Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6316411.5.5                    56 PI      83         24     1582                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012837827 Xl3.1-xlk68b07ex.3.5 - 50 ESTs
                                                                       .....-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-xlk68b07ex.3.5                                                                                                                                                                                                                                  CGCTGTGTCGGCTGCGGACTAGGTTTGCTGACGGCTTCCTGTTCCCTGCACGCTTTGCTTGGAGTTTGAAGGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAAGGGATCACGGACACAAGGTCTCCCACTGTGGATAAGATTCTTGTGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGACCGTTGCCATGGATTGTGAGATGGTTGGAGTGGGGATGGATGGTGAGGAGAGTATTTTAGCCCGTGTCTCCATTGTCAATCTGTTTGGCAAGTGTGTGTATGACAAGTATGTCAAGCCAACGGAACGAGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGGCCTGAGGACGTGAAGAAGGGGGAACCCTTTAAAGTTGTTCAGAAGGAGGTTTCAGAAATTCTCAGAGGGCGAACCCTAGTCGGACACGCTGTGCACAATGACCTGAAGATTCTTTTCTTAGATCACCCCAAAAAGGCCATCAGGGACACCCAGAAATACAAACCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCCTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGATTATTTTATTTTTATTAAATGAGATTGGTGCCTGAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012722304                                                                                                                                                                                                                                        GTCGGCTGCGGACTAGGTTTGCTGACGGCTTCCTGTTCCCTGCACGCTTTGCTTGGAGTTTGAAGGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAAGGGATCACGGACACAAGGTCTCCCACTGTGGATAAGATTCTTGTGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGACCGTTGCCATGGATTGTGAGATGGTTGGAGTGGGGATGGATGGTGAGGAGAGTATTTTAGCCCGTGTCTCCATTGTCAATCTGTTTGGCAAGTGTGTGTATGACAAGTATGTCAAGCCAACGGAACGAGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGGCCTGAGGACGTGAAGAAGGGGGAACCCTTTAAAGTTGTTCAGAAGGAGGTTTCAGAAATTCTCAGAGGGCGAACCCTAGTCGGACACGCTGTGCACAATGACCTGAAGATTCTTTTCTTAGATCACCCCAAAAAGGCCATCAGGGACACCCAGAAATACAAACCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCCTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGATTATTTTATTTTTATTAAATGAGATTGGTGCCTGAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                       2     2     2     2     2     2     2     3     4     5     4     7    10    12    11    15    12    15    12    15    12    15    12    16    12    16    13    16    13    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    17    15    17    15    17    17    18    17    19    17    19    18    19    18    19    18    19    18    19    18    19    17    20    18    21    18    22    18    22    20    22    19    22    20    22    20    22    20    22    20    22    20    22    20    22    21    23    22    24    22    24    21    23    20    22    19    22    20    22    20    21    20    21    19    21    15    21    17    21    14    21    14    20    12    17    12    17    12    17    11    17    11    16     9    16    10    16     9    15     7    14     8    13     8    13     8    13     8    14     9    13     9    13     7    10     4     7     5     8     5     8     6     8     6     8     6     8     5     9     7     9     7     9     7     9     6     9     5    10     5    12     6    14     6    14     6    14     7    14     6    14     6    14     7    14     7    14     8    14     8    14     7    14     8    13     9    15    10    16    11    16    11    18    14    20    15    21    16    21    15    20    16    20    16    20    15    20    16    20    16    20    17    19    16    19    17    19    16    19    17    20    18    20    16    19    17    19    15    19    16    18    16    18    15    17    14    17    16    16    16    16    16    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    16    17    17    18    18    18    18    18    18    18    17    18    17    18    16    18    17    18    19    21    18    21    19    21    20    21    19    21    19    21    19    21    19    21    16    21    16    21    15    20    10    15    10    12     8     9     5     6     3     4
  5   1   2       e>1                            Xl3.1-IMAGE:4684258.5                                                                                                                                                                                                                                  CGCTGTGTCGGCTGCGGACTAGGTTTGCTGACGGCTTCCTGTTCCCTGCACGCTTTGCTTGGAGTTTGAAGGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAAGGGATCACGGACACAAGGTCTCCCACTGTGGATAAGATTCTTGTGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGACCGTTGCCATGGATTGTGAGATGGTTGGAGTGGGGATGGATGGTGAGGAGAGTATTTTAGCCCGTGTCTCCATTGTCAATCTGTTTGGCAAGTGTGTGTATGACAAGTATGTCAAGCCAACGGAACGAGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGGCCTGAGGACGTG
  5   1   2       e>1                               Xl3.1-xlk68b07ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGTGTCTCCATTGTCAATCTGTTTGGCAAGTGTGTGTATGACAAGTATGTCAAGCCAACGGAACGAGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGGCCTGAGGACGTGAAGAAGGGGGAACCCTTTAAAGTTGTTCAGAAGGAGGTTTCAGAAATTCTCAGAGGGCGAACCCTAGTCGGACACGCTGTGCACAATGACCTGAAGATTCTTTTCTTAGATCACCCCAAAAAGGCCATCAGGGACACCCAGAAATACAAACCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCCTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGATTATTTTATTTTTATTAAATGAGATTGGTGCCTGAAAAAAAAAAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------T
                                               BLH ATG     216     863                                                                                                                                                                                                                                  
                                               BLH MIN     207     151                                                                                                                                                                                                                                  
                                               BLH OVR     216     772                                                                                                                                                                                                                                  
                                               EST CLI      63       8                                                                                                                                                                                                                                  
                                               ORF LNG     216      87                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 8e-044     NP_648689.1 CG6833-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ag ---- 2e-046     XP_561529.3 AGAP012826-PA [Anopheles gambiae str. PEST] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 4e-047     NP_496560.1 prevents mitotic catastrophe 2 homolog (30.3 kD) (2M315) [Caenorhabditiselegans] --------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Os ---- 3e-048     NP_001061683.1 Os08g0377400 [Oryza sativa (japonica cultivar-group)] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 3e-057     XP_001184180.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - ?? ---- 4e-081     XP_001788257.1 PREDICTED: similar to RNA exonuclease 4 (Exonuclease XPMC2) (hPMC2) (Prevents mitotic catastrophe 2 protein homolog) [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Mm ---- 1e-096     NP_997117.2 XPMC2 prevents mitotic catastrophe 2 homolog [Mus musculus] -----------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Dr ==== 2e-100     XP_700471.2 PREDICTED: similar to prevents mitotic catastrophe 2 homolog [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Cf ---- 1e-100     XP_548392.2 PREDICTED: similar to Probable exonuclease XPMC2 (hPMC2) (Prevents mitotic catastrophe 2 protein homolog) [Canis familiaris] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Gg ---- 2e-107     XP_415436.1 PREDICTED: similar to XPMC2 prevents mitotic catastrophe 2 homolog; Xenopus prevents mitotic catastrophe 2 homolog [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Hs ==== 1e-108     NP_065118.2 XPMC2 prevents mitotic catastrophe 2 homolog [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 0          CAJ83758.1 prevents mitotic catastrophe 2 homolog [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 0          NP_001079510.1 prevents mitotic catastrophe 2 [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xl3.1-xlk68b07ex.3.5                                                                                                                                                                                                                                                                                                    TGA------------------------------------------------------------------------------------------------------TAA------------TGA---TGA---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------ATG---------------------------------------------------TGA------------------------------TGA------------------------------------------TGA------------------------------------------TAA---------------------------------------ATG---------------TAA---------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------TGAATG---------ATG---------------------------------------------------------------------------------------------------------TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2       e>1                            Xl3.1-IMAGE:4684258.5                                                                                                                                                                                                                                  CGCTGTGTCGGCTGCGGACTAGGTTTGCTGACGGCTTCCTGTTCCCTGCACGCTTTGCTTGGAGTTTGAAGGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAAGGGATCACGGACACAAGGTCTCCCACTGTGGATAAGATTCTTGTGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGACCGTTGCCATGGATTGTGAGATGGTTGGAGTGGGGATGGATGGTGAGGAGAGTATTTTAGCCCGTGTCTCCATTGTCAATCTGTTTGGCAAGTGTGTGTATGACAAGTATGTCAAGCCAACGGAACGAGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGGCCTGAGGACGTG
                                                  Xl3.1-CHK-1012688685                                                                                                                                                                                                                                        GTCGGCTGCGGACTAGGTTTGCTGACGGCTTCCTGTTCCCTGCACGCTTTGCTTGGAGTTTGAAGGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAAGGGATCACGGACACAAGGTCTCCCACTGTGGATAAGATTCTTGTGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGACCGTTGCCATGGATTGTGAGATGGTTGGAGTGGGGATGGATGGTGAGGAGAGTATTTTAGCCCGTGTCTCCATTGTCAATCTGTTTGGCAAGTGTGTGTATGACAAGTATGTCAAGCCAACGGAACGAGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGGCCTGAGGACGTGAGAAAG
  5   1   2       bld Oo1  5g                         IMAGE:6640959.5p                                                                                                                                                                                                                         CAAGTGCCACGCTGTGTCGGCTGCGGACTAGGTTTGCTGACGGCTTCCTGTTCCCTGCACGCTTTGCTTGGAGTTTGAAGGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAAACGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACTGAGGAGTCCGTCCCCCAAAAAAGTGGTCACAAAATAAATGGCGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCACCACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTNCAGGGGAGGCGCAGCCACAACCCTCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATANGAGGCGGCTCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAGGGGATCACGGACACAGGTCTCCCGCTGTGGGATAGATCTTGTGAAAGAAAGGCTTTTGAAGGCTCACTCGGACGTTGCCTGGAT
  5   1   2       bld Emb9 5g                         IMAGE:7978471.5p                                                                                                                                                                                                                                  CGCTGTGTCGGCTGCGGACTAGGTTTGCTGACGGCTTCCTGTTCCCTGCACGCTTTGCTTGGAGTTTGAAGGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCGCCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGGTGGA
  5   1   2       bld Ga18      in                        xlk6e06ex.5p                                                                                                                                                                                                                                                           GGTTTGCTGACGGCTTCCTGTTCCCTGCACGCTTNNTTGGAGTTTGAAGGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGNNNNCTTTCTGCTGGGACGAGGTGCTTCNNNNNNGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGNCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGANCAGAAAGNCTCAGAGAAGAAAANCGAGGAGNCCGTCCCCCAAAAAAGTGGNCACAAAATAAATGGNGGCATAACTAGTGTATCTGCANTAGCAAAGGGAGCCNANGCACCTTCACNAGCAACACCTACNAAGCTGCCNAGAAGTCCGACGAGTGAGNAAAGGANGAAACGGAAGATCATNGCGANNA
  5   1   2       bld Emb4 5g                         IMAGE:4684258.5p                                                                                                                                                                                                                                                                          GTTCCCTGCACGCTTTGCTTGGAGTTTGAAGGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAAAGGCTGGACGCGTGGGCTCGTGAGATGCAAGGGATCACGGACACCGGGTCTCCCACTGTGGGATAAGATTCTTGTGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGAACGGTGCCATGGATTGTGAAATGGTTGGANTGGGAATGGATT
  5   1   2      seed Neu7 5g3  in                         XL024n10.5p                                                                                                                                                                                                                                                                                GGCACGCTTTGCTTGGAGTTTGAAGGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCC
  5   1   2       bld Ga18      in                       xlk68b07ex.5p                                                                                                                                                                                                                                                                                     CTGCACGCTNNNNNGGAGTTTGAAGGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGNNNNCTTTCTGCTGGGACGAGGTGCTNNNNNACNNCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGNCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTNCAACAACATTGGNTAAATGCCCTAAGAAAGANCAGAAAGTCTCAGAGAAGAAAANCGAGGAGNCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCNATAGCAAAGGGAGCCNAGGCACCTTCACAAGCAACACCTANAAAAGCTGCCGAGAAGTCCGACGA
  5   1   2       bld Emb4 5g                         IMAGE:5542157.5p                                                                                                                                                                                                                                                                                          CCACGCGTCCGGAAGGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAGGGGATCACCGACACCAAGTCTCCCACTGTGGGATAAAGATCCTTGGTGAAGAAAAGGGCTTTTGGAAGGGCTCCACTCGGGACGGTTGGCCATGGAATTTGTGAAAA
  5   1   2       bld Em10 5g                         IMAGE:8318612.5p                                                                                                                                                                                                                                                                                                 GTTTGAAGGCATGGGGAGAACTGGCGCTTAAGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACCATTTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCTTCAAGGGGAGGCGCAGCCACAACCTCCAAGGTGGATATCTGGTTCGATGATGTGG
  5   1   2       bld Em10 5g                         IMAGE:8319330.5p                                                                                                                                                                                                                                                                                                 GTTTGAAGGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAAGCGCAGCCANCACCTCCNAAGGTGGATATCTGGTTCGATGATGT
  5   1   2       bld Emb4 5g                         IMAGE:5571258.5p                                                                                                                                                                                                                                                                                                        GGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAAAGGCGGGCCCTGGGGCCCGAGGCTGGAAGCGTGGCTCGTGAAATGCAAGGGATCACGGACACAAAGTCTCCCACTGGGGAAAAAAATCTTGTGAAAGAAAAGGGCTTTTTAAAGGCTCACTCCGAACGGTTGCCATGGGATGTGAAAATGGTCGGCAATG
  5   1   2       bld Em10 5g                         IMAGE:8320842.5p                                                                                                                                                                                                                                                                                                        GGCATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAGGGGAGGCGCAGCCACACCTCCNAAGTGGAATCTGGTCGAGATGTGATCAGATGACTANAGCGGCCTGGGCCAAGCTGACCGTGCTCTGAATGCAGATCCGACCAGTCCCCTGGATAATCTGTGAGAAGCTTGNAGTCTCGAGTGCTGATGAAGTGATGA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4960266.5p                                                                                                                                                                                                                                                                                                          CATGGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCCAAGGAAAGAAACGG
  5   1   2       bld Em10 5g                         IMAGE:7983642.5p                                                                                                                                                                                                                                                                                                             GGGGAGAACTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATNAGAGCGGCCCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAAAGGATCACGGACACAGG
  5   1   2       bld Ov1  5g                         IMAGE:6317355.5p                                                                                                                                                                                                                                                                                                                   GGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATGTGAAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGNGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGNCCAGAAGCTGGACGCGTGGCTCGTGAGATGCCAGGGATCCCGGACCCCAGGTCTCCCCCTGTGGATAAGATTCTTGGGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGACCGGTGCCCTGGATTGTGAAATGGTTGGAAATGGGGATTGGAATGGGTGAAGAAAAAAATCTTAAcccccggtcccccccTGGGCAAACCTTGTTTGGCAAAGGTGGTGTCCTT
  5   1   2       bld Emb9 5g3  in                    IMAGE:7976679.5p                                                                                                                                                                                                                                                                                                                     CTGGGGCATCGGAGCATTAAGTTGCAGAGCCGCTTTCTGCTGGGACGAGGTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGATACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAGAGGCTGGACGCGTG
  5   1   2       bld Ov1  5g                IMAGE:6317355-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                  GTGCTTCGCAGAGCTGCAGGAATCGCTGGGCATGTTCCATGTGAAAATCACTAAGCTTTGACCCTGATTGGCTAATGAAGGGGCACCAATGGCAAAAGCCAAAGTGAAGAAGGACCAATCGCCTTGCAGTGGCTCTCTGGGAAAAACCGCAAATACTCCGAAACAGAAGAGGAAGCAGAAGCAGAGGAAATTCTGGCAAAACCACCCTAAAATCACTACAAAGACAGGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGT
  5   1   2       bld Int2      in                    IMAGE:8820607.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGATGTTTCAGGGGATTTCGTGTGATTATGAATTCGTCCCGAGAAACTAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACTGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGCGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAAGGGATCACGGACACAAGGTCTCCCACTGTGGATAAGATTCTTGTGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGACCGTTGCCATGGATTGTGAGATGGTTGGAGTGGGGATGGATGGTGAGGAGAGTATTTTAGCCCGTGTCTCCATTGTCAATCTGTTTGGCAAGTGTGTGTATGACAAGTATGTCAAGCCAACGGAACGAGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGCCTGAGACGTGAAGAAGGGGACCCTTTTAAAGTTGTTCAGAGAGGTTTCAGAATTCTCGAGGCGACCCTAGTCGACCCGCTGTGCACAATGACCTGGAGATCCTTTCCTAGATCACCCAAAAGCATCAGGAACCCAGAAATAACAACCTTAAGCCGAAGGTTACATTGGC
  5   1   2       bld Em10                            IMAGE:8318069.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAATAAAAAGGTTTCTCTTCTGCTGCCCCCCAAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAAGGGATCACGGACACAAGGTCTCCCACTGTGGATAAGATTCTTGTGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGACCGTTGCCATGGATTGTGAGATGGTTGGAGTGGGGATGGATGGTGAGGANANNATNNT
  5   1   2       bld Neu7      in                         XL006n09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTAAAAAGGTTTCTCTTCTGCTGCCCCCCAGGGGCCCCAGGAATTCTCATCCAACTGGAAGGCGCTGCAGGAGTTATTGAAGCCAAAGGAAAACCAGGCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAAGGGATCACGGACACAAGGTCTCCCACTGTGGATAAGATTCTTGTGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGACCGTTGCCATGGATTGTGAGATGGTTGGAGTGGGGATGGATGGTGAG
  5   1   2       chi Int2                            IMAGE:8823384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCAAAGGTTAAGTAACTGTGTCAAATTTACTTAATAATTCGTCCCGAAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAAGGGATCACGGACACAAGGTCTCCCACTGTGGATAAGATTCTTGTGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGACCGTTGCCATGGATTGTGAGATGGTTGGAGTGGGGATGGATGGTGAGGAGAGTATCTTAGCCCGTGTCTCCATTGTCAATCTGTTTGGCAAGTGTGTGTATGACAAGTATGTCAAGCCAACGGAACGAGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGGCCTGAGGACGTGAGAAAGGGGAACCCTTTAAAGTTGTTCAGAAGAGGTTTCAGAAATTCTCAGAGGGCGAACCCTATCAGACACGCTGTGCACAATGACCTGAAGATTCTTTTCTAGATCACCCCAAAAAGGCCATCAGGAACACCCAGAAATACAAACCCTTTAAGCAGAAAGTAAAGAGTGGCGCCCGTCCTTGAACTGCTGTGTGGAAAAAATCCTGAATGTGAAGTGCAGACTGGGGAACCTTGCTCGTCAGATGCCAAGCCTTGCAGGGCCCTTATACACCTGCAGAAAAGAACTTGGAATTCCCCAATTAGAGCCAAATATACACCTGGCGCT
  5   1   2       bld Neu7      in                         XL026m01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCACTGCCTGCAACAACATTGGCTAAATGCCCTAAGAAAGACCAGAAAGTCTCAGAGAAGAAAACCGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGTGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAAGGGATCACGGACACAAGGTCTCCCACTGTGGA
  5   1   2       bld Ooc1                             Ooc1-db24g01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGTCGACCCACGCGTCCGGAAAGACCAGAAAGTCTCAGAGAAGAAAACTGAGGAGTCCGTCCCCCAAAAAAGTGGCCACAAAATAAATGGCGGCATAACTAGTGTATCTGCAATAGCAAAGGGAGCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAAGGGATCACGGACACAAGGTCTCCCACTGTGGATAAGATTCTTGTGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGACCGTTGCCATGGATTGTGAGATGGTTGGAGTGNGGATGGATGG
  5   1   2       bld Emb9      in                    IMAGE:7974092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCAAGGCACCTTCACAAGCAACACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCCCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAAGGGATCACGGACACAAGGTCTCCCACTGTGGATAAGATTCTTGTGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGACCGTTGCCATGGATTGTGAGATGGTTGGAGTGGGGATGGATGGTGAGGAGANT
  5   1   2       bld Ov1       in                    IMAGE:8328245.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAAGGCACCTTCACAAGCACCACCTACAAAAGCTGCCGAGAAGTCCGACGAGGTGAGCAAAGGAAAGAAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCTCTGGGGCCAGAGGCTGGACGCGTGGCTCGTGAGATGCAAGGGATCACGGACACAAGGTCTCCCGCTGTGGATAAGATTCTTGTGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGACCGTTGCCATGGATTGTGAGATGGTTGGAGTGGGGATGGATGGTGAGGAGAGTATTTTAGCCCGTGTCTCCATTGTCAATCTGTTTGGCAAGTGTGTGTATGACAAGTATGTCAAGCCAACGGAACGAGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGGCCTGAGGACGTGAAGAAGGGGGAACCCTTTAAAGTTGTTCAGAAGGAGGTTTCAGAAATTCTCAGAGGGCGAACCCTAGTCGGACACGCTGTGCACAACGACCTGAAGATTCTTTTCTTAGATCACCCCAAAAAGCCATCAGGGACACCCAGAAATACAAACCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAAGAAATCCTGAATGTGAAGGTGCAGACTGTG
  5   1   2       bld Tad1                            IMAGE:6939975.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGAACGGAAGATCATGGCGGAGGCCACAGACACGGAGCACCAAGGAAAGAAGCCTCAAGGGGAGGCGCAGCCACAACCTCCAAAGGTGGATATCTGGTTCGATGATGTGGATCCAGATGACATAGAGGCGGCTCTGGGGCCAGAGGCTGGACGCTCTGGCTCGTGAGATGCAAGGGATCACGGACACAAGGTCTCCCGCTGTGGATAAGATTCTTGTGAAAGAAAGGGCTTTTGAAGGGCTCACTCGGACCGTTGCCATGGATTGTGAGATGGTTGGAGTGGGGATGNGATGGTGAGGAGAGTATTTTANNCCGTGTCTCCNTTGTNCATCTGTTTGGCAAGTGTGTGTATGACAAGTATGTCAAGCCAACGGAACGAGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGGCCTGAGGACGTGAAGAAGGGGGAACCCTTTAAAGTTGTTCAGAAGGAGGTTTCAGAAATTCTCAGAGGGCGAACCCTAGTCGGACACGCTGTGCACAACGACCTGAAGATTCTTTTCTTAGATCACCCCAAAAAGGCCATCCGGGACACCCAGAAATACAAACCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAACTGCTGTGTGAGAAATCCGGAAGGGAAGGCAACGGGACCTGTCGGTAAGCAGGCGTCGAGCAACGGN
  5   1   2       e>1                               Xl3.1-xlk68b07ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGTGTCTCCATTGTCAATCTGTTTGGCAAGTGTGTGTATGACAAGTATGTCAAGCCAACGGAACGAGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGGCCTGAGGACGTGAAGAAGGGGGAACCCTTTAAAGTTGTTCAGAAGGAGGTTTCAGAAATTCTCAGAGGGCGAACCCTAGTCGGACACGCTGTGCACAATGACCTGAAGATTCTTTTCTTAGATCACCCCAAAAAGGCCATCAGGGACACCCAGAAATACAAACCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCCTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGATTATTTTATTTTTATTAAATGAGATTGGTGCCTGAAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012688827                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTCCATTGTCAATCTGTTTGGCAAGTGTGTGTATGACAAGTATGTCAAGCCAACGGAACGAGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGGCCTGAGGACGTGAAGAAGGGGGAACCCTTTAAAGTTGTTCAGAAGGAGGTTTCAGAAATTCTCAGAGGGCGAACCCTAGTCGGACACGCTGTGCACAATGACCTGAAGATTCTTTTCTTAGATCACCCCAAAAAGGCCATCAGGGACACCCAGAAATACAAACCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCCTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGATTATTTTATTTTTATTAAATGAGATTGGTGCCTGAAAAAAAAAAAAAAA
  5   1   2       bld Ga15      in                       XL474f23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTCACTCGGACCGCTTGCCATGGATTGTGAGATGGTTGGAGTGGGGATGGATGGTGAGGAGAGTATCTTAGCCCGTGTCTCCATTGTCAATCTGTTTGGCAAGTGTGTGTATGACAAGTATGTCAAGCCAACGGAACGAGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGGCCTGAGGACGTGAAGAAGGGGGAACCCTTTAAAGTTGTTCAGAAGGAGGTTTCAGAAATTCTCAGAGGGCGAACCCTAGTCGGACACGCTGTGCACAATGACCTGAAGATTCTTTTCTTAGATCACCCCAAAAAGGCCATCAGGGACACCCAGAAATACAAACCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCCTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACANGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCACCCGTGCCTTATTGTTG
  5   1   2       bld Egg4      in                    IMAGE:3744318.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAGTATTTTAGCCCGTGTCTCCATTGTCAATCTGTTTGGCAAGTGTGTGTATGACAAGTATGTCAAGCCAACGGAACGAGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGGCCTGAGGACGTGAAGAAGGGGGAACCCTTTAAAGTTGTTCAGAAGGAGGTTTCAGAAATTCTCAGAGGGCGAACCCTAGTCGGACACGCTGTGCACAATGACCTGAAGATTCTTTTCTTAGATCACCCCAAAAAGGCCATCAGGGACACCCAGAAATACAAACCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCCTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGT
  3   1   2       bld Ga18      in                       xlk68b07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTTAGNCCGNNTCTCCATTNNCAATCTGTTTGGCAAGTGTGNGTATGACAAGTATGTCAAGCCANCGGANCGAGTGACCGACTATAGNACGGCAGTGAGTGGGATCAGGCCTGAGGACGTNNAGAAGGGGGAACCCTTTAAAGTTGTTCAGAAGGAGGTTTCAGAAATTCTCAGAGGGCGAACCCTAGTCGGACNCNCTGTGCACAATGACCTGAAGATTCTTTTCTTAGATCACCCCAAAAAGGCCATCAGGGACACCCAGAAATACAANNCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCCTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTNCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGANCTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTNNNANNGCCGTGACTCGCTCCANTTCCATAGTTTAACA
  3   1   2       bld Int2      in                    IMAGE:8820607.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTCTCCATTGTCATTCTGTTTGGCAGTGGTGTATGACAGTATGTCAGCACGGAACGATGACGACTTAGGACGCATGATGGATCAGCTGAGACGGAGAAGGAACTTTAAAGTGTTCAGAGGAGGCTTCAGAATCTCAGAGGGCGAACCTAGTCGGACACGCTGTGCACATGACTGAAGATTCTTTTCTTAGATCACCCCAAAAAGGCCATCAGGGACACCCAGAAATACAAACCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCGTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGCACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGAT
  5   1   2       bld Egg1      in                    IMAGE:4783862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TACCTCAGCACGAGGGTGACCGACTATAGGACGGCAGTGAGTGGGATCAGGCCTGAGGACGTGAAGAAGGGGGAACCCTTTAAAGTTGTTCAGAAGGAGGTTTCAGAAATTCTCAGAGGGCGAACCCTAGTCGGACACGCTGTGCACAACGACCTGAAGATTCTTTTCTTAGATCACCCCAAAAAGGCCATCAGGGACACCCAGAAATACAAACCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCCTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTTCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGG
  3   1   2       bld Emb9 5g3  in                    IMAGE:7976679.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTCGTTCTCATTTGAAGGTTGCATTCACAGACATGCGCTAGCGCATATGTCGCGAGAGGAGAGGGACCTTAGTGTCGAGAGTTCGAATCTCGAGCGACCTGTGACAGTGGCACAGACTGAGATCTTTCTAGACACCCAAAAGCCTCGGGACACCAGAATACAAACCTTAAGCAGAAGTAAGAGTGGCGCCCTCCCCTGAATGCTGTGTGAGAAATCCTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCNCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAGTGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACTCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTAACAGGATATTTT
  5  -1   2       bld Emb4                            IMAGE:4970937.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        NGTGATCAGCTGAGACTGAGAGGGATCCTTCAATTGTCAGAAGAGTTCAGAATCTCAGAGGCGACCCTATCGGACACGCGTGCACAAGACCTGAGATTCTTTTCTTAGATCACNCCAAAAGGCCATCAGCGACACCCAGATATACAACCCCTTANAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCCTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAATAGGTCACCCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTAACAGGATTTTTATTTATAAGGAG
  3   1   2       bld Ga18      in                        xlk6e06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGGGNNCCCTTTNAAGTNGTTCANAGNANNTTTCANAANTNCTCAGNGGNNANNCTAGTNGGNACNNNCTGTGCACAATGNCCTGANGATTCTTTTCTTAGATCACCCCAAAAAGNCCATCAGGGACACCCAGAAATACANNCCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCCTGAATGTGAAGGTGCAGACTGGGGAACNCTGCTCGGTTCAAGATNNCCAGGCTNNCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTNNNNNNGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTNNNAGAGCCGTGACTCGCTCCANTTCCATANNNNACAGGANT
  3   1   2       bld Emb9      in                    IMAGE:7974092.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGTTGTTCAGAAAGGAGGTTTCAGAAATTCTCAGAGGGCGAAACCCTAGTCGGACACGCTGTGCACAATGACTTGAGATTCTTTTCTTAGATCACCCCAAAAAAGGCCATCAGGGACACCCAGAAATACAAACCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCTTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAGTGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACTCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACCAGGCATTA
  3   1   2       bld Neu7      in                         XL026m01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTTGTTCAGAAGNAGGTTTCAGAAATTCTCAGAGGGCGAACCCTAGTCGGACACGCTGTGCACAATGACCTGAAGATTCTTTTCTTAGATCACCCCAAAAAGGCCATCAGGGACACCCAGAAATACAAACCCTTTAAGCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCCTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCNATGGCCTTTGC
  5   1   2      seed Ga15      in                       XL453l09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGAAAGTAAAGAGTGGGCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCCTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGATTATTTTATTTTTATTAAATGANATTGGTGCCTGATCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL453l09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAGAGNGGGGCGCCNGTCCCTGANNNTGCTGTGTGAGAAAATCCTGAATGNGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACCAGGATTATTT
  5   1   2       bld Ga15      in                       XL429p19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGCCCGTCCCTGAAACTGCTGTGTGAGAAAATCCTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAANAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCANAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCANAGCCGTGACTCGCTCCAATTCCATANTTTAACAGGATTATTTTATTTTTATTAAATGANATTGGTGCCTGaaaaaaaaaa
  3   1   2       chi Egg4                            IMAGE:3744319.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGTGTGAGAAGATCTTGAATGTGAAGGTGCCGATGGGGGACCACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGGTGGACAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGANAGATAATCAATGTCCTCAGTGAAAGCTGTCTCCCCGTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTTTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCTCCCACAGGACTGGTGTGGCCCGAGGCTGACCCCCAAACATGTAGACTTTTTAGGGACCATAAAGGTCCCTCTGTGCTATGCAGGGATGCCCCACCCGTTAGACAGCTTTGAAGGCACATGGGTTTGAAGGCCCGGTTCCCAGTCATAGAACGGACACACTCACCCATTCAGTCGATAGATAATTGATATTCCCGCAGGGTGTCTAGCCACAATTTGAGATGTTGAACAGCCTCCGTTGTTATTCAATTAAAGGGATTGGAGCAAAAA
  3   1   2       bld Ga15      in                       XL474f23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAGAAAATCCTGAATGTGAAGGTGCAGAGTGGGGAACACTGCTCGGTTCAAGATGCCCAGGNTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCNTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTAACAGGA
  3   1   2       bld Neu7                                 XL002k09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCNTGAATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGATTATTTNATTTTTATTAAA
  3   1   2       bld Ov1       in                    IMAGE:8328245.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGTGAAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTTCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGCACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGATTATTTTATTTTTATTAAATGAGATTGGTGCCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Neu7      in                         XL006n09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAATGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGGACTCGCTCCAATTCCATAGTTTAACAGGAT
  3   1   2       bld Neu7 5g3  in                         XL024n10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGGTGCAGACTGGGGAACACTGCTCGGTTCAAGATGCCCAGGCTGCCATGCGCTTATACACCATGGAGAAGAAGAGCTGGGAAGTCGCCATTAAAGCCAAATACACCGGCGTCATGCCTGTTGACAGGAAGTCGAAAGGGCCGCAGAAAGATAAACAATGTCCTCAGTGAAAGCTGTCTCCCCCTGCTGGACATGAGCGGTGAGACCAGTGGCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTACAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACTCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGATTATTTTATTTTTATTAAA
  3   1   2       bld Ga15      in                       XL429p19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCAGAAAGATAANCAATGTCCTCAGTGAAAGCTGTCTCCCCTTGNTGGACATGAGCGGTGAGACCAATGNCCTTTGCTCTGGAGACCAGCCGTGCCTTATTGTTGAACTGCGTNCAAGGCCACAGACCCCCGTGAGTTTTGGGCGCTGTAATTCTGGTTATGCCATGAACATNTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCNTAATGGTTAATTGGGATGTTTGNTGNGAGGGTGCCCAANTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGNCTTTNTTGGGAACAAAAAGGTCACNTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTNTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCANTCACTTTGACGCAACTTTGTTNTAAGCAGAGCCGTGACTCGCTCCA
  3   1   2       bld Emb4 5g3  in                    IMAGE:4960266.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCCATGAACATTTTATAATACAGGAGCAAATGTGGATCCCTACAGGTTAATGTTTCCTAATGGTTAATTGGGATGTTTGCTGCGAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGAACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGATTATTTTATTTTTATTAAATGAGATTGGTGCCTG
  3   1   2       bld Egg1      in                    IMAGE:4783862.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGGGTGCCCAACTACAGGACAGGTGTGGCCCGCTGCTGACCCCCAAACCTCTTGACTTTTTTGGGAACAAAAAGGTCACCTTGTGTTATGCAGTGATGCCCAACCAGCTATACATTTCTGTTGGCACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGATTATTTTATTTTTATTAAATGAGATTGGTGCCTGATCAGTGGCTAATTAGTCTCCATGTGTAAAACTTCTGCGTGAGTATAATACTCAAAAGATGGAATTAGTCCAAATGACCAACAGGATACCGCATGTGGTTGGTTATATAGGATCTGTTATCCAGAATGCTCAGTGCCTGGTGTTTGCCAGATAATGGGTCTGTAATTTGGATTTGGATACCTTGTCTAAATCTTGTAAACATGAAATAAACCCAATAGGCTGGTTTTGCCTCCAATAAGGATTAATGATATCTTAGTTGGGATCAAGTACAAGGTACTGTTTTAAGAAAGAAAAAATAAAA
  3   1   2       bld Egg4      in                    IMAGE:3744318.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACCAGCTATACATTTCTGTTGGCACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGATTATTTTATTTTTATTAAATGAGATTGGTGCCTGAA
  3   1   2       bld Emb4                            IMAGE:4203563.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACCAGCTATACATTTCTGTTGGCACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGATTATTTTATTTTTATTAAATGAGATTGGTGCCTGAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1                                 AW764484.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACCAGCTATACATTTCTGTTGGCACATCTGGCTGAATGCCCGGTTCCATGGCATTGTACGGAAAGACAACCCCATTCACTTTGACGCAACTTTGTTTTAAGCAGAGCCGTGACTCGCTCCAATTCCATAGTTTAACAGGATTATTTTATTTTTATTAAATGAGATTGGTGCCTGaaaaaaaaaaaaaaaaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)