Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012837839 Xl3.1-IMAGE:8070776.3.5 - 44 ESTs
                                                                       .-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8070776.3.5                                GTCCGAGAACTGTGTAGAGAGAGAGCAATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGCATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTCTTTTCCTTGTGGACAACGGAACTAAAGGTTTTGTTAAGGGGAGGAAACTGGAGAAAATTGGCTTGAAGGCACAGGACACAGCAGAATTGTTTTTCGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGGCAGGAAAATAAAGGCTTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTTGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGCTGAAGACACAGATCTGTGTGGGTCGTACCTTCCTGGACAACTGTCTTCAGCTTCATGCGGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTACAGAATACTGTGGCAACTCAGTGTCTCCAACTTCATGGAGGGTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTTGATTCTCGTGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACCACTGAAATTCTGTTCTGCTACTCTGCCTTAACGTTTTCACGTGCCATTCTTCTTCTCACATTTTCATATTGGTTTCTTCGTTTGTTACGCGGAATGATCCTATTACATGAACACATTTTTCCTGATTGCACTTATGGATGTAGAAATAGAATCTTAAATTCTGACTGTTTGCCAATGGACTGGGTGACTTGAGTTTTATTTTGAATTCTTTCCTTTGTAAATCTGTCTGGTACCTGAGGATTAATGGTTAGATCTCACTCAAACTTAAAGGAGAACTGACCCCCCCCCCCAGTAATAAAAGCCCCCCTTAACTGCCTGCCATTTCCCCCCTCCCTTATCCACACTGTGCATTAGTGAAAAAGGCACCCCTGTAAAAAACTTTACCCTAAAATGCAGAGAAGTGCAGCAGAGTTCCCTAGCACCATCTACCTGTTTGACTAATGCACAGTGTGAGGAGGGAGAGGGGAGAAATGGGAGGCATTTAAGGGGGGGGGGGGTTTAGTTCATATTTAAAGGAGGCAGCAGCAAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGTTTTTTTTTTCAATAAAGCACTATTGAACAGTTAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012722765                                      GAACTGTGTAGAGAGAGAGCAATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGCATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTCTTTTCCTTGTGGACAACGGAACTAAAGGTTTTGTTAAGGGGAGGAAACTGGAGAAAATTGGCTTGAAGGCACAGGACACAGCAGAATTGTTTTTCGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGGCAGGAAAATAAAGGCTTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTTGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGCTGAAGACACAGATCTGTGTGGGTCGTACCTTCCTGGACAACTGTCTTCAGCTTCATGCGGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTACAGAATACTGTGGCAACTCAGTGTCTCCAACTTCATGGAGGGTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTTGATTCTCGTGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACCACTGAAATTCTGTTCTGCTACTCTGCCTTAACGTTTTCACGTGCCATTCTTCTTCTCACATTTTCATATTGGTTTCTTCGTTTGTTACGCGGAATGATCCTATTACATGAACACATTTTTCCTGATTGCACTTATGGATGTAGAAATAGAATCTTAAATTCTGACTGTTTGCCAATGGACTGGGTGACTTGAGTTTTATTTTGAATTCTTTCCTTTGTAAATCTGTCTGGTACCTGAxGxxTxATGGTTAGATCTCACTCAAACTTAAAGGAGAACTGACCCCCCCCCCCAGTAATAAAAGCCCCCCTTAACTGCCTGCCATTTCCCCCCTCCCTTATCCACACTGTGCATTAGTGAAAAAGGCACCCCTGTAAAAAACTTTACCCTAAAATGCAGAGAAGTGCAGCAGAGTTCCCTAGCACCATCTACCTGTTTGACTAATGCACAGTGTGAGGAGGGAGAGGGGAGAAATGGGAGGCATTTAAGGGGGGGGGGGGTTTAGTTCATATTTAAAGGAGGCAGCAGCAAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGTTTTTTTTTTCAATAAAGCACTATTGAACAGTTAAAAAAAAAAAAA
                                                      consensus depths                                     2     3     4     5     7     8    11    12    11    13    11    13    12    14    12    14    12    14    13    14    13    14    13    14    13    14    13    14    13    14    14    15    14    15    14    15    14    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    16    16    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    17    18    17    18    17    18    17    18    17    18    16    19    17    19    15    19    16    19    14    17    14    16    13    15    14    15    14    14    13    13    13    13    11    11    11    11    11    11    11    11    11    11     9     9     7     8     5     8     4     8     5     8     4     8     4     7     4     7     4     7     4     7     4     7     4     7     4     5     4     5     4     5     3     4     3     4     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     2     3     2     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     3     4     3     4     3     4     4     5     5     5     5     5     4     6     5     6     5     6     5     6     5     6     5     6     5     7     5     9     5    10     6    11     7    11     7    11     7    11     7    11     6    10     8    11     7    12     7    11    11    13    12    13    12    13    12    14    12    13    12    13    13    14    13    14    14    14    14    14    14    14    14    14    14    14    15    15    13    15    15    15    15    15    16    16    16    16    15    16    16    17    16    17    17    17    17    17    17    17    18    18    18    18    18    18    16    18    15    18    17    18    16    18    17    18    17    18    17    18    17    18    17    18    17    18    18    19    18    19    18    18    18    18    17    18    15    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    17    12    14    11    13     8    11     4     7     2     3     2     2
  5   1   2      ests                            Xl3.1-IMAGE:7018544.5                                     AGAACTGTGTAGAGAGAGAGCAATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGCATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTCTTTTCCTTGTGGACAACGGAACTAAAGGTTTTGTTAAGGGGAGGAAACTGGAGAAAATTGGCTTGAAGGCACAGGACACAGCAGAATTGTTTTTCGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGGCAGGAAAATAAAGGCTTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTTGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGCTGAAGACACAGATCTGTGTGGGTCGTACCTTCCTGGACAACTGTCTTCAGCTTCATGCGGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTACAGAATACTGTGGCAACTCAGTGTCTCCAACTTCA
  5   1   2      ests                            Xl3.1-IMAGE:8070776.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTAATGGTTAGATCTCACTCAAACTTAAAGGAGAACTGACCCCCCCCCCCAGTAATAAAAGCCCCCCTTAACTGCCTGCCATTTCCCCCCTCCCTTATCCACACTGTGCATTAGTGAAAAAGGCACCCCTGTAAAAAACTTTACCCTAAAATGCAGAGAAGTGCAGCAGAGTTCCCTAGCACCATCTACCTGTTTGACTAATGCACAGTGTGAGGAGGGAGAGGGGAGAAATGGGAGGCATTTAAGGGGGGGGGGGGTTTAGTTCATATTTAAAGGAGGCAGCAGCAAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGTTTTTTTTTTCAATAAAGCACTATTGAACA
                                                                   SNP                                                                                                        -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----A-------
                                               BLH ATG      22    1404                                
                                               BLH MIN      22     295                                
                                               BLH MPR       1     295                                
                                               BLH OVR      22      45                                
                                               EST CLI      17      25                                
                                               ORF LNG      22       5                                
  5   1   2      ests                            Xl3.1-IMAGE:7018544.5                                     AGAACTGTGTAGAGAGAGAGCAATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGCATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTCTTTTCCTTGTGGACAACGGAACTAAAGGTTTTGTTAAGGGGAGGAAACTGGAGAAAATTGGCTTGAAGGCACAGGACACAGCAGAATTGTTTTTCGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGGCAGGAAAATAAAGGCTTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTTGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGCTGAAGACACAGATCTGTGTGGGTCGTACCTTCCTGGACAACTGTCTTCAGCTTCATGCGGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTACAGAATACTGTGGCAACTCAGTGTCTCCAACTTCA
                                                  Xl3.1-CHK-1012689990                                           GTGTAGAGAGAGAGCAATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGCATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTCTTTTCCTTGTGGACAACGGAACTAAAGGTTTTGTTAAGGGGAGGAAACTGGAGAAAATTGGCTTGAAGGCACAGGACACAGCAGAATTGTTTTTCGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGGCAGGAAAATAAAGGCTTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTTGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGCTGAAGACACAGATCTGTGTGGGTCGTACCTTCCTGGACAACTGTCTTCAGCTTCATGCGGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTACAGAATACTGTGGCAACTCAGTGTCTCCA
  5   1   2       bld Brn1 5g                         IMAGE:7018544.5p CGCTGGACCGGTCCGGATTCCCGGGATGCCAGTCCGAGAACTGTGTAGAGAGAGAGCAATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGTATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTTGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTCTTTTCCTTGTGGACAACGGGAACTAAAGGTTTTTGGTAANGGGGAGGGAAACTGGGANAAAATTGGCTTTG
  5   1   2       bld Ov1  5g                         IMAGE:8330529.5p                    GCTGCATAGCCAGTCCGAGAACTGTGTAGAGAGAGAGCAATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGTATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCNAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAAGTGT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074123.5p                             CCACGCGTCCGACTGTGTATAGAGAGAGCAATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGTATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCATGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGATTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCATGCGCTGGCAGTGACTTACAGGGTGTTA
  5   1   2       bld Ga18      in                       xlk70p18ex.5p                                 GTCCGAGAACTGTGTAGAGAGAGAGCAATGNCAGCCCGNNTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGTATCAGCGGCAAACATGTGTGTGGCANNNNNGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGNCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATNCATTGGGNCTATAGCTATGACTGAGCCAGGNGCTNGCAGTGNNTTACAGGGTGNTAGAACAAATGCCAAGNANATGGAAG
  5   1   2       bld FaB  5g3  in                    IMAGE:8070776.5p                                         CTGTGTAGAGAGAGAGCAATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGCATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGG
  5   1   2       bld Te2N 5g3  in                    IMAGE:7201918.5p                                              TAGAGAGAGAGCAATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGCATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTCTTTTCCTTGTGGACACNGNAACTAAAGGTTTGTTNANGGGGAGGAAACTGGGAGAAAATTGGCTTGAAGGCACAGGACAACAGCAGAATTGNTTTTTTCGAGAATGTACCGGCTTCCTTGCTGATGCCTTATTTGGGGGC
  5   1   2       bld FaBN 5g                         IMAGE:8079099.5p                                                GAGAGAGAGCAATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGCATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAG
  5   1   2       bld Lu1  5g                         IMAGE:4056775.5p                                                      GAGCAATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGCATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTNTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATGTATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAAGCGCTGGCAGTGACTTACAGGTGTAGAAACAATGCCAAGAAAGATGGAGTGATTGGATACTCACGGCCGGT
  5   1   2      seed Te2N 5g                         IMAGE:7767409.5p                                                         CAATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGCATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTCTTTTCTTG
  5   1   2       bld Emb1 5g                         IMAGE:6630759.5p                                                          AATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGCATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACNAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTCTTTTCCTTGTGGACACGGGGACTTAAGGGTTTTGTTTAAGGGGAGGAAAACTGGGAGAAAATTGGCCTTGGAGGCACAGGGACCCAGCCAAAATTTGTTTTTTCAAGGGATGGTACGGCCTTCCCTGCCTGGATGCTTTTAATGGGGGGCAGGGAAAAATTAAAAGGCTTTTTATTTACTTTAATGGGCCAGAACTTTN
  5   1   2       bld Ov1  5g                         IMAGE:6318269.5p                                                           ATGGCAGCCCGGCTAAGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGTATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTCTTTTCCTTGTGGACAACGGAACTANAGGTTTTTGTTAAGGGGGAGGAAACTGGGAGAAAATTGGGCTTGAAAGGCACAGGGACACCAGCAGAAATTGTTTTTTTCGAGGGATGTACGGGCTTCCCTGGGCTGATGCT
  5   1   2       bld Tbd7      in                         XL072f06.5p                                                             GGCAGCCCGGCTAAGCTTTTGGGNAAAATCTGTTCAACAGCTGAATGGCATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAAC
  5   1   2       bld Ga12      in                         XL191f08.5p                                                                           AGGCTTTTGGGAAAATCTGTTCAACAGCTGAATGGCATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGT
  5   1   2       bld Ga12                                 XL141i06.5p                                                                                                  CAGCTGAATGGCATCAGCGGCAAACATGTGTGTGGCACCGCTAGTGCAGTCTCAGTGCCAAACAGGTACCAGCACAGTCATCCCAAATCCAGTGATGAGAGACCACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAG
  5   1   2       bld Te2N                            IMAGE:7768341.5p                                                                                                                                                                                                          ACGCTTAGAAACTTCTCAAGCCAAGTCTTTAATGGACATAGGCACAAGGGGTGTCTTTAGTTCAGACCACGACATCTTCAGAGAAAGCGCAAGAAAATTCTTTCAGCAGGAAGTGGTCCCCTACCATGCTGAGTGGGAGAAGGCAGGACAAGTAAGCCGGAACTTATGGGAGAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTC
  5   1   2       bld He1       in                    IMAGE:4406869.5p                                                                                                                                                                                                                                                                                                                                                                                     GAAAGCTGGTGAACAGGGTCTTTTGGGTACCAGTACCCCTGAAGAGCATGGTGGCATCGGTGCTGATATTCTGTCATCTGCTATTGTATGGGAAGAACAGATGTATGTGAACTGCACAGGACCCGGTTTTAGTCTTCACTCTGACATTGTGATGCCTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTCTTTTCCTTGTGGACAACGGAACTAAAGGTTTTGTTAAGGGGAGGAAACTGGAGAAAATTGGCTTGAAGGCACAGGACACAGCAGAATTGGTTTTCGAGGATGTACGGGTTCCTGCTGATGCTTTATTGGGGGCAGAAAATAAAGGGTTTTATTACTTAATGGGGGAACTTCCCAGG
  3   1   2       bld Ga18      in                       xlk70p18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                  ANGNTNTTTNNGNNNCCAGTACCCCTGNANNGCATGGTGGCATNGNGCTGANNNTNNNNTCATCTGCTATNNNANGGGNAGNACAGATGTATGTGAANNGCACAGGACCCGGTTTNANTCTTCACNNTGNCATTGTGATNCCTTACATCTCNAGATATGGCAGNAAGGGCCNNNGTAGAAAAATNNNTCCTCAANTGACTGCTGGNAAATGCATTGGGNCTATAGCTATGACTGANNCAGGCGCTGGCAGTGACTTACAGGGTGNTNAGNACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTCTTTTCCTTGTGGACAACGGAACTAAAGGTTTTGTTAAGGGGAGGAAACTGGAGAAAATTGGCTTGAAGGCACAGGACACAGCAGAATTGTTTTTCGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGGCAGGAAAATAAAGGCTTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTTGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGCTGAAGACACAGATCTGTGTGGGTCGTACCTTCCTGGACAACTGTCTTCAGCTTCATGCGGAGAAACGTTTAGCTCCNCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTACAGAATACTGTGGCAACTCAGTGTCTCCAACTTCATGGAGGGTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTTGATTCTCGTGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTANCCTTTCACCACTGAAATTCTGTTCTGCTACTCTGCCTTANCGNTTTCNCGTGCCANNNNNNTGAT
  5   1   2       bld DMZ       in                         xl319c21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTACATCTCAAGATATGGCAGCAAGGGCCAAGTAGAAAAATATATTCCTCAAATGACTGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGTGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTCTTTTCCTTGTGGACAACGGAACTAAAGGTTTTGTTAAGGGGAGGAAACTGGAGAAAATTGGCTTGAAGGCACAGGACACAGCAGAATTGTTTTTCGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGGCAGGAAAATAAAGGCTTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTTGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGCTGAAGACACAGATCTGTGTGGGTCGTACCTTCCTGGACAACTGTCTTCAGCTTCATGCGGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTACAGAATACTGTGG
  5   1   2       bld Ga12      in                         XL215l21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGGCTGGCAAATGCATTGGGGCTATAGCTATGACTGAGCCAGGCGCTGGCAGTGACTTACAGGGTGTTAGAACAAATGCCAAGAAAGATGGAAGATTGGATACTCAACGGCAGTAAGGTGTTTATTACCAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTGACAAACCGTGAAGCTCGCACACCCGCTCATGGGATCAGTCTTTTCCTTGTGGACAACGGAACTAAAGGTTTTGTTAAGGGGAGGAAACTGGAGAAAATTGGCTTGAAGGCACAGGACACAGCAGAATTGTTTTTCGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGGCAGGAAAATAAAGGCTTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTTGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGCTGAAGACACAGATCTGTGTGGGTCGTACCTTCCTGGACAACTGTCTTCAGCTTCATGCGGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTACAGAATACTGTGGCAACTCAGTGTCTCCAACTTCATGGA
  5   1   2       bld Lu1       in                    IMAGE:4633796.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGCTGAAGACACAGATCTGTGTGGGTCGTACCTTCCTGGACAACTGTCTTCAGCTTCATGCGGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTACAGAATACTGTGGCAACTCAGTGTCTCCAACTTCATGGAGGGTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTTGATTCTCGTGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACCACTGAAATTCTGTTCTGCTACTCTGCCTTAACGTTTTCACGTGCCATTCTTCTTCTCACATTTTCATATTGGTTTCTTCGTTTGTTACGCGGAATGATCCTATTACATGAACACATTTTTCCTGATTGCACTTATGGATGTA
  5   1   2      ests                            Xl3.1-IMAGE:8070776.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTAATGGTTAGATCTCACTCAAACTTAAAGGAGAACTGACCCCCCCCCCCAGTAATAAAAGCCCCCCTTAACTGCCTGCCATTTCCCCCCTCCCTTATCCACACTGTGCATTAGTGAAAAAGGCACCCCTGTAAAAAACTTTACCCTAAAATGCAGAGAAGTGCAGCAGAGTTCCCTAGCACCATCTACCTGTTTGACTAATGCACAGTGTGAGGAGGGAGAGGGGAGAAATGGGAGGCATTTAAGGGGGGGGGGGGTTTAGTTCATATTTAAAGGAGGCAGCAGCAAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGTTTTTTTTTTCAATAAAGCACTATTGAACA
                                                  Xl3.1-CHK-1012688843                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTTAGATCTCACTCAAACTTAAAGGAGAACTGACCCCCCCCCCCAGTAATAAAAGCCCCCCTTAACTGCCTGCCATTTCCCCCCTCCCTTATCCACACTGTGCATTAGTGAAAAAGGCACCCCTGTAAAAAACTTTACCCTAAAATGCAGAGAAGTGCAGCAGAGTTCCCTAGCACCATCTACCTGTTTGACTAATGCACAGTGTGAGGAGGGAGAGGGGAGAAATGGGAGGCATTTAAGGGGGGGGGGGGTTTAGTTCATATTTAAAGGAGGCAGCAGCAAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGTTTTTTTTTTCAATAAAGCACTATTGAACAGTTAAA
  5   1   2       bld Egg1                               PBX0116E08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACGAGGGGTTTCTTCGTTTGTTACGCGGAATGATCCTATTACATGAACACATTTTTCCTGATTGCACTTATGGATGTAGAAATAGAATCTTAAATTCTGACTGTTTGCCAATGGACTGGGTGACTTGAGTTTTATTTTGAATTCTTTCCTTTGTAAATCTGTCTGGTACCTGAAGGATTAATGGTTAGATCTCACTCAAACTTAAAGGAGAACTGAccccccccccAGTAATAAAAGCCCCCCTTGACTGCCTGCCATTTCCCCCCTCCCTTATCCACACTGTGCATTAGTGAAAAAGGCACCCCTGTAAAAAACTTTACCCTAAAATGCAGAGAAGTGCAGCAGAGTTCCCTAGCACCATCTACCTGTTTGACTAATGCACGGTGTGAGGAGGGAGAGGGGAGAAATGGGAGGCATTTAAggggggggggggTTTAGTTCATATTTAAAGGAGGCATCATCAAATACATGCCAGAGGGAATCGTTGCTAAACCATATCAATCCTTTAAGAACATGTT
  5   1   2       bld Te2       in                    IMAGE:7390925.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATAGAATCTTAAATTCTGACTGTTTGCCAATGGACTGGGTGACTTGAGTTTTATTTTGAATTCTTTCCTTTGTAAATCTGTCTGGTACCTGAAGGATTAATGGTTAGATCTCACTCAAACTTAAAGGAGAACTGAcccccccccccAGTAATAAAAGCCCCCCTTAACTGCCTGCCATTTCCCCCCTCCCTTATCCACACTGTGCATTAGTGAAAAAGGCACCCCTGTAAAAAACTTTACCCTAAAATGCAGAGAAGTGCAGCAGAGTTCCCTAGCACCATCTACCTGTTTGACTAATGCACAGTGTGAGGGGGGAGAGGGGAGAAATGGGAGGCATTTAAgggggggggggtttantgggggggggggTGGGTTNT
  5   1   2       bld Tbd2                   IMAGE:3200835-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGAAGGATTAATGGTTAGATCTCACTCAAACTTAAAGGAGAACTGAcccccccccccAGTAATAAAAGCCCCCCTTAACTGCCTGCCATTTCCCCCCTCCCTTATCCACACTGTGCATTAGTGAAAAAGGCACCCCTGTAAAAAACTTTACCCTAAAATGCAGAGAAGTGCAGCAGAGTTCCCTAGCACCATCTACCTGTTTGACTAATGCACAGTGTGAGGAGGGAGAGGGGAGAAATGGGAGGCATTTAAgggggggggggTTTAGTTCGTATTTAAAGGAGGC
  5   1   2       bld Tbd2      in                    IMAGE:3200835.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAGGATTAATGGTTAGATCTCACTCAAACTTAAAGGAGAACTGAcccccccccccAGTAATAAAAGCCCCCCTTAACTGCCTGCCATTTCCCCCCTCCCTTATCCACACTGTGCATTAGTGAAAAAGGCACCCCTGTAAAAAACTTTACCCTAAAATGCAGAGAAGTGCAGCAGAGTTCCCTAGCACCATCTACCTGTTTGACTAATGCACAGTGTGAGGAGGGAGAGGGGAGAAATGGGAGGCATTTAAggggggggggg
  5   1   2       bld Tbd6                   IMAGE:4436453-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGAACTGAcccccccccccAGTAATAAAAGCCCCCCTTAATTGGCTGCCATTTCCCCCCTCCCTTATCCACACTGTGCATTAGTGAAAAAGGCACCCCTGTAAAAAACTTTACCCTAAAATGCAGAGAAGTGCAGCAGAGTTCCCTAGCACCATCTACCTGTTTGACTAATGCACAGTGTGAGGAGGGAGAGGGGAGAAATGGGAGGCA
  3   1   2       bld Te2       in                    IMAGE:7390925.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACTTGCGAGTTAGTATTACAATAAGAACGCCCCCCCAGAAAGCCCTAAGCTGCATCCCCTCCTATCACATGCATAGAAAAGCACCCTTAAAACTTCCTAAATGCGAGAGGCAGCAGAGTCCTAGCACATCTACTGTTGATAATGCACATGTGAGGGGAGAGGGAGAAANGGAGGCATTAAGGGGGGGGGGTTTGTTCATATTAAAGGAGGCAGCAGCAAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGTTT
  3   1   2       bld FaB  5g3  in                    IMAGE:8070776.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACTTTACCCTAAAATGCAGAGAAGTGCAGCAGAGTTCCCTAGCACCATCTACTGTTTGACTAATGCACAGTGTGAGGAGGGAGAGGGGAGAAATGGGAGGCATTTAAGGGGGGGGGGGGTTTAGTTCATATTTAAAGGAGGCAGCAGCAAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGTTTTTCAGCCCCCCC
  3   1   2       bld Te2N 5g3  in                    IMAGE:7201918.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAAATGCAGAGAGTGCAGCAGAGTCCCTAGCACCATCTACNTGTTGACTAATGCACAGTGTGAGGAGGGAGAGGGGAGAAATGGGAGGCATTTAAGGGGGGGGGGGTTTAGTTCATATTTAAAGGAGGCAGCAGCAAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATAATTGCTAATGGTTTTTTCAACAGCCAGCG
  5  -1   2       bld Emb9      in                    IMAGE:7973748.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAACCCTTAGCCATTCCTCCTTCCCTGCTTGGAAGCCCCGAAAATTCCTAAGCGAAAGGCGCATTCCTACCATTCCTTTGTTATCCAGTggggaggagggggaatgggggcttaaggggggggTTTAGTCTTTTAAAGAGGCGCGGCAACACTCCAGAGGGATCGTGTAAACCATGCAATCCTTTAGAACATGTCTTTACTTTAAAGGAAAGTTTTAACAAGATATGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTtgtgtgtttatgtgtgtgtgaTTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACAAAGATTCCGCTTGGCTTTTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGttttttttttcaataaagcactattgaacagttaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk148n06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCNCANGCGNCNGNTTCCCTAGCACCATCTNCTTNNTTGNCTANTGCANANTNNGNGGAGGGAGAGGGGNAGAAATGGGNGGCNTTTANGGGGGGGGGGGGTTTAGTTCATATTTAAAGGAGGNAGCAGCAAATACATGCCAGAGGGNATCGTTGCTAAANCATAGNAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACAAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGTTTTTTTTTTNAATAAANNACTANNNNACA
  5   1   2       bld Ga18      in                      xlk148n06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCCTAGCACCATCTACCTGTTTGACTAGTGCACAGTGTGAGGAGGGAGAGGGGAGAAATGGGAGGNATTTAAggggggggggggTTTAGNTCATATTTAAAGGAGGNAGNNGNNAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGNTGAAATAAAGNGGACATTTACCCTGAAATTAACTTAAAGNATGATGTAGACAATAGTGCTGTAAGAAAGANAGNGGNTGGGCtttttgtgtgtttatgtgtgtgtgATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGNTTGGNATTTGGNAGNGGNTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGNGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGNTCTTTCTTCAGATAGAGAGNACCACCAGNATGGCTTTTCAGAATTTTACTAAGNGGNCTTTGAGNCTTAAAAGCTTTTTTCTCTGTGTTTNNNGNACGAGTAANCATGCAGNATCTCAATGACCGGNTAGNG
  3   1   2       bld DMZ       in                         xl319c21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ANGGGGGGGGGGGGTTTAGTTCATATTTAAAGGAGGCAGCAGCAAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGACAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCNTTAAATGTTCTTTCTTCAGATAGAGAGAACCNCCNGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCNCGAGTAACCNTGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATAT
  3   1   2       bld Ga12      in                         XL191f08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGGGGGGGGGGGTTTAGTTCATATTTAAAGGAGGCAGCAGCAAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTNTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTNTTACCATTAAATGTTNTTTNTTCAGATAGAGAGAACCNCCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATNTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTNTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGTTTTTTTTTTCAATAAAGCACTATGAAAAAGAAA
  3   1   2       bld DMZ       in                         xl243l05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAATTCGGCACGAGGGGCAGCAGCAAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCNTTAAATGTTCTTTCTTCAGATAGAGAGAACCNCCNGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCNCGAGTAACCNTGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATA
  3   1   2       bld DMZ       in                         xl240g01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGGGCAGCAGCAAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCNTTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATAT
  5   1   2       bld DMZ       in                         xl243l05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCAGCAGCAAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCtttttgtgtgtttatgtgtgtgtgATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGttttttttttCAATAANGC
  5   1   2      seed DMZ       in                         xl240g01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCAGCAGCAAATACATGCCAGAGGGAATCGTTGCTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCtttttgtgtgtttatgtgtgtgtgATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGttttttttttCAATAAAGC
  3   1   2       bld Tbd7      in                         XL072f06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAAACCATAGCAATCCTTTAAGAACATGTTCTTTACATTTAAAANAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAANAAANATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATANAGAGAACCNCCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCNCGAGTAACCATGCAGTATCTCAATGACCGGTTAGNGCCTGAACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGNCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAANCCAGGTTTTGTAAANGACAATATTAATTGCTAATGGGTTTTTTTTTTTCAATAAAGCACTAT
  3   1   2       bld Ov1  5g3  in                    IMAGE:5074123.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTAAAAGAAAAGTTTTAACAAGATATTGGCTCAGGCTGAAATAAAGTGGACATTTACCCTGAAATTAACTTAAAGTATGATGTAGACAATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGTTTTTTTTTTCAATAAAGCACTATTGAAC
  3   1   2       bld Tbd2      in                    IMAGE:3200835.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAGTGCTGTAAGAAAGATAGTGGTTGGTCTTTTTGTGTGTTTATGTGTGTGTGATTTAAGAATTATTAAATTTTCGTTCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGTTTTTTTTTTCAATAAAGCACTATTGAACAGTTAA
  3   1   2       add Ga12      in                         XL215l21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GNGNGATTTAAGAATTATTAAATTTTCGTTTTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTTTTACCATTAAATGTTNTTTTTTCAGATAGAGAGAACCNCCAGTATGGCTTTTCAGAATTATACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTNTNTGTGTTTAACGCNCGAGTAACCATGCAGTATNTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGCTTTTGCTGGATTCAGGGCTGCAGACTGAATNTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAAC
  3   1   2       bld Lu1       in                    IMAGE:4633796.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTGCAGCTTTTCAGTTTGGTATTTGGCAGTGGTTCAGTTGGCAGACTGAATGATGAATAGAAGATAGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCTATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTACTAAGTGGCCTTTGAGCCTTAAAAGCTTTTTTCTCTGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATAATTTTTTTTTTCAATAAAGCACTATTGAACAGTTAAAAAAAAAAAAAAA
  3   1   2       add Emb9      in                    IMAGE:7973748.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAATTGGAGAAGTGAGTGAAAAATTTAAGAATTTAAAATAATAAGCAATTCTTACCATTAAATGTTCTTTCTTCAGATAGAGAGAACCACCAGTATGGCTTTTCAGAATTTTAATAAGTGGCCTTTGAGCCTTAGAAGCTTTTTTATATGTGTTTAACGCACGAGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACAAAGATTCCGCTCGGTTTCTGCTGGATTCAGGGTTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAAATATTAATGCATAAAATGGGGG
  3   1   2       bld He1       in                    IMAGE:4406869.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTAACCATGCAGTATCTCAATGACCGGTTAGTGCCTGCACATATATTAAACCAAGATTCCGCTTGGCTTCTGCTGGATTCAGGGCTGCAGACTGAATCTGTTCCTGTTTTGTCCAAGTAATGATAAACCGAATCCTTACCTCTGTAAAATCCAGGTTTTGTAAATGACAATATTAATTGCTAATGGGTTTTTTTTTTCAATAAAGCCCTATTGACCAGAAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)