAATCTGCTACCCCACCAGCAATGGTTTCTGCCAACAGTGAGGAACCTTCCAAAAATTCATCAGCAACACATCAGACTAACAACAATTCTCATAACACAGGACTACTTCCACCTAATTTTAACGAATGGTATGTCTGAGCAAAATGTAGAGAGGCCTAGTCATGCTCAACAAAAGGACCATGTGCAAAAAAACAGAATCCAATTTTTTTTATGTTGAACCAAGGCGGAAATGGAATTTACCACACAAGCAACAGTATAGGGCTTCATCTTGTTAAAATAATTTACCAACATTTTCTAAAGATGGCTACAGACTAACAAAGCCCTTTTCTCAGGATCTGAACACATTTTTTGGTGTTTGTATTTCCTCTGATTTTATGCCCTTTTCATTTTAACAACTTCACTCCTTTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAATACTTGTAGATATATAAAATATTTAAGATAAAATCCTATTTATTTGAAG
                                                  Xl3.1-CHK-1012722303                                                                                                                                                                      GTGAGTGATTGACTTTATCAGTCCAAGGACxTxxxxAGTTGGxxxxGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCAGAGGAGATATTTTCGGACGTCCAGATCCTTATAGGGCAGTGCCCAGCCCGAGGACAGATCATTATGCTGCTGCCCAATTTCATAATTATAATCACATGAATATGAGCATGAATGTAGCTGCTCACCATGGCCCTGGGGCTTTCTTTAGGTACATGAGGCAACCCATCAAACAAGAGTTATCTTGTAAGTGGCTTGAGGAATCACCAATGAACCGTCCTCAGAAAACCTGTGACAGGACATTTAGCAGCATGCATGAACTGGTTACACATATGACAATGGAACATGTTGGGGGTCCAGAACAAAGTAATCACATATGTTACTGGGAGGAATGTCCCAGAGGAGGTAAATCTTTTAAAGCAAAGTATAAACTAGTGAATCATATCAGGGTGCATACCGGAGAAAAACCCTTTCCATGCCCCTTCCCTGGATGTGGGAAAATCTTTGCACGTTCAGAAAATCTCAAGATCCACAAAAGAACTCATACAGGTGAGAAGCCATTCAAGTGTGAGTTTGAAGGCTGCGATAGAAGGTTTGCAAACAGCAGCGACAGGAAAAAACATATGCATGTGCACACGTCAGATAAGCCATATATCTGCAAAGTGTGTGATAAATCCTACACTCACCCCAGCTCCCTAAGAAAGCACATGAAGGTTCATGAATCACAAGGGTCTGATTCTTCCCCTGCTGCCAGCTCAGGGTACGAATCTGCTACCCCACCAGCAATGGTTTCTGCCAACAGTGAGGAACCTTCCAAAAATTCATCAGCAACACATCAGACTAACAACAATTCTCATAACACAGGACTACTTCCACCTAATTTTAACGAATGGTATGTCTGAGCAAAATGTAGAGAGGCCTAGTCATGCTCAACAAAAGGACCATGTGCAAAAAAACAGAATCCAATTTTTTTTATGTTGAACCAAGGCGGAAATGGAATTTACCACACAAGCAACAGTATAGGGCTTCATCTTGTTAAAATAATTTACCAACATTTTCTAAAGATGGCTACAGACTAACAAAGCCCTTTTCTCAGGATCTGAACACATTTTTTGGTGTTTGTATTTCCTCTGATTTTATGCCCTTTTCATTTTAACAACTTCACTCCTTTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAATACTTGTAGATATATAAAATATTTAAGATAAAATCCTATTTAT
                                                      consensus depths                                                                                                                                                                     2     2     2     2     2     3     4     8     8    16     9    18     9    18    13    21    13    21    13    21    13    21    13    21    13    21    21    21    21    21    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    21    22    21    22    21    22    22    22    22    22    22    22    20    22    22    23    22    23    22    23    22    22    22    22    22    22    22    22    22    22    22    23    22    23    23    23    22    22    22    22    22    22    22    22    22    22    22    22    22    22    21    21    20    21    19    19    14    16    15    16    15    16    13    15    10    14    10    14     9    13     7    11     7    11     7    11     4     8     4     9     3     8     3     8     3     7     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6     3     7     2     7     3     7     3     7     3     7     2     4     2     4     3     5     3     5     3     5     3     5     3     5     2     5     2     5     2     5     2     7     2     7     2     7     3     7     3     7     4     8     4     6     4     6     4     6     4     6     4     6     4     6     4     6     5     7     5     7     5     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     8     5     8     5     8     4     8     5     8     5    10     4     9     4     9     4     9     4     9     4     9     4     9     4     9     5    12     5    12     5    12     4    11     4    13     4    14     4    14     4    15     5    18     4    20     5    24     5    26    16    29    15    28    15    29    17    31    19    32    22    33    28    35    30    36    33    36    30    36    28    36    27    36    32    36    34    36    34    36    35    36    33    36    34    37    30    37    31    37    33    37    32    37    28    37    33    37    22    36    22    36    22    36    22    35    21    35    31    35    21    35    18    32    19    30    16    29    16    29    17    28    14    26    14    24    14    24    13    23    13    23    13    23    13    23    13    23    10    22    10    21    11    20     7    15     6    11     4     6
  5   1   2      ests                               Xl3.1-XL517n09ex.5                                                                                                                                                                TGAGCAGTGAGTGATTGACTTTATCAGTCCAAGGACTTACTCAGTTGGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCAGAGGAGATATTTTCGGACGTCCAGATCCTTATAGGGCAGTGCCCAGCCCGAGGACAGATCATTATGCTGCTGCCCAATTCCATAATTATAATCACATGAATATGAGCATGAATGTAGCTGCTCACCATGGCCCTGGGGCTTTCTTTAGGTACATGAGGCAACCCATCAAACAAGAGTTATCTTGTAAGTGGCTTGAGGAATCACCAATGAACCGTCCTCAGAAAACCTGTGACAGGACATTTAGCAGCATGCATGAACTGGTTACACATATGACAATGGAACATGTTGGGGGTCCAGAACAAAGTAATCACATATGTTACTGGGAGGAATGT
  5   1   2      ests                               Xl3.1-XL518h07ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTAAAGCAAAGTATAAACTAGTGAATCATATCAGGGTGCATACCGGAGAAAAACCCTTTCCATGCCCCTTCCCTGGATGTGGGAAAATCTTTGCACGTTCAGAAAATCTCAAGATCCACAAAAGAACTCATACAGGTGAGAAGCCATTCAAGTGTGAGTTTGAAGGCTGCGATAGAAGGTTTGCAAACAGCAGCGACAGGAAAAAACATATGCATGTGCACACGTCAGATAAGCCATATATCTGCAAAGTGTGTGATAAATCCTACACTCACCCCAGCTCCCTAAGAAAGCACATGAAGGTTCATGAATCACAAGGGTCTGATTCTTCCCCTGCTGCCAGCTCAGGGTACGAATCTGCTACCCCACCAGCAATGGTTTCTGCCAACAGTGAGGAACCTTCCAAAAATTCATCAGCAACACATCAGACTAACAACAATTCTCATAACACAGGACTACTTCCACCTAATTTTAACGAATGGTATGTCTGAGCAAAATGTAGAGAGGCCTAGTCATGCTCAACAAAAGGACCATGTGCAAAAAAACAGAATCCAATTTTTTTTATGTTGAACCAAGGCGGAAATGGAATTTACCACACAAGCAACAGTATAGGGCTTCATCTTGTTAAAATAATTTACCAACATTTTCTAAAGATGGCTACAGACTAACAAAGCCCTTTTCTCAGGATCTGAACACATTTTTTGGTGTTTGTATTTCCTCTGATTTTATGCCCTTTTCATTTTAACAACTTCACTCCTTTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAATACTTGTAGATATATAAAATATTTAAGATAAAATCCTATTTATT
  5   1   2      en>5                                 Xl3.1-xl236e06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTTTTTTTTTAAAGAAATTAAGAGGTTTTTAGCTGATGTATTTAACATGAAAATTCTCCACCTTGTTGGTGATTGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATGTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTACTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGTATATTTTCAGAAATGGGGATGTGATGTTCATACACAGATTGTGACCGTTTAGTACAGTTGCCTTTTGTAACAACTTTTGTAAATACATATCCACGATGCCATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAAAAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAATGTATTGTTTTGAAGAATTCCCATTTAAACTGTCTAACAAATGTTTGTTTACTTCATGCAACACTGAAACTAATGAAAATATTCTGATTCTGCTGTATTAATTGGACATCAAAAACTATAATTTTTCAGCTTGTTTGGGCAATACTTGTAGATATATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTAAAGAAATTAAGAGGTTTTTAGCTGATGTATTTAACATGAAAATT
                                                                   SNP                                                                                                                                                                                                                                                                                                                            A---C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                        T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----G--A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        A----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    G----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --C-G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----T--G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --C-------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ------T----C
                                               BLH ATG     177    1853                                                                                                                                                                
                                               BLH MIN     177     285                                                                                                                                                                
                                               BLH OVR     177      74                                                                                                                                                                
                                               EST CLI      39      63                                                                                                                                                                
                                               ORF LNG     177       8                                                                                                                                                                
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ce ---- 4e-048     NP_001024478.1 REgulator of Fusion family member (ref-2) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ci ---- 4e-072     NP_001027958.1 zic related zinc finger protein Ci-macho1 [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 1e-083     NP_524228.2 odd paired CG1133-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PREDICTED - Sp ---- 1e-106     XP_001191359.1 PREDICTED: similar to zinc finger protein Ap-Zic [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - ?? ---- 1e-160     XP_001787525.1 PREDICTED: similar to zinc finger protein of the cerebellum 2 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Gg ==== 1e-178     NP_989585.1 Zic family member 1 (odd-paired homolog, Drosophila) [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PREDICTED - Cf ---- 0          XP_549291.2 PREDICTED: similar to zinc finger protein of the cerebellum 3 [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 0          NP_003404.1 zinc finger protein of the cerebellum 3 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Bt ==== 0          XP_614225.2 PREDICTED: similar to zinc-finger protein of the cerebellum 3 isoform 1 [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 0          NP_033601.2 zinc finger protein of the cerebellum 3 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 0          NP_001001950.1 zic family member 3 heterotaxy 1 (odd-paired homolog, Drosophila); zinc fingerprotein of the cerebellum 3 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 0          NP_001005691.1 zic family member 3 heterotaxy 1 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 0          NP_001081088.1 Zic family member 3 heterotaxy 1 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xl3.1-XL518h07ex.3.5                                                                                                                                                                TGA------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---ATG---ATG------------------------------------------ATG---------------------------------------------------ATG---------------------------------------ATG------------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TGA------------------TAG---------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------TAA---------------------TGA------------------------------------------------------------------------------TAA------TAA------------TAA------TAA---------------------------TAA---------------------------------------------------------------------------------------------------------------------------ATG---ATGTGA---------------------------------------------------------------------------------------------------------------------------TGA---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2      ests                               Xl3.1-XL517n09ex.5                                                                                                                                                                TGAGCAGTGAGTGATTGACTTTATCAGTCCAAGGACTTACTCAGTTGGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCAGAGGAGATATTTTCGGACGTCCAGATCCTTATAGGGCAGTGCCCAGCCCGAGGACAGATCATTATGCTGCTGCCCAATTCCATAATTATAATCACATGAATATGAGCATGAATGTAGCTGCTCACCATGGCCCTGGGGCTTTCTTTAGGTACATGAGGCAACCCATCAAACAAGAGTTATCTTGTAAGTGGCTTGAGGAATCACCAATGAACCGTCCTCAGAAAACCTGTGACAGGACATTTAGCAGCATGCATGAACTGGTTACACATATGACAATGGAACATGTTGGGGGTCCAGAACAAAGTAATCACATATGTTACTGGGAGGAATGT
                                                  Xl3.1-CHK-1012688680                                                                                                                                                                      GTGAGTGATTGACTTTATCAGTCCAAGGACxTxxxxAGTTGGxxxxGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCAGAGGAGATATTTTCGGACGTCCAGATCCTTATAGGGCAGTGCCCAGCCCGAGGACAGATCATTATGCTGCTGCCCAATTTCATAATTATAATCACATGAATATGAGCATGAATGTAGCTGCTCACCATGGCCCTGGGGCTTTCTTTAGGTACATGAGGCAACCCATCAAACAAGAGTTATCTTGTAAGTGGCTTGAGGAATCACCAATGAACCGTCCTCAGAAAACCTGTGACAGGACATTTAGCAGCATGCATGAACTGGTTACACATATGACAATGGAACATGTTGGGGGTCCAGAACAAAGTAATCACATATGTTACTGGGAG
  5   1   2       bld Ga18 5g3  in                      xlk159c07ex.5p                                                                                                                                 ATTCAGACTGCCTCCTGAGTTGGTTTATGTGTGAGCAGTGAGTGATTGACTTTATCAGTCCAAGGACATTACTCAGTTGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGNCAATGGTCAAATGCATTTAGGACTCAGAGGAGATATTTTCGGACGTCCAGATCCTTATAGGGCAGNNNNNGCCCGAGGACAGATCATTATGCTGCTGNCCAATTCCATAATTATAATCACATGAATATGAGCATGANTGTAGCTGCTCACCATGGCCCCGGGCTTTCTTTAGATACATGAGGNAACCCATCAANNAG
  5   1   2       bld Ga15 5g3  in                       XL517n09ex.5p                                                                                                                                                                TGAGCAGTGAGTGATTGACTTTATCAGTCCAAGGACATTACTCAGTTGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCTTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCAGAGGAGATATTTTCGGACGTCCAGATCCTTATAGGGCAGTGCCCAGCCCGAGGACAGATCATTATGCTGCTGCCCAATTCCATAATTATAATCACATGAATATGANCATGAATGTAGCTGCTCACC
  5   1   2       bld Ga12 5g                              XL152a07.5p                                                                                                                                                                                 GGCACGAGGTAAGGACATTACTCCAGTTGGAGAGGGTGAACTGTTTCCAGGNATTTTCGGAAGCAAAAGGAATTAAAAGAAAACttttttttCCTGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGAACTGCACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTTACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCCAGTCATGATCTCTCCTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCGCTTGGACATCATGCTGGGCAGGTGCCATCTTATGGTGGTGCAGCCTTTAACTCCACACGCGATTTCCTTTTCCGAAATCGGAACTCTGGAATTGCGGAATCAACCTCTGCAGGTGGTCAGCATGGACTTTTTGCCAGCCATGGTCCCCC
  5   1   2       bld Neu7 5g3  in                         XL036g01.5p                                                                                                                                                                                               GACATTACTACAGTTGGAGTAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCANCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCTTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCANTGGACATGT
  5   1   2       bld DMZ  5g3  in                         xl236e06.5p                                                                                                                                                                                                GACATTACTCAGTTGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGAAAACttttttttCCTGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGAACTGCACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTTACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCCAGTCATGATCTCTCCTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCGCTTGGACATCATGCTGGGCAGGTGCCATCTTATGGTGGTGCAGCCTTTAACTCCACACGCGATTTCCTTTTCCGAAATCGGAACTCTGGAATTGCGGAATCAACCTCTGCAGGTGGTCAGCATGGACTTTTTGCCAGCCATGGTCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCTGGACTTCATGAACAAAGTTCCAGCCACGGATCATCCAATGGACATATGGTCAATAGTCAAATGCATTTAGGACTCAGGGGAGATATTTTTGGGCGTCCAGATCCTTACAGGGCAGTGCCCAGCCCAAGGACAGATCATTATGCTGCTGCC
  5   1   2       bld DMZ  5g                              xl305p11.5p                                                                                                                                                                                                AACATTACTCAGTTGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGAAAACttttttttCCTGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGAACTGCACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTTACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCCAGTCATGATCTCTCCTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCGCTTGGACATCATGCTGGGCAGGTGCCATCTTATGGTGGTGCAGCCTTTAACTCCACACGCGATTTCCTTTTCCGAAATCGGAACTCTGGAATTGCGGAATCAACCTCTGCAGGTGGTCAGCATGGACTTTTTGCCAGCCATGGTCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCTGGACTTCATGAACAAAGTTCCAGCCACGGATCATCCAATGGACATATGGTCAATAGTCAAATGCATTTAGGA
  5   1   2       bld DMZ  5g3  in                         xl331g13.5p                                                                                                                                                                                                GACATTACTCAGTTGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGAAAACttttttttCCTGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGAACTGCACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTTACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCCAGTCATGATCTCTCCTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCGCTTGGACATCATGCTGGGCAGGTGCCATCTTATGGTGGTGCAGCCTTTAACTCCACACGCGATTTCCTTTTCCGAAATCGGAACTCTGGAATTGCGGAATCAACCTCTGCAGGTGGTCAGCATGGACTTTTTGCCAGCCATGGTCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCTGGACTTCATGAACAAAGTTCCAGCCACGGATCATCCAATGGACATATGGTCAATAGTCAAATGCATTTAGGACTCAGGGGAGATATTTTTGGGCGTCCAGATCCTTACAGGGCAGTGCCCAGCCCAAGGACAGATCATTATGCTGCTGCCCAATTTCATAAT
  5   1   2       bld Ga12 5g3  in                         XL185j17.5p                                                                                                                                                                                                 ACATTACTCAGTTGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGAAAACttttttttCCTGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGAACTGCACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTTACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCCAGTCATGATCTCTCCTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCGCTTGGACATCATGCTGGGCAGGTGCCATCTTATGGTGGTGCAGCCTTTAACTCCACACGCGATTTCCTTTTCCGAAATCGGAACTCTGGAATTGCGGAATCAACCTCTGCAGGTGGTCAGCATGGACTTTTTGCCAGCCATGGTCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCTGGACTTCATGAACAAAGTTCCAGCCACGGATCATCCAATGGACATATGGTCAATAGTCAAATGCATTTAGGACTCAGGGGAGATATTTTTGGGCGTCCAGATCCTTACAGGGCAGTGC
  5   1   2       bld Ga15 5g3  in                       XL463g21ex.5p                                                                                                                                                                                                       CTCAGTTGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGAAAACttttttttCCTGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGAACTGCACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTTACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCCAGTCATGATCTCTCCTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCGCTTGGACATCATGCTGGGCAGGTGCCATCTTATGGTGGTGCAGCCTTTAACTCCACACGCGATTTCCTTTTCCGAAATCGGAACTCTGGAATTGCGGAATCAACCTCTGCAGGTGGTCAGCATGGACTTTTTGCCAGCCATGGTCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCTGGACTTCATGAACAAAGTTCCAGCCACGGATCATCCAATGGACATATGGTCAATAGTCAAATGCATTTAGGACTCAGGGGAGATATTTTTGGGCGTCCAGATCCTTACAGGGCAGTGCCCAGCCCAAGGACAGATCATTATGCTGCTGCCCAATTTCATAATTATAATCACATGAATATGAGCATGAATGTAGCTGCTCACC
  5   1   2       bld DMZ  5g3  in                         xl285a05.5p                                                                                                                                                                                                       CTCAGTTGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGAAAACttttttttCCTGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGAACTGCACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTTACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCCAGTCATGATCTCTCCTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCGCTTGGACATCATGCTGGGCAGGTGCCATCTTATGGTGGTGCAGCCTTTAACTCCACACGCGATTTCCTTTTCCGAAATCGGAACTCTGGAATTGCGGAATCAACCTCTGCAGGTGGTCAGCATGGACTTTTTGCCAGCCATGGTCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCTGGACTTCATGAACAAAGTTCCAGCCACGGATCATCCAATGGACATATGGTCAATAGTCAAATGCATTTAGGACTCAGGGGAGATATTTTTGGGCGTCCAGATCCTTACAGGGCAGTGCCCAGCC
  5   1   2       bld DMZ  5g3  in                         xl274d16.5p                                                                                                                                                                                                       CTCAGTTGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGAAAACttttttttCCTGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGAACTGCACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTTACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCCAGTCATGATCTCTCCTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCGCTTGGACATCATGCTGGGCAGGTGCCATCTTATGGTGGTGCAGCCTTTAACTCCACACGCGATTTCCTTTTCCGAAATCGGAACTCTGGAATTGCGGAATCAACCTCTGCAGGTGGTCAGCATGGACTTTTTGCCAGCCATGGTCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCTGGACTTCATGAACAAAGTTCCAGCCACGGATCATCCAATGGACATATGGTCAATAGTCAAATGCATTTAGGAC
  5   1   2       bld Ga12 5g3  in                         XL215d04.5p                                                                                                                                                                                                        CTCAGTTGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCANCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCTTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATT
  5   1   2       bld DMZ  5g3  in                         xl289o02.5p                                                                                                                                                                                                        CTCAGTTGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCTTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCAGAGGAGATATTTTCGGACGTCCAGATCCTTATAGGGCAGTGCCCAGCCCGAGGACAGATCATTATGCTGCTGCCCAATTCC
  5   1   2      seed DMZ  5g3  in                         xl267g19.5p                                                                                                                                                                                                        CTCAGTTGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCTTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCAGA
  5   1   2       bld DMZ  5g3  in                         xl251a06.5p                                                                                                                                                                                                        CTCAGTTGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCAGAGGAGATATTTTCGGACGTCCAGATCCTTATAGGGCAGTGCCCAGCCCGAGGACAGATCATTATGCTGCTGCCCAATTCCATAATTATAATCACATGAATATGAGCATGAATGTAGCT
  5   1   2       bld DMZ  5g3  in                         xl329n10.5p                                                                                                                                                                                                        CTCAGTTGGAGAGGGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCTTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCA
  5   1   2       bld Ga15 5g3  in                       XL431m21ex.5p                                                                                                                                                                                                                     GGTGAACTGTTTCCAGGATTTTCGGAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCAGAGGAGATATTTTCGGACGTCCAGATCCTTATAGGGCAGTGCCCAGCCCGAGGACAGATCATTATGCTGCTGCCCAATTCCATAATTATAATCACATGAATATGAGCATGAATGTAGCTGCTCACCATGGCCCCGGGGCTTTCTTTA
  5   1   2       bld Ga12 5g                              XL154h09.5p                                                                                                                                                                                                                       GTGAACTGTTTCCGGNATTTTCGGAAGCAAAAGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCTTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAG
  5   1   2       bld Ga15 5g3  in                       XL456j23ex.5p                                                                                                                                                                                                                                             GAAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCAGAGGAGATATTTTCGGACGTCCAGATCCTTATAGGGCAGTGCCCAGCCCGAGGACAGATCATTATGCTGCTGCCCAATTCCATAATTATAATCACATGAATATGAGCATGAATGTAGCTGCTCACCATGGCCCCGGGGCTTTCTTTAGATACATGAGGCAACCCATCAAACAANAGTTATCGTGT
  5   1   2       bld Emb1 5g                         IMAGE:6864758.5p                                                                                                                                                                                                                                              AAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAGTTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCAGAAGAGATATTTTCGGACGTCCAGATCCCTTATAGGGCAGTGCCCCAGCCCGGAAGACAGATCATTATTGCTGCTTGCCCAATTCCAGTATGTTTAATCCCCCTGACTATCGATCCAGAAATGTCGCCTGCCTCAACATGGGGCCAAGGGAGCCTTTTCTCTTATAAAACCATGAAGGCGAACCCCGTTCAAAACAGAGAGTTTATCCGTGGGAAAAATGGGCTTGGAGGGTAATCCAACCAACGGAAACCTACTCCCTCCCGAAAAATCCCTGGTTTAGCAGGGGACAATTTTTAGGCAGAACTTTGGCCNAGTAGAACGGGGGGCTTTACCCCGCTGTTC
  5   1   2       bld Emb1 5g                         IMAGE:6864781.5p                                                                                                                                                                                                                                              AAGCAAAAGGAATTAAAAGATAACTTTTTCCCCCCGAACATTCCACATGAACTGTATCCAGTGCTGACCACAGATCAGCTTGTACTGCTCAGCTCATTCATGACAATGCTATTAGATGGAGGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTTGGGACAGCTCGCCATCATGAGATGTCCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTCATGCTGCGGCTTTTAAGCTCAGTCCAGCAAGTCATGATCTTTCTTCAAGCCAGAGCTCAGCTTTTACCCCACAGGCTTCTGGATATGCCAGTTCACTTGGACATCATGCTGGGCAGGTGCCATCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCAGAGGAAATATTTTCGGACCTCCAGATCCTTATAGGGCAGTGCCCAGCCCCGAGGACAGATCATTATGCTGCTGCCCCAATTCCATAATTATAATCCCATGAAATATGAACATGAATGGTAGCTTGCCCACCATGGGCAAGGGGGCTTTTCTTTTAGATACCTTGAGGGAACCCCATCAAACAAAAAATTTACCCGTGGTAAATGGGCCTTGAGGAAATCAAACAAGGGAACCCTTCCTTCAGAAAAACCTGGTGTACCGGGGAATTTTAAGCCACGCTGGCCTTGGAATTGGTTTTACCCCCATGTGGAAAATTTGGAACACATGTTTTGGGGG
  5   1   2       bld Neu4                            IMAGE:4085028.5p                                                                                                                                                                                                                                                                                                                                                   GACAATGCTATTAGATGGATGACCGCAGTTTCCCACCCTGGGAGTTGGTGGGTTCGGGACAGCTCGCCATCATGAGATGTGCAACCGAGATGCTGGCATGGGGCTTAATCCATTCACTGAGCCTTCTAATGCTGCGGCTTTTAAGCTCAGTACATCAAGCTATGATCTGTCTTAAAGCCACAGATAAGATTTTACCTCACATGCTTCTGGATATGCCAATTCACTTGGACATCATGCTGGGCAAGTGCCATCTTACGGAGGTGCATCT
  5   1   2       bld Ga18      in                      xlk166l07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGNCATCATGCTGNNAGNNGCNTCTTACGGTGGTGCAGCCTTTAACTCAACACGCGATTTCCTTTTCCGAAATCGTAACTCTGGAATTGCAGACTCATCTTCTGCAGGCAGTCAACATGGACTTTTTGCCAACCATGGGCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCCGGACTTCATGAGCAAAGTTCCAGCCATACATCATCCAATGGACATGTGGTCAATGGTCAAATGCATTTAGGACTCAGAGGAGATATTTTCGGACGTCCAGATCCTTATAGGGCAGTGNCAGCCCGAGGACAGATCATTATGCTGCTGCCCAATTCCATAATTATAATCACATGAATATGAGCATGAATGTAGCTGCTCACCATGGCCCCGGGGCTTTCTTTAGATACATGAGGCAACCCATCAAACAAGAGTTATCGTGTAAATGGCTTGAGGAATCAACAATGAACCATCCTCAGAAAACCTGTGACAGGACATTTAGCAGCATNNATGAACTGGTTACACATATGACAATGGAACATGTTGGGGGTCCAGAACAAAATAATCACATATGCTACTGGGAGGAATGTCCCAGGGGAGGTAAATCTTTTAAAGCAAAGTATAAACTAGTGAATCATATCAGGGTGCATACCNGAGAAAAACCCTTTCCATGCCCCTTCCCTGGATGTGGGAAAATCTTTGCACGTNCAGAAAATCTCAAGATCCACAAAAGAACTCATACAGGTGAGAAGNCATTCAAGNNTGAGNTTGAANGCTGCGATA
  5   1   2       bld Neu7      in                         XL042h21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAACCTCTGCAGGTGGTCAGCATGGNACTTTTTGCCAGCCATGGTCCCCCAGGAATTGGTGAGCCCCCAGGACACCTGATCTTCCCTGGACTTCATGAACAAAGTTCCAGCCACGGATCATCCAATGGACATATGGTCAATAGTCAAATGCATTTAGGACTCAGGGGAGATATTTTTGGGCGTCCAGATCCTTACAGGGCAGTGCCCAGCCCAAGGACAGATCATTATGCTGCTGCCCAATTTCATAATTATAATCACATGAATATGAGCATGAATGTAGCTGCTCACCATGGCCCTGGGGCTTTCTTTAGGTACATGAGGCAACCCATCAAACAAGAGTTATCTTGTAAGTGGCTTGAGGAATCACCAATGAACCGTCCTCAGAAAACCTGTGACAGGACATTTAGCAGCATGCATGAACTGGTTACACATATGACAATGGAACATGTTGGGGGTCCAGAACAAAGTAATCACATATGTTACTGGGAGGAATGTCCCA
  5   1   2       bld Neu7                                 XL012i16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCACGAGGCTCAGGGGAGATATTTTTGGGCGTCCAGATCCTTACAGGGCAGTGCCCAGCCCAAGGACAGATCATTATGCTGCTGCCCAATTTCATAATTATAATCACATGAATATGAGCATGAATGTAGCTGCTCACCATGGCCCTGGGGCTTTCTTTAGGTACATGAGGCAACCCATCAAACAAGAGTTATCTTGTAAGTGGCTTGAGGAATCACCAATGAACCGTCCTCAGAAAACCTGTGACAGGACATTTAGCAGCATGCATGAACTGGTTACACATATGACAATGGAACATGTTGGGGGTCCAGAACAAAGTAATCACATATGTTACTGGGAGGAATGTCCCAGAGGAGGTAAATCTTTTAAAGCAAAGTATAAACTAGTGAATCATATCAGGGTGCACACAGGAGAGAAACCCTTTCCATGCCCCCTTTCCTGGATGTGGGAAAATCTTTGCACGTTCAGAAAATCTCAAGATCCACAAAAGAACTCATACAGGTGAGAAGCCATTCAAGTGTGAGTTCGAGGGATGCGA
  5   1   2      ests                               Xl3.1-XL518h07ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTAAAGCAAAGTATAAACTAGTGAATCATATCAGGGTGCATACCGGAGAAAAACCCTTTCCATGCCCCTTCCCTGGATGTGGGAAAATCTTTGCACGTTCAGAAAATCTCAAGATCCACAAAAGAACTCATACAGGTGAGAAGCCATTCAAGTGTGAGTTTGAAGGCTGCGATAGAAGGTTTGCAAACAGCAGCGACAGGAAAAAACATATGCATGTGCACACGTCAGATAAGCCATATATCTGCAAAGTGTGTGATAAATCCTACACTCACCCCAGCTCCCTAAGAAAGCACATGAAGGTTCATGAATCACAAGGGTCTGATTCTTCCCCTGCTGCCAGCTCAGGGTACGAATCTGCTACCCCACCAGCAATGGTTTCTGCCAACAGTGAGGAACCTTCCAAAAATTCATCAGCAACACATCAGACTAACAACAATTCTCATAACACAGGACTACTTCCACCTAATTTTAACGAATGGTATGTCTGAGCAAAATGTAGAGAGGCCTAGTCATGCTCAACAAAAGGACCATGTGCAAAAAAACAGAATCCAATTTTTTTTATGTTGAACCAAGGCGGAAATGGAATTTACCACACAAGCAACAGTATAGGGCTTCATCTTGTTAAAATAATTTACCAACATTTTCTAAAGATGGCTACAGACTAACAAAGCCCTTTTCTCAGGATCTGAACACATTTTTTGGTGTTTGTATTTCCTCTGATTTTATGCCCTTTTCATTTTAACAACTTCACTCCTTTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAATACTTGTAGATATATAAAATATTTAAGATAAAATCCTATTTATT
                                                  Xl3.1-CHK-1012688072                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAGTATAAACTAGTGAATCATATCAGGGTGCATACCGGAGAAAAACCCTTTCCATGCCCCTTCCCTGGATGTGGGAAAATCTTTGCACGTTCAGAAAATCTCAAGATCCACAAAAGAACTCATACAGGTGAGAAGCCATTCAAGTGTGAGTTTGAAGGCTGCGATAGAAGGTTTGCAAACAGCAGCGACAGGAAAAAACATATGCATGTGCACACGTCAGATAAGCCATATATCTGCAAAGTGTGTGATAAATCCTACACTCACCCCAGCTCCCTAAGAAAGCACATGAAGGTTCATGAATCACAAGGGTCTGATTCTTCCCCTGCTGCCAGCTCAGGGTACGAATCTGCTACCCCACCAGCAATGGTTTCTGCCAACAGTGAGGAACCTTCCAAAAATTCATCAGCAACACATCAGACTAACAACAATTCTCATAACACAGGACTACTTCCACCTAATTTTAACGAATGGTATGTCTGAGCAAAATGTAGAGAGGCCTAGTCATGCTCAACAAAAGGACCATGTGCAAAAAAACAGAATCCAATTTTTTTTATGTTGAACCAAGGCGGAAATGGAATTTACCACACAAGCAACAGTATAGGGCTTCATCTTGTTAAAATAATTTACCAACATTTTCTAAAGATGGCTACAGACTAACAAAGCCCTTTTCTCAGGATCTGAACACATTTTTTGGTGTTTGTATTTCCTCTGATTTTATGCCCTTTTCATTTTAACAACTTCACTCCTTTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAATACTTGTAGATATATAAAATATTTAAGATAAAATCCTATTTATTTGAAGA
  5   1   2       bld Ga15                               XL432l02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCATTCAAGTGTGAGTTTGAAGGCTGCGATAGAAGGTTTGCAAACAGCAGCGACAGGAAAAAACATATGCATGTGCACACGTCAGATAAGCCATATATCTGCAAAGTGTGTGATAAATCCTACACTCACCCCAGCTCCCTAAGAAAGCACATGAAGGTAAGTTTTATTGTTCTGAATTAACATGCTTAAATGTTGTAAAGAAATATTTGTACATATAAATAGGTATGaaataaaaaataaaaaTGAGGAATTCCACAGTTTCTGTTTACTCTCAAATTCCTCTGTCACAACCGGTGAACTATACCTTCACCACAAACCTAAACTTCACCCGAGAATGCcttataatatttatatttttaatgatcataaacaatttcatatttttatactttattGGCATATATCAATTGTGTTTCTTCTATAGTTATCTACTCAATTCAGGATGCGTTTACGGCCTTACAAATTACGTTCATTATGAACATTTCATTGCATAACAGTTTTATCTAATTTTATACTCTGCTTTTAGGTTCATGAATCACAAGGGTCTGATTCTTCCCCTGCTGCCAGCTCAGGGTACGAATCTGCTACCCCACCAGCAATGGTTTCTGCCAACAGTGAGGAACCTTCCAAAAATTCATCAGCAACACATCAGACTAACAACAATTCTCATAACACAGGACTACTTCCACCTAATTTTAACGAATGGTATGTCTGAGCNAAAATGTAGAGAGGCCCTAGTCATGCTCAACAAAAGGACCATGTGC
  5   1   2       bld Ga18      in                      xlk148j16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATATGACAATGGNACATNTTGGGGGNCCAGAACAAAATAATCACATATGCTACTGGGAGGAATGTCCCAGGGGAGGTAAATCTTTTAAAGCAAAGTATAAACTAGTGAATCATATCAGGGTGCATACCGGAGAAAAACCCTTTCCATGCCCCTTCCCTGGATGTGGGAAAATCTTTGCACGTTCAGAAAATCTCAAGATCCACAAAAGAACTCATACAGGTGAGAAGCCATTCAAGTGTGAGTTTGAAGGCTGCGATAGAAGGTTTGCAAACAGCAGCGACAGGAAAAAACATATGCATGTGCACACGTCAGATAAGCCATATATCTGCAAAGTGTGTGATAAATCCTACACTCACCCCAGCTCCCTAAGAAAGCACATGAAGGTTCATGAATCACAAGGGTCTGATTCTTCCCCTGCTGCCAGCTCAGGGTACGAATCTGCTACCCCACCAGCAATGGTTTCTGCCAACAGTGAGGAACCTTCCAAAAATTCATCAGCAACACATCAGACTAACAACAATTCTCATAACACAGGACTACTTCCACCTAATTTTAACGAATGGNATGTCTGAGCAAAATGTAGAGAGGNCTAGTCATGCTCAACAAAAGGACCATGTGCAAAAAAACAGAATCCAAttttttttATGTTGAACCAAGGCGGAAATGGAATTTACCACACAAGCAACAGTATAGGNCTTCATCTTGTTAAAATAATTTACCAACATTTTCTAAAGATGGCTACAGA
  5   1   2      shim Ga15      in                       XL518h07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCTTTTAAAGCAAAGTATAAACTAGTGAATCATATCAGGGTGCATACCGGAGAAAAACCCTTTCCATGCCCCTTCCCTGGATGTGGGAAAATCTTTGCACGTTCAGAAAATCTCAAGATCCACAAAAGAACTCATACAGGTGAGAAGCCATTCAAGTGTGAGTTTGAAGGCTGCGATAGAAGGTTTGCAAACAGCAGCGACAGGAAAAAACATATGCATGTGCACACGTCAGATAAGCCATATATCTGCAAAGTGTGTGATAAATCCTACACTCACCCCAGCTCCCTAAGAAAGCACATGAAGGTTCATGAATCACAAGGGTCTGATTCTTCCCCTGCTGCCAGCTCAGGGTACGAATCTGCTACCCCACCAGCAATGGTTTCTGCCAACAGTGAGGAACCTTCCAAAAATTCATCAGCAACACATCAGACTAACAACAATTCTCATAACACAGGACTACTTCCACCTAATTTTAACGAATGGTATGTCTGAGCAAAATGTAGAGAGGCCTAGTCATGCTCAACAAAAGGACCATGTGCAAAAAAACAGAATCCAAttttttttATGTTGAACCAAGGCGGAAATGGAATTTACCACACAAGCAACAGTATAGGGCTTCATCTTGTTAAAATAATTTACCAACATTTTCTAAAGATGGCTACAGACTAACAAAGCCCTTTTCTCAGGATCTGAACACATTTTTTGGTGTTTGTATTTCCTCTGATTTTATGCCCTTTTCATTTTAACAACTTCACTCCtttttttttttt
  5   1   2      shim DMZ       in                         xl329c16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAGATCAGTCTCAGGCAACAATGTGAATTTCATTAAGTGAGAAGCCATTCAAGTGTGAGTTTGAAGGCTGCGATAGAAGGTTTGCAAACAGCAGCGACAGGAAAAAACATATGCATGTGCACACGTCAGATAAGCCATATATCTGCAAAGTGTGTGATAAATCCTACACTCACCCCAGCTCCCTAAGAAAGCACATGAAGGTTCATGAATCACAAGGGTCTGATTCTTCCCCTGCTGCCAGCTCAGGGTACGAATCTGCTACCCCACCAGCAATGGTTTCTGCCAACAGTGAGGAACCTTCCAAAAATTCATCAGCAACACATCAGACTAACAACAATTCTCATAACACAGGACTACTTCCACCTAATTTTAACGAATGGTATGTCTGAGCAAAATGTAGAGAGGCCTAGTCATGCTCAACAAAAGGACCATGTGCAAAAAAACAGAATCCAAttttttttATGTTGAACCAAGGCGGAAATGGAATTTACCACACAAGCAACAGTATAGGGCTTCATCTTGTTAAAATAATTTACCAACATTTTCTAAAGATGGCTACAGACTAACAAAGCCCTTTTCTCAGGATCTGAACACATTTTTTGGTGTTTGTATTTCCTCTGATTTTATGCCCTTTTCATTTTAACAACTTCACTCCttttttttttttAAA
  3   1   2       bld Ga18      in                      xlk148j16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTCAGNAANTCNNCAGATCCACAAANNNACTCANNNNGNGAGAAGCCATTCAAGNNNGAGTTTNANGNCTGCNATAGNAGNTTTGCNACAGNAGCNACANGAAAANACATATGNATGNNNNCNCNTCAGANAANNCATANNTCTGCAAAGTGTGTGATAANTNCTANNNTCACCCCAGCTCCCTNAGNAAGCACATNNAGGTTCATGAATCACAAGGGTCTGATTCTTCCCCTGCTNCCAGCTCAGGGTACGAATCTGCTNCCCCNCCAGCAATGGTTTCTGCCAACAGTGANGANNNTTCCAAAAATTCATCAGCAACACATCAGACTAACAACAATTCTCATAACACAGGNCTACTTCCNCCTAATTTTAACGAATGGTATGTCTGAGCAAAATGTAGAGAGGCCTAGTCATGCTCAACAAAAGGACCATGTGCAAAAAAACAGAATCCAATTTTTTTTATGTTGAACCAAGGCGGAAATGGAATTTACCACACAAGCAACAGTATAGGGCTTCATCTTGTTAAAATAATTTACCAACATTTTCTAAAGATGGCTACAGACTAACAAAGCCCTTTTCTCAGGATCTGAACACATTTTTTGGTGTTTGTATTTCCTCTGATTTTATGCCCTTTTCATTTTAACAACTTCNCTCCTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAANNNNNTANCAT
  5   1   2       bld Ga15      in                       XL457e24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCCGCGAGGGATGCGATAGAAGGTTTGCAAACAGCAGTGACAGGAAAAAACACATGCATGTGCACACGTCAGATAAGCCATATATCTGCAAAGTGTGTGATAAATCCTACACTCACCCCAGCTCCCTAAGAAAGCACATGAAGGTTCATGAATCACAAGGGTCTGATTCTTCTCCTGCTGCCAGCTCAGGGTACGAATCTGCTACCCCACCAGCAATGGTTTCTGCCAACAGTGAGGAACCTTCCAAAAATTCTTCAGCAACACATCAGACTAACAGCAACTCTCATAACACAGGACTACTTCCATCTAATTTTAATGAATGGTATGTTTGAGCAAAATGTACAGAGGCCTAGTCATGCTCAACAAAAGGACCAAAAAAAGAGAATACAATTTTTTTGTTGAACCAAGGCGGAAATGGAATTTACCACACAAGCAACAGTATAGGGCTTCATATTGTTAAAATCATTTACCAACATTTTTAAAGATGGCTGCGGACTAACGATGCCCTTTTCTCAGGATCTAAACACATTTTTTGGCGTTTGTATTTCTTCTGATTTTATGTTCTCCCCTTTTCATTTTAAAACAACTTCACTCtttttttttttttttAAAAAANTTAAANGGTTTTTANC
  5   1   2       bld Ga15                               XL406m06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAATCCTACACTCACCCCAGCTCCCTAAGAAAGCACATGAAGGTTCATGAATCACAAGGGTCTGATTCTTCCCCTGCTGCCAGCTCAGGGTACGAATCTGCTACCCCACCAGCAATGGTTTCTGCCAACAGTGAGGAACCTTCCAAAAATTCATCAGCAACACATCAGACTAACAACAATTCTCATAACACAGGACTACTTCCACCTAATTTTAACGAATGGTATGTCTGAGCAAAATGTAGAGAGGCCTAGTCATGCTCAACAAAAGGACCATGTGCAAAAAAACAGAATCCAAttttttttATGTTGAACCAAGGCGGAAATGGAATTTACCACACAAGCAACAGTATAGGGCTTCATCTTGTTAAAATAATTTACCAACATTTTCTAAAGATGGCTACAGACTAACAAAGCCCTTTTCTCAGGATCTGAACACATTTTTTGGTGTTTGTATTTCCTCTGATTTTATGCCCTTTTCATTTTAACAACTTCACTCCttttttttttttttAAAAAANTNAA
  3   1   2       add DMZ       in                         xl329c16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CNCCTAATTTTAACGAATGGTATGTNTGAGCAAAATGTAGNGAGGCCTAGTCATGCTCAACAAAAGGNCCATGNGCAAAAAAACAGAATCCAATTTTTTTTATGTTGAACCAAGGCGGAAATGGAATTTNCCNCNCNAGCAACNGNATAGGGNTTCATCTTGTTAAAATAATTTACCAACNTTTTNTAAAGATGGNTACAGNCTAACAAAGCCCTTTTCTCNGGNTNTGAACNCNTTTTTTGGGGNTTGNATTTCCTCTGATTTTATGCCCTTTTCATTTTAACAACTTCNCTCCTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAAATCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTNCTGTAAATACTTATCCACCGATGCCANATATTTATCNTTNGTAACTTTAATTATTGATACCAAGTGCCGGGAAG
  3   1   2       bld DMZ  5g3  in                         xl267g19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACAAAAGGNCCATGNGCAAAAAAACAGAATCCAATTTTTTTTATGTTGAACCAAGGCGGAAATGGAATTTNCCACCCAAGCNACNGNATAGGGCTTCNTCTTGTTAAAATAATTTACCNACNTTTTNTAAAGNNGGGTACNGNCTAACAAAGCCCTTTTNTCNGGNTNTGNACNCNTTTTTTGGGGNTTGNATTTCCTCNGNTTTTATGCCCNTTTCNTTTTAACAACTTCNCTCCNTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCT
  5   1   2       bld Ga18      in                       xlk68a24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTTCATCTTGTTAAAATAATTTACCAACATTTTCTAAAGATGGCTACAGACTAACAAAGCCCTTTTCTCAGGATCTGAACACATTTTTTGGTGTTTGTATTTCCTCTGATTTTATGCCCTTTTCATTTTAACAACTTCACTCCttttttttttttttAAAGAAANTAAGAGGNCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAANTTAATTATTGATACAAGTGCCGGGAANTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTNATAACTGCTNNNNNNTAAAAATGATTGTTTTGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL518h07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTCNTNTTGTTAAAANAATTTACCCACATTTTNTAAAGANGGNTNCNGNCTAACNAAGCCCTTTTTTCNGGNTNTGNACCCNTTTTTTGGGGGTTGGANTTCCTCNGNNTTTANGCCCNTTTCNTTTTAACNACTTCCCNCCNTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAATACTTGTAGATATATAAAATATTTAAGATAAAATCCTAT
  3   1   2       add DMZ                                 rxl288l04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATCTTGTTAAAATAATTTACCNACNTTTTTTAAAGANGGNTACAGNCTAACAAAGCCCTTTTNTCAGGNTNTGAACNCNTTTTTTGGGGGTTGNATTTCCTCTGANTTTATGCCCTTTTCATTTTAACAANTTCNCTCCTTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGANTGTGATGTTCATACACAGANTGTGACCATTCAGTACAGTTGCCTTTCGTAAGAACTTTNGNAAATACNTGCTCCACGATGCCANACATTNATCA
  5   1   2       bld Ga18      in                      xlk125n09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TACAGACTAACAAAGCCCTTTTCTCAGGATCTGAACACATTTTTTGGTGTTTGTATTTCCTCTGATTTTATGCCCTTTTCATTTTAACAACTTCACTCCtttttttttttttAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTNNNNNNTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGNCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAANACTTGTAGNNATATAAAANATTTAAGANAAAATCCTANTTNNNTTTGANG
  3   1   2       bld DMZ  5g3  in                         xl251a06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCCCTTTTNTCNGGNTNTGAACNCNTTTTTNGGGGNTTGNATTTCCTCGGANTTTANGCCCNTTTCATTTTAACNACTTCCCNCCTTTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAATAGCTTGTAGATATATAAAATAT
  3   1   2       bld DMZ  5g3  in                         xl289o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTTGGGGNTTGNATTTCCTCNGNTTTTATGCCCNTTTCATTTTAACAACTTCCCTCCTTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTNTNCAGCTCGCTGGAGCAATACTTG
  3   1   2       bld DMZ  5g3  in                         xl329n10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTANGCCCNTTTCANTTTAACNACTTCCCTCCTTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTNTNCAGCTTGNTNGAGCAATACTTGTAGATATATAAAATAT
  3   1   2       bld Ga15 5g3  in                       XL517n09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCCNTTTCNNTTTAACNACNTCCCNCCCTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAATACTTGTAGATATATAAAATATTTAAGATAAAATCCTATTTATTTGAAGAATAAAGTATAACTGAAGTAC
  3   1   2       bld Ga12 5g3  in                         XL215d04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTCATTTTAANAANTTCNCTCCTTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAATACTTGTAGATATATAAAATATTTAAGATAAAATCCTATTTATTTGAAGAATA
  3   1   2       bld Neu7 5g3  in                         XL036g01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGNTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAGAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAANTGGTCATCAACAAACTATAATTTTTCAGTCTTGTTTGAGCAATANCTTGTAGATATATAAAATATTTAAGA
  3   1   2      seed Ga12                                 XL185n19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTTTTTTTTTTTTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAATACTTGTAGATATATAAAATATTTAAGATAAAATCCTATTTATTTGAAGAANAA
  3   1   2       add Ga15 5g3  in                       XL431m21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GNTTTTNTNNGNNAANGAAATTAAGAGGTCTNTAGCTAATGTACTTAGAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCNTAAACAGTGCCAAAGTCTTGTTATTTCTCGAGCCTAACTCAAAGCANTACACTTGTGAANGTATTCCTTGTCNTATAGGGTCAAAGCTGTNGNGTGGCATATTTTCAGAAATGGGAATGNGATGTTCATACACAGATTGTGACCATTTAGTACAGTGTGCCTTTTGTAAGACCTTCTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCNGTATAGCTTTTGGTTATAACTGCTNTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTNTAACCAATGTTTGTTTACGTCATGCAATGCTGAAACTGATGACAATATTCTGATTCTGCTGTAGCTNATTGGTCATCAANAACTATAATTNTTCAGCTTGTNTGAGCAATAGCTTGTAGATATATANAATACTTAAGCTCAAATCCTA
  3   1   2       bld DMZ                                 rxl290o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTNTTTTTNTNTAAAGAAATTAAGAGGTCTTTAGCTAATGTACTTAAAATTCTCTTCACCTTTGTGGTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTNGTGAATGTATTCCTNGTCTNATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTCGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATNCAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGNTTTTCTAACAAAACTCTGTATAGCTTTNGGTTATAACTGCTNTAGCNTTAAAAATGANTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAANGCTGAAACTAATGACAATATTCNGANTCTGCTGTATTAATTGGTCATCAAAAACTATACATTNT
  3   1   2       bld Ga15 5g3  in                       XL456j23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTTTTTAAAGAAATTAAGAGGTCTNTAGCTAATGTACNTAAAATTCTCTTCACCTTNGTGGTGAANGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCNTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAATACTTGTAGATATATAAAATATTTAAGATAAAATCCTATT
  3   1   2       bld Ga18      in                      xlk125n09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAAGCTNATGTACTTAAAATTCTCNNNNNCTTTGTGNTGAATGTTANACTCTCACATTCTTAAACAGTGNCAAAGTCTTGTTATTTCTTGANNCTNACTCAAAGCATNACACTTGTGAATGTATTNCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAATACTTGTAGATATATAAAATATTTAAGATNNNNNNTNNNNTNTGNAGA
  3   1   2       add Ga18 5g3  in                      xlk159c07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGNCTTAAAATTCNNNNCNCCTTTGNGGTGNNTNNNANANTCTNNCNTTCTTAAANAGTGCCAAAGNCNNGTTATTTCTTGAACCTNACTCAAAGCATNACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAANGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACANNNTCNGTANAGC
  3   1   2       add Ga18      in                       xlk68a24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CNNAAAATTCTCNNNACCTNTGTGGNGANTGTTAAACTCTNACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTNNCTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAANGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGNGNCCATTTAGTACANTTNCCTTTTGTAAGAACTTTTGTAAATACTTATCCNNGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTANNAGAAAAAAANTTTNNCTNACAANNTCTGTANAGCNNTTGG
  3   1   2       chi Ga18                               rxlk6m09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGGTNNNTGTNNNNNTNTNACATTCNNANACAGTGCCAAAGNCNNGTTATTTCNNGNNNCTNNCTCAAAGCATNACNCTNGNGAATGTATTCCTTGTCTTATAGGGTCAANGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAATACTTGTAGATATATAAAANNTNTAAGA
  5   1   2       bld Emb1                   IMAGE:6636619-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTaaaaaaaaaaaaaaa
  5   1   2       bld Emb1                            IMAGE:6636619.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAATGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATTTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  3   1   2       bld Ga18      in                      xlk166l07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ANTCTTNNACAGTNCCAAAGTCTTGTTATTTCTTGNNCCTNNCTCAAAGCATNANNCTTGTGAATGTATTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGCATATTTTCAGAAATGGGAATGTGATGTTCATACACAGATTGTGACCATTTAGTACAGTTGCCTTTTGTAAGAACTTTTGTAAATACTTATCCACGATGCCATATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAGAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAAATGATTGTTTTGAAGAATTCCCATTTAAGCTGTCTAACAAATGTTTGTTTACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATCAAAAACTATAATTTTTCAGCTTGTTTGAGCAATACTTGTAGATATATAAAATA
  5   1   2      en>5                                 Xl3.1-xl236e06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTTTTTTTTTAAAGAAATTAAGAGGTTTTTAGCTGATGTATTTAACATGAAAATTCTCCACCTTGTTGGTGATTGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATGTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTACTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGTATATTTTCAGAAATGGGGATGTGATGTTCATACACAGATTGTGACCGTTTAGTACAGTTGCCTTTTGTAACAACTTTTGTAAATACATATCCACGATGCCATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAAAAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAATGTATTGTTTTGAAGAATTCCCATTTAAACTGTCTAACAAATGTTTGTTTACTTCATGCAACACTGAAACTAATGAAAATATTCTGATTCTGCTGTATTAATTGGACATCAAAAACTATAATTTTTCAGCTTGTTTGGGCAATACTTGTAGATATATG
                                                  Xl3.1-CHK-1012693337                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTAAAGAAATTAAGAGGTTTTTAGCTGATGTATTTAACATGAAAATTCTCCACCTTGTTGGTGATTGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATGTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTACTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGTATATTTTCAGAAATGGGGATGTGATGTTCATACACAGATTGTGACCGTTTAGTACAGTTGCCTTTTGTAACAACTTTTGTAAATACATATCCACGATGCCATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAAAAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAATGTATTGTTTTGAAGAATTCCCATTTAAACTGTCTAACAAATGTTTGTTTACTTCATGCAACACTGAAACTAATGAAAATATTCTGATTCTGCTGTATTAATTGGACATCAAAAACTATAATTTTTCAGCTTGTTTGGGCAxxxxTxxxxxxxxxxxxGAAATA
  3   1   2       add Ga15 5g3  in                       XL463g21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACNAAAGGGCCCAAAAAAGGGNANACNATTTTTTTGNNGNACCCAGGGGGGAAAGGNANTTTCCCCCCCAGCCNCCGNNTNGGGGTTCNNNTTGNTAAAANCCNTTNCCCNCCNTTTTNAAGNGGGGNGGGGGNTAACGNNGCCCCTTTTTCnGGnTTTnAACCCnnTTTTTGGGGGTTGGAnTTTTTTTGnnTTTAnGNTTNCCCCCTTTCNNTTTAAAACNACNTCCCNNNTTTTTTTTTTTTTAAAGAAATTAAGAGGTTTTTAGCTGATGTATTTAACATGAAAATTCTCCNCCTTGTTGGNGATTGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATGTCTTGAACCTAACTCAAAGCNTTACNCTTGNGAATGTACTCCTTGTCTTATAGGGTCAAAGCTGTTGNGTGGTATATTTTCAGAAATGGGGATGNGATGTTCATACNCAGATTGNGNCCGTTTAGTACAGTTGCCTTTTGTAACAACTTTTGTAAATACATATCCCCGATGCCATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAAAAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAAC
  3   1   2       bld DMZ  5g3  in                         xl274d16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAACGNTGCCCTTTTNTCNGGNTNTAAACNCNTTTTTTGGNGNTTGNANTTNTTCTGNNTTTANGNTCTCCCCNTTTCNTTTTAAAACAACTTCNCTCTTTTTTTTTTTAAAGAAATTAAGAGGTTTTTAGCTGATGTATTTAACNTGAAAATTCTCCNCCTTAGTGGTGATTGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATGTCTTGAACCTAACTCAAAGCNTTACACTTGNGAATGTACTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGTATATTTTCAGAAATGGGGATGTGATGTTCATACACAGATTGTGACCGTTTAGTACAGTTGCCTTTTGTAACAACTTTTGTAAATACATATCCNCGATGCCATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAAAAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAATGTATTGTTTTGAAGAATTCCCATTTAAACTGTCTAACAAATGT
  3   1   2       bld Gas3                              xlnga002i15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTGGCGATGTATTCTCTAATTTATGTCTCCCCTTTCATTTAAACACGTCACTTTTTTTTGTTTAAAGAAATAAGAGGTTTTAGCTGATGTATTAACATGAAATTCTCCACCTTGTTGGTGATTGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATGTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTACTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGTATATTTTCAGAAATGGGGATGTGATGTTCATACACAGATTGTGACCGTTTAGTACAGTTGCCTTTTGTAACAACTTTTGTAAATACATATCCACGATGCCATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACCAATATTTATGAAAAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAATGTATTGTTTTGAAGAATTCCCATTTAAACTGTCTAACAAATGTTTGTTTACTTCATGCAACACTGAAACTAATGAAAATATTCTGATTCTGCTGTATTAATTGGACATCAAAAACTATAATTTTTCAGCTTGTTTGGGCAATACTTGTAGATATATGAAATATTTAAGATAAGATCCTATTTATTTTGAAGAATAAAGTATAACTGAAGTACTCGTTGAAAAAAAAAA
  3   1   2       add DMZ  5g3  in                         xl285a05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GNATTTAAGGTNTCCCCCTTTCNTTTTAAAACNACNTCCCNNTTTTTTTTTTTTTAAAGAAATTAAGAGGTTTTTAGCTGATGTATTTAACNTGAAAATTCTCCNCCTTGTTGGTGATTGTTAAACTCTCACNTTCTTAAACAGTGCCAAAGTCTTGTTATGTCTTGAACCTAACTCAAAGCNTTACNCTTGTGAATGTACTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGTATATTTTCAGAAATGGGGATGTGATGTTCATACNCAGATTGTGACCGTTTAGTACNGTTGCCTTTTGTAACAACTTTTGTAAATACATATCCNCGNTGCCATATTTATCNTTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAAAAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAATGTATTGTTTTGAAGAATTCCCATTTAAACTGTCTAACAAATGTTTGTTTACTTCATGCAACACTGAAACTAATGAAAATATTCTGATTCTGCTGTATTAATTGGACATCAAAAACTATAATNTTTCAGCTTGTTTGGGCAATAGCNTGTAGATATATGAAATATCTAAGATAAGATC
  3   1   2       bld DMZ  5g3  in                         xl331g13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTANGNTNTCCCCCTTTCNNTTTAAAACNACNTCCCTNTTTTTTTTTTTTTTAAAGAAATTAAGAGGTTTTTAGCTGATGTATTTAACATGAAAATTCTCCACCTTGTTGGTGATTGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATGTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTACTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGTATATTTTCAGAAATGGGGATGTGATGTTCATACACAGATTGTGACCGTTTAGTACAGTTGCCTTTTGTAACAACTTTTGTAAATACATATCCACGATGCCATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAAAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAATGTATTGTTTTGAAGAATTCCCATTTAAACTGTCTAACAAATGTTTGTTTACTTCATGCAACACTGAAACTAATGAAAATATTCTGATTCTGCTGTATTAATTGGACATCAANANTCTATAATNTNTCAGCTNGTGTGGGC
  3   1   2       add Ga15      in                       XL457e24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TNNCCCCCTTTCCTTTTAAAACNNCNNCCCNNNTTTTTTTTTTTTTTAAAGAAATTAAGAGGTTTTTAGNTGATGTATTTAACATGAAAATTCTCCCCCTTAGNGGNGATTGTTAAACTCTCNCATTCTTAAACAGNGCCAAAGTCTTGTTATGTCTTGAACCTAACTCAAAGCNTTACNCTTGNGAATGTACTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGTATATTTTCAGAAATGGGGATGNGATGTTCATACNCAGATTGTGACCGTTTAGTACAGTTGCCTTTTGTAACNACTTTTGTAAATACATATCCCCGATGCCATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAAAAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAATGTATTGTTTTGAAGAATTCCCATTTAAACTGTCTAACAAATGTTTGTTTACTTCATGCAACACTGAAACTAATGAAAATATTCTGATTCTGCTGTATTAATTGGACATCAAAAACTATAATTTTTCAGCTTGTTTGGGCAATACTTGTAGATATATGAAATATNTAAGATAAGATCCTATT
  5   1   2       bld Ga18      in                       xlk61a06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTTTTAAAACAACTTCACTCtttttttttttttttAAAGAAATTAAGAGGTTTTTAGCTGATGTATTTAACATGAAAATTCTCCACCTTGTTGGTGATTGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATGTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTACTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGTATATTTTCAGAAATGGGGATGTGATGTTCATACACAGATTGTGACCGTTTAGTACAGTTGCCTTTTGTAACAACTTTTGTAAATACATATCCACGATGCCATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGaaaaaaaaaaGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTNNNNNNTAAAATGTATTGTTTTGAAGAATTCCCATTTAAACTGTCTAACAAATGTTTGTTTACTTCATGCAACACTGAAACTAATGAAAATATTCTGATTCTGCTGTATTAATTGGACATCAAAAACTATAATTTTTCAGCTTGTTTGGGCAATACTTGTAGATATATGAAATATTTAAGANAAGATCCTATTTATTTTGAAGAATAAAGNATAACTGAAGNA
  3   1   2      seed DMZ  5g3  in                         xl236e06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTCNTTTTAAAACAACTTCCCNCTTTTTTTTTTTTTTAAAGAAATTAAGAGGTTTTTAGCTGATGTATTTAACATGAAAATTCTCCACCTTGTTGGTGATTGTTAAACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATGTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTACTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGTATATTTTCAGAAATGGGGATGTGATGTTCATACACAGATTGTGACCGTTTAGTACAGTTGCCTTTTGTAACAACTTTTGTAAATACATATCCACGATGCCATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAAAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAATGTATTGTTTTGAAGAATTCCCATTTAAACTGTCTAACAAATGTTTGTTTACTTCATGCAACACTGAAACTAATGAAAATATTCTGATTCTGCTGTATTAATTGGACATCAAAAACTATAATTTTTCAGCTTGTTTGGGCAATACTTGTAGATATANGAA
  3   1   2       chi Ga18                             rxlk144j15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTCTCTTNTnnnnnnnnAAAGAAANNNAAGAGGTTTNNTAGCTGATGNATNNNACATGAAAATTCTCCNNCTNNTNGGTGANNGNNANACTCNCACANTCNNAAANAGNNCCAAAGTCTTGTTATGTCTTGANCCTAACTCAAAGCATTACNCTTGTGAATGTACTCCTTGTCTNANAGGGTCAAAGCTGTTGTGTGGTATATTTTCAGAAATGGGGATGTGATGTTCATACACAGATTGTGACCGTTTAGTACAGTTGCCTTTTGTAACAACTTTTGTAAATACATATCCACGATGCCATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAAAAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAATGTATTGTTTTGAAGAATTCCCATTTAAACTGTCTAACAAATGTTTGTTTACTTCATGCAACACTGAAACTAATGAAAATATTCTGATTCTGCTGTATTAATTGGACATCAAAAACTATAATTTTTCAGCTTGTTTGGGCAATACTTGTAGATATATGAAATATTTAAGATAAGT
  3   1   2       add Neu7      in                         XL042h21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACTNTTTTTTTTTTTTTTAAAGAAATTAAGAGGTTTTTAGCTGATGTATTTAACATGAAAATTCTCCACCTTAGTGGTGATTGTTAAACTCTCACATTNTTAAACAGTGCCAAAGTCTTGTTATGTCTTGAACCTAACTCAAAGCATTACACTTGTGAATGTACTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGTATATTTTCAGAAATGGGGATGTGATGTTCATACACANATTGTGACCGTTTAGTACAGTTGCCTTTTGTAACAACTTTTGTAAATACATANCCACGATGCCATATTTATCATTTGTAATTTAATTATTGANACAAGGGCCGGGAACTGAACAATATTTATGAAAAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTGGTTATAACTGCTTTAGCATTAAAATGTGATTGTTTTGAAGAATTNCCCATTTAAACTGGCNAACAAA
  3   1   2       bld Ga18                             rxlk123e18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTAGNTGATGTATTTAACATGAAAATTCTCCACCTNGTTGGTGATTGTTANACTCTCACATTCTTAAACAGTGCCAAAGTCTTGTTATGTCTNGAACCTAACTCAAAGCATTACACTTGTGAATGTACTCCTTGTCTNATAGGGTCAAAGCTGTTGTGTGGTATATTTTCAGAAATGGGGATGTGATGTTCATACACAGATTGTGACCGTTTAGTACAGTTGCCTTTTGTAACAACTTTTGTAAATACATATCCACGATGCCATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAAAAAAAAAAGTTTTTCTAACAAANCTCTGTATAGCTTT
  3   1   2       add Ga12 5g3  in                         XL185j17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGANGTATTTGACATGAAAATTCTCCNCCTTAGTGGTGATTGNTAAACTCTCACATTNTTAAACAGTGCCAAAGTNTTGTTATGTCTTGAACCTAACTCAAAGCANTACACTTGTGAATGTNCTCCTTGTCTTATAGGGTCAAAGCTGTTGTGTGGTATATTTTCAGNAATGGGGATGTGANGTTCATNCACAGATTGTGGCCGTTTAGTNCAGTTGCCTTTNGNAACAACTTTTGTAAATACATATCCNCGATGCCATATTTATCATTTGTAATNTAATTANTGATNCAAGTGCCGGGAANTGAACAATATTTANGAAAAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAATGTATTGTTNTGAAGAATTCCCATTTAAACTGTCTAACAAATGTTTGTNNACTTCATGCA
  3   1   2       add Ga18      in                       xlk61a06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGTGATGNTCANNNNCNGATTGNGNCCGTTTAGNACAGTTNCCTTTTGTAACNNCTTTTGNAAATACATNTCCACGATGCCATATTTATCATTTGTAATTTAATTATTGATACAAGTGCCGGGAACTGAACAATATTTATGAAAAAAAAAAGTTTTTCTAACAAAACTCTGTATAGCTTTTGGTTATAACTGCTTTAGCATTAAAATGTATTGTTTTGAAGAATTCCCATTTAAACTGTCTAACAAATGTTTGTTTACTTCATGCAACACTGAANCTAATGAAAATATTCTGATTCTGCTGTATTAATTGGACATCAAAAACTATAATTTTTCAGCTTGTNTGGGCAANACNNGTAGATATATGAAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)