Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:3436361-IMAGp.5                11 PI      93        217      944                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:4677875-IMAGp.5                 6 PI      77        601     1199                TBP-related factor 3 [Xenopus laevis]
     3   0.0    0Xl3.1-IMAGE:8550666.3                       5 PI      75       1403     1788                TBP1 [Gallus gallus]

 This cluster: approximate FL confidence score = 97%

 1012837869 Xl3.1-IMAGE:6324598.5.5 - 29 ESTs
                                                                       -40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6324598.5.5                                         TGGTGTCATTTCTGGCACAAAACAAGAATATGAAGACTACTACATTGTAGTACTTCCTGTCACTTCCTGATCCCGAAGAACTTCAGAGGAGCTGATAAAACTTTTTACCAGTTGAGTGAGAAGCCCCTGATGATGAGCTGCTCATTGGTTGAGCAGCGTTTAGTTTACGCATGCGTGATAATCAGTGGCGCCGGGTGCAATGGTGGAGCGTTTTTAAGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTGGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACAGCACTTATATTTAGTTCGGGAAAAATGGTATGCACTGGAGCTAAAAGTGAAGAACAATCACGTTTAGCAGCAAGAAAATATGCCAGAGTTGTACAGAAACTCGGATTTCCAGCCAAGTTTTTAGATTTTAAAATACAAAATATGGTGGGAAGCTGCGATGTGAAATTCCCTATCAGATTAGAGGGACTGGTCCTTACACATCAGCAGTTTAGCAGTTATGAGCCTGAACTGTTTCCAGGTCTTATCTACAGAATGATCAAACCAAGAATTGTCCTGCTTATTTTTGTTTCTGGAAAGGTTGTACTGACAGGTGCTAAAGTTCGAGCAGAGATCTATGAAGCTTTTGAAAACATCTATCCTATCCTAAAAGGCTTTAGAAAAACAACGTAACTGCTGGATTTTTTTTAAGGGTTTTTATGTAATATAGAAAATTTTTGTACAGGATATGATGCAACAGTGGCAGAAGACCCCTACATTTATCTATGGTGTTTCATTGAAATCAGTATATTTGTGGGGCTTTGTTTCATGGAGGACAATGGTTTTACATGGACTTTTAAGTGTTTTTTTTGTTTTGTTTTTATTTTTTTTTTAACAATGTGGTTTTATCAAGAATGTTACCTTTTACATTAGTAGAAGGATGGTCAACAGGAATTTTAGATCTGCTTCCATATGTTCTGGACTAAATCAGATCAAGAGAATGCGGGTACTGTAAGGAGCCCCAATTGTAAATAGATTTAGTAAATTCATTATAATAATAATGACTGTTTTATTTCTGCACTTGAACTTATGAATATGAACCAGTAAGTTTTATTATCTAATGTGATTTATGTGAGCTTTCAGCTCATTATTCTGTTAGAATTTTTTTATTAACTAACCTTGGGATGCCTGAAACTTGAGCAACAATAACTTTAACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAAACCTGTCTTTTGTGTTTTACTTGCTTTGTGCCAAACATTCCCGATTCGCAGAATTCAGTGAGACAGAATAAATTTATAATGTTTCTGTTAAAAAAAAA
                                                  Xl3.1-CHK-1012722770                                               CATTTCTGGCACAAAACAAGAATATGAAGACTACTACATTGTAGTACTTCCTGTCACTTCCTGATCCCGAAGAACTTCAGAGGAGCTGATAAAACTTTTTACCAGTTGAGTGAGAAGCCCCTGATGATGAGCTGCTCAxxGGxTGAGCAGCGTTTAGTTTACGCATGCGTGATAATCAGTGGCGCCGGGTGCAATGGTGGAGCGTTTTTAAGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTGGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACAGCACTTATATTTAGTTCGGGAAAAATGGTATGCACTGGAGCTAAAAGTGAAGAACAATCACGTTTAGCAGCAAGAAAATATGCCAGAGTTGTACAGAAACTCGGATTTCCAGCCAAGTTTTTAGATTTTAAAATACAAAATATGGTGGGAAGCTGCGATGTGAAATTCCCTATCAGATTAGAGGGACTGGTCCTTACACATCAGCAGTTTAGCAGTTATGAGCCTGAACTGTTTCCAGGTCTTATCTACAGAATGATCAAACCAAGAATTGTCCTGCTTATTTTTGTTTCTGGAAAGGTTGTACTGACAGGTGCTAAAGTTCGAGCAGAGATCTATGAAGCTTTTGAAAACATCTATCCTATCCTAAAAGGCTTTAGAAAAACAACGTAACTGCTGGATTTTTTTTAAGGGTTTTTATGTAATATAGAAAATTTTTGTACAGGATATGATGCAACAGTGGCAGAAGACCCCTACATTTATCTATGGTGTTTCATTGAAATCAGTATATTTGTGGGGCTTTGTTTCATGGAGGACAATGGTTTTACATGGACTTTTAAGTGTTTTTTTTGTTTTGTTTTxxTxTTTTTTTTAACAATGTGGTTTTATCAAGAATGTTACCTTTTACATTAGTAGAAGGATGGTCAACAGGAATTTTAGATCTGCTTCCATATGTTCTGGACTAAATCAGATCAAGAGAATGCGGGTACTGTAAGGAGCCCCAATTGTAAATAGATTTAGTAAATTCATTATAATAATAATGACTGTTTTATTTCTGCACTTGAACTTATGAATATGAACCAGTAAGTTTTATTATCTAATGTGATTTATGTGAGCTTTCAGCTCATTATTCTGTTAGAATTTTTTTATTAACTAACCTTGGGATGCCTGAAACTTGAGCAACAATAACTTTAACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAAACCTGTCTTTTGTGTTTTACTTGCTTTGTGCCAAACATTCCCGATTCGCAGAATTCAGTGAGACAGAATAAATTTATAATGTTTCTGTTAAA
                                                      consensus depths                                              3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     5     3     5     3     7     4     7     5     8     5     8     5     9     5     9     5     9    10    11    10    11    10    11    10    11    10    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    15    15    15    15    15    15    15    15    14    14    14    14    14    14    14    14    13    13    13    13    13    13    13    13    13    13    13    13    11    11    11    11    10    11    10    11     9    10     9    10     7     9     8     9     7     8     7     8     5     6     5     6     5     6     5     5     4     5     4     5     4     5     4     6     6     7     5     6     5     6     5     6     5     6     5     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     3     6     3     6     3     6     3     6     3     6     4     7     4     7     4     6     4     6     4     6     4     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     5     4     6     4     6     4     6     4     8     4     8     4     8     4     8     4     8     4     8     4     7     4     7     7     7     7     7     7     7     7     7     7     7     6     6     5     7     5     6     5     6     5     8     5     8     5     8     5     8     5     8     8     8     7     8     8     8     9     9     8     8     8     8     6     8     6     8     7     9     7     9     6     9     8    10     8    10     8    10     8    11     9    11     9    11     9    11     9    11     9    11     9    11     8    11     8    11     8    11     7    10     7    10     6     8     5     7     5     5     4     4
  5   1   2       e>1                            Xl3.1-IMAGE:6324598.5                                   TGTGTATGGTGTCATTTCTGGCACAAAACAAGAATATGAAGACTACTACATTGTAGTACTTCCTGTCACTTCCTGATCCCGAAGAACTTCAGAGGAGCTGATAAAACTTTTTACCAGTTGAGTGAGAAGCCCCTGATGATGAGCTGCTCAAAGGCTGAGCAGCGTTTAGTTTACGCATGCGTGATAATCAGTGGCGCCGGGTGCAATGGTGGAGCGTTTTTAAGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTGGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACAGCACTTATATTTAGTTCGGGAAAAATGGTATGCACTGGAGCTAAAAGTGAAGAACAATCACGTTTAGCAGCAAGAAAATATGCCAGAGTTGTACAGAAACTCGGATTTCCAGCCAAGTTTTTAGATTTTAAAATACAAAATATGGTGGGAAGCTGCGATGTGAAATTCCCTATCAGATTAGAGGGACTGGTCCTTACACATCAGCAGTTTAGCAGTT
  5   1   2       e>1                            Xl3.1-IMAGE:8464041.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAAGAACAATCACGTTTAGCAGCAAGAAAATATGCCAGAGTTGTACAGAAACTCGGATTTCCAGCCAAGTTTTTAGATTTTAAAATACAAAATATGGTGGGAAGCTGCGATGTGAAATTCCCTATCAGATTAGAGGGACTGGTCCTTACACATCAGCAGTTTAGCAGTTATGAGCCTGAACTGTTTCCAGGTCTTATCTACAGAATGATCAAACCAAGAATTGTCCTGCTTATTTTTGTTTCTGGAAAGGTTGTACTGACAGGTGCTAAAGTTCGAGCAGAGATCTATGAAGCTTTTGAAAACATCTATCCTATCCTAAAAGGCTTTAGAAAAACAACGTAACTGCTGGATTTTTTTTAAGGGTTTTTATGTAATATAGAAAATTTTTGTACAGGATATGATGCAACAGTGGCAGAAGACCCCTACATTTATCTATGGTGTTTCATTGAAATCAGTATATTTGTGGGGCTTTGTTTCATGGAGGACAATGGTTTTACATGGACTTTTAAGTGTTTTTTTTGTTTTGTTTTATTATTTTTTTTAACAATGTGGTTTTATCAAGAATGTTACCTTTTACATTAGTAGAAGGATGGTCAACAGGAATTTTAGATCTGCTTCCATATGTTCTGGACTAAATCAGATCAAGAGAATGCGGGTACTGTAAGGAGCCCCAATTGTAAATAGATTTAGTAAATTCATTATAATAATAATGACTGTTTTATTTCTGCACTTGAACTTATGAATATGAACCAGTAAGTTTTATTATCTAATGTGATTTATGTGAGCTTTCAGCTCATTATTCTGTTAGAATTTTTTTATTAACTAACCTTGGGATGCCTGAAACTTGAGCAACAATAACTTTAACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAAACCTGTCTTTTGTGTTTTACTTGCTTTGTGCCAAACATTCCCGATTCGCAGAATTCAGTGAGACAGAATAAATTTATAATGTTTCTGTTAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                         AAGGCTGCTGTTTCGAGAATGGAGTTCAAAGATAAGGAGCTCTGAACAAATTACTCTATTCATAAAAGGAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAATCAGTATATTTGTGGGGCTTT
                                                                   SNP                                                                                                                                                                                                                                                                 G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---T--------
                                               BLH ATG     314     690                                         
                                               BLH MIN     308     177                                         
                                               BLH MPR      62     177                                         
                                               BLH OVR     314     821                                         
                                               ORF LNG     314      53                                         
  5   1   2       e>1                            Xl3.1-IMAGE:6324598.5                                   TGTGTATGGTGTCATTTCTGGCACAAAACAAGAATATGAAGACTACTACATTGTAGTACTTCCTGTCACTTCCTGATCCCGAAGAACTTCAGAGGAGCTGATAAAACTTTTTACCAGTTGAGTGAGAAGCCCCTGATGATGAGCTGCTCAAAGGCTGAGCAGCGTTTAGTTTACGCATGCGTGATAATCAGTGGCGCCGGGTGCAATGGTGGAGCGTTTTTAAGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTGGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACAGCACTTATATTTAGTTCGGGAAAAATGGTATGCACTGGAGCTAAAAGTGAAGAACAATCACGTTTAGCAGCAAGAAAATATGCCAGAGTTGTACAGAAACTCGGATTTCCAGCCAAGTTTTTAGATTTTAAAATACAAAATATGGTGGGAAGCTGCGATGTGAAATTCCCTATCAGATTAGAGGGACTGGTCCTTACACATCAGCAGTTTAGCAGTT
                                                  Xl3.1-CHK-1012691939                                         TGGTGTCATTTCTGGCACAAAACAAGAATATGAAGACTACTACATTGTAGTACTTCCTGTCACTTCCTGATCCCGAAGAACTTCAGAGGAGCTGATAAAACTTTTTACCAGTTGAGTGAGAAGCCCCTGATGATGAGCTGCTCAxxGGxTGAGCAGCGTTTAGTTTACGCATGCGTGATAATCAGTGGCGCCGGGTGCAATGGTGGAGCGTTTTTAAGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTGGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACAGCACTTATATTTAGTTCGGGAAAAATGGTATGCACTGGAGCTAAAAGTGAAGAACAATCACGTTTAGCAGCAAGAAAATATGCCAGAGTTGTACAGAAACTCGGATTTCCAGCCAAGTTTTTAGATTTTAAAATACAAAATATGGTGGGAAGCTGCGATGTGAAATTCCCTATCAGATTAGAGGGACTGGTCCTTACACATCAGCAGTTTA
  5   1   2       bld Egg1 5g                            PBX0138F01.5p GCGAGTGTAAATCAAGTGTGAGCTGCAGCAGAAATGTGTATGGTGTCATTTTTGGCACAAAACAAGAATATGAAGACTACTACATTGTAGTTCTTCCTGTCACTTCCTGATCCCGAAGAACTTCAGAGGAGCTGATAAAACTTTTTACCAGTTGAGTGAGAAGCCCCTGATGATGAGCTGCTCAAAGGCTGCTGTTTCGAGAATGGAGTTCAAAGATAAGGAGCTCTGAACAAATTACTCTATTCATAAAAGGAGGGGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACC
  5   1   2       bld Spl  5g                         IMAGE:8461067.5p     CGGGTGCAATGGTGGAGCGTTTTTAAGAAATGTGTATGGTGTCATTTCTGGCACAAAACAAGAATATGAAGACTACTACATTGTAGTACTTCCTGTCACTTCCTGATCCCGAAGAACTTCAGAGGAGCTGATAAAACTTTTTACCAGTTGAGTGAGAAGCCCCTGATGATGAGCTGCTCAAAGGCTGCTGTTTCGAGAATGGAGTTCAAAGATAAGGAGCTCTGAACAAATTACTCTATTCATAAAAGGAGGGGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTCCTCAGCTACAGACATAGTGTCACTGTAATCTGGCTGCAACTGGGACTAAACATTGCACTAGAGCGCGATGCGAGTAACCNNAGCGTTTGCGCTGTTATGAGATCAGACCCGTCACGCCTTAATAGTG
  5   1   2       bld Spl  5g3  in                    IMAGE:8464041.5p          GTGCATGGTGGAGCGTTTTTAGAAATGTGTATGGTGTCATTTCTGGCACAAAACAAGAATATGAAGACTACTACATTGTAGTACTTCCTGTCACTTCCTGATCCCGAAGAACTTCAGAGGAGCTGATAAAACTTTTTACCAGTTGAGTGAGAAGCCCCTGATGATGAGCTGCTCAAAGGCTGCTGTTTCGAGAATGGAGTTCAAAGATAAGGAGCTCTGAACAAATTACTCTATTCATAAAAGGAGGGGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073624.5p                                                                                                                                       CCACGCGTCCGGGCTGCGCAAACGGGAAGTGATGTCATTCATTAGACTGATTGGTTGAGCAGCGTTTAGTTTACGCATGCGTGATAATCAGTGGCGCCGGGTGCAATGGTGGAGCGTTTTTAAGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCAT
  3  -1   2       bld Tbd4                            IMAGE:4059795.3p                                                                                                                                             TCAGAATAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGGATTGGTTGAGCAGCGTTTAGTTTACGCATGCGTGATAATCAGTGGCGCCGGGTGCAATGGTGGAGCGTTTTTAAGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATATGGGG
  5   1   2       bld Ooc1 5g3  in                     Ooc1-db26h10.y1                                                                                                                                                                  GGGTCGACCCACGCGTCCGCTGATTGGTTGAGCAGCGTTTAGTTTACGCATGCGTGATAATCAGTGGCGCCGGGTGCAATGGTGGAGCGTTTTTAAGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAGACTGGACCTAAAAACAATTGCACTT
  5   1   2       bld Neu7 5g3  in                         XL023e04.5p                                                                                                                                                                      TGTCATTCATTAGNACTGATTGGTTGAGCAGCGTTTAGTTTACGCATGCGTGATAATCAGTGGCGCCGGGTGCAATGGTGGAGCGTTTTTAAGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAA
  5   1   2       bld Egg3 5g                         IMAGE:3378239.5p                                                                                                                                                                                               CCGGGGCGTTTAGTTTACGCATGCGTGATAATCAGTGGCGCCGGGTGCAATGGTGGAGCGTTTTTAAGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTACAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAGTTGTTCCTCAGCTACAGAGCATAGTGTCCACTGTAAATCTTGGCTTGCAACTGGACCTAGATGCAATTGCGCTTATAGCGCGATATGCAGAGTATAACCCAAAGCGTTATGCTGCTGTTATGATGAAGATTCGAGAGCCACGTACAGCAGGTCTTGTATTGAGTTTCGGAAAAATGGTATGCTACTGAGCTTAAAGTGAATACAATCC
  5   1   2       bld Ga12 5g3  in                         XL220c13.5p                                                                                                                                                                                                                  GGTTTTTAAGGTGAGCGCGCGAGTGTAAATCAAGTGTGAGCTGCAGCAGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCT
  5   1   2       bld Egg3 5g                         IMAGE:6323529.5p                                                                                                                                                                                                                                                        AAGAACTTCCAAAGACTTTGCCTGCCCCGCTTGCCCCATTTTCCTTTCGCACAATAGCACCCTACATTACATTCCCTGCGCCATTTCCCACTGACACCACATGCATCAAAACAACAGCATACCCCCTTTCCACCGGCTGGCATCACCACACGGCCTCTATAACACCGCCGATTACCATTTTCACACCGATGCCTTATGGAACTGGCCTGACCCCCCAACCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTGGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACAGCACTTATATTTTAGTTCGGGAAAAATGGTATGCACCGGGAGCCTAAAATGAAAAAACAATCACGTTTAGCAGCAAGAAAAATTATGCCCAGAGTTGTACAAAAACTCGGATTTCCAGCCCAAGTTTTAAAATTTTAAAATACCAAACAATGGTGGGAAAGCTGCCCAAGTGAAATTCCCCCATCAAATACGAGGGGACTGGGTCCCTTACCCCTTCAGCCAGGTTTAACCAGGTACATGAACCCCTAAACTGGTTTCCAAGAGCCCTTATCCCACCCAAAATGATTCCAAACCCCACGAATTAGGGCCCCCGCCCTCAAATTCTTGGGGCTCCCACGGAAAAAGAGTCA
  5   1   2      seed Egg3 5g                         IMAGE:6324598.5p                                                                                                                                                                                                                                                        CCCCGGGGCAGGACTTTTGTCTGCAGCTGGAATGGTTTATTTTAATTTGTAAGAATAGCACACTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTGGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACAGCACTTATATTTAGTTCGGGAAAAATGGTATGCACTGGAGCTAAAAGTGAAGAACAATCACGTTTAGCAGCAAGAAAATATGCCAGAGTTGTACAGAAACTCGGATTTCCAGCCCAAGTTTTTAGATTTTAAAATACAAAATATGGTGGGGAAGCTGCGATGTGAAATTCCCCTATCAGAATTAGAGGGACTGGGTCCTTACACATCAGCAAGTTAACAGGTTATGAAGCCTGGACCTGTTTTCCAGGGTCTTTATCTACAGAAATGATCCAACCCCAGAAATTGGTCCTGCCTTATTTTTTGG
  5   1   2       bld Gas7 5g                         IMAGE:4084020.5p                                                                                                                                                                                                                                                                                                                 CCGGGCTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTGGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAG
  5   1   2       bld Gas7 5g                         IMAGE:4084021.5p                                                                                                                                                                                                                                                                                                                 CCGGGCTTTATTTTATTCTTTGTGGGATTTCCAATTGACACAACATGGATCAAAACAACAGCATACCCCCTTTCCAGGGGCTGGCATCACCACAGGGTTCTCTAACACCGGCGATTAACATTTTCAGTCCGATGCCTTATGGAACTGGTCTGACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTGGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAA
  5   1   2       bld Egg2      in                    IMAGE:5162441.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCCCCCAGCCTGTGCAAACAATTAACAGTTTATCAGTATTGGAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTGGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACAGCACTTATATTTAGTTCGGGAAAAATGGTATGCACTGGAGCTAAAAGTGAAGAACAATCACGTTTAGCAGCAAGAAAATATGCCAGAGTTGTACAGAAACTCGGATTTCCAGCCAAGTTTTTAGATTTTAAAATACAAAATATGGTGGGAAGCTGCGATGTGAAATTCCCTATCAGATTAGAGGGACTGGTCCTTACACATCAGCAGTTTAGCAGTTAT
  5   1   2       bld Oo1                             IMAGE:6642810.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGAACAGCAAAGACAACAGCAGCAGACACAGCAGTCAACATCACAACAAGTGAATCTGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAAACTCTTACTACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATGACTCCAATGACACCCATTACTCCTGCCACCCCTGCATCAGAAAGCTCGGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTGGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACAGCACTTATATTTAGTTCGGGAAAAATGGTATGCACTGGAGCTAAAAGTGAAGAACAATCACGTTTAGCAGCAAGAAAATATGCCAGAGTTGTACAGAAACTCGGATTTCCAGCCAAGTTTTTAGATTTTAAAATACAAAATATGGTGGGAAGCTGCGATGTGAAATTCCCTATCAGATTAGAGGGACTGGTCCTTACACATCAGCAGTTTAGCAGTTATGAGCCTGAACTGTTTCCAGGTCTTATCTACAGAATGATCAAACCAAGAATTGTCCTGCTTATTTTTGTTTCTGGAAAGGTTGTACTGACAGGTGCTAAAGTTCGAGCAGAGATCTATGAAGCTTTTGAAGACATCTATCCTATCCTAGAAGGCTTTAGAAAAACAACGTAACTGCTGGATCTTTTTTAAGGGTTTTTATGTAATATAGGAAATTTTCTGTACAGGATATGATGCAACAGTGGCAGAAGACCCCTACATTTATCTATGGTGGTTCATTGAAATCAGTATATTTTGTGGGGGCTTGTTTTCATGGAGGACNAATGGTCTTACATGGGACTTTTT
  5   1   2       e>1                            Xl3.1-IMAGE:8464041.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAAGAACAATCACGTTTAGCAGCAAGAAAATATGCCAGAGTTGTACAGAAACTCGGATTTCCAGCCAAGTTTTTAGATTTTAAAATACAAAATATGGTGGGAAGCTGCGATGTGAAATTCCCTATCAGATTAGAGGGACTGGTCCTTACACATCAGCAGTTTAGCAGTTATGAGCCTGAACTGTTTCCAGGTCTTATCTACAGAATGATCAAACCAAGAATTGTCCTGCTTATTTTTGTTTCTGGAAAGGTTGTACTGACAGGTGCTAAAGTTCGAGCAGAGATCTATGAAGCTTTTGAAAACATCTATCCTATCCTAAAAGGCTTTAGAAAAACAACGTAACTGCTGGATTTTTTTTAAGGGTTTTTATGTAATATAGAAAATTTTTGTACAGGATATGATGCAACAGTGGCAGAAGACCCCTACATTTATCTATGGTGTTTCATTGAAATCAGTATATTTGTGGGGCTTTGTTTCATGGAGGACAATGGTTTTACATGGACTTTTAAGTGTTTTTTTTGTTTTGTTTTATTATTTTTTTTAACAATGTGGTTTTATCAAGAATGTTACCTTTTACATTAGTAGAAGGATGGTCAACAGGAATTTTAGATCTGCTTCCATATGTTCTGGACTAAATCAGATCAAGAGAATGCGGGTACTGTAAGGAGCCCCAATTGTAAATAGATTTAGTAAATTCATTATAATAATAATGACTGTTTTATTTCTGCACTTGAACTTATGAATATGAACCAGTAAGTTTTATTATCTAATGTGATTTATGTGAGCTTTCAGCTCATTATTCTGTTAGAATTTTTTTATTAACTAACCTTGGGATGCCTGAAACTTGAGCAACAATAACTTTAACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAAACCTGTCTTTTGTGTTTTACTTGCTTTGTGCCAAACATTCCCGATTCGCAGAATTCAGTGAGACAGAATAAATTTATAATGTTTCTGTTAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012692406                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAATCACGTTTAGCAGCAAGAAAATATGCCAGAGTTGTACAGAAACTCGGATTTCCAGCCAAGTTTTTAGATTTTAAAATACAAAATATGGTGGGAAGCTGCGATGTGAAATTCCCTATCAGATTAGAGGGACTGGTCCTTACACATCAGCAGTTTAGCAGTTATGAGCCTGAACTGTTTCCAGGTCTTATCTACAGAATGATCAAACCAAGAATTGTCCTGCTTATTTTTGTTTCTGGAAAGGTTGTACTGACAGGTGCTAAAGTTCGAGCAGAGATCTATGAAGCTTTTGAAAACATCTATCCTATCCTAAAAGGCTTTAGAAAAACAACGTAACTGCTGGATTTTTTTTAAGGGTTTTTATGTAATATAGAAAATTTTTGTACAGGATATGATGCAACAGTGGCAGAAGACCCCTACATTTATCTATGGTGTTTCATTGAAATCAGTATATTTGTGGGGCTTTGTTTCATGGAGGACAATGGTTTTACATGGACTTTTAAGTGTTTTTTTTGTTTTGTTTTxxTxTTTTTTTTAACAATGTGGTTTTATCAAGAATGTTACCTTTTACATTAGTAGAAGGATGGTCAACAGGAATTTTAGATCTGCTTCCATATGTTCTGGACTAAATCAGATCAAGAGAATGCGGGTACTGTAAGGAGCCCCAATTGTAAATAGATTTAGTAAATTCATTATAATAATAATGACTGTTTTATTTCTGCACTTGAACTTATGAATATGAACCAGTAAGTTTTATTATCTAATGTGATTTATGTGAGCTTTCAGCTCATTATTCTGTTAGAATTTTTTTATTAACTAACCTTGGGATGCCTGAAACTTGAGCAACAATAACTTTAACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAAACCTGTCTTTTGTGTTTTACTTGCTTTGTGCCAAACATTCCCGATTCGCAGAATTCAGTGAGACAGAATAAATTTATAATGTTTCTGTTAAAAAAA
  3   1   2       bld Egg1                            IMAGE:3301736.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGGTATGCCTGGGAGCTAAAAGTGAAGAACAATCACGTTTAGCAGCAAGAAAATATGCCAGAGTTGTACAGAAACTCGGATTTCCAGCCAAGTTTTTAGATTTTAAAATACAAAATATGGTGGGAAGCTGCGATGTGAAATTCCCTATCAGATTAGAGGGACTGGTCCTTACACATCAGCAGTTTAGCAGTTATGAGCCTGAACTGTTTCCAGGTCTTATCTACAGAATGATCAAACCAAGAATTGTCCTGCTTATTTTTGTTTCTGGAAAGGTTGTACTGACAGGTGCTAAAGTTCGAGCAGAGATCTATGAAGCTTTTGAAAACATCTATCCTATCCTAAAAGGCTTTAGAAAAACAACGTAACTGCTGGATTTTTTTTAAGGGTTTTTATGTAATATAGAAAATTTTTGTACAGGATATGATGCAACAGTGGCAGAAGACCCCTACATTTATCTATGGTGTTTCATTGAAATCAGTATATTTGTGGGGCTTTGTTTCATGGAGGACAATGGTTTTACATGGACTTTTAAGTGTTTTTTTTGTTTTGTTTTTATTTTTTTTTTAACAATGTGGTTTTATCAAGAATGTTACCTTTTACATTAGTAGAAGGATGGTCAACAGGAATTTAAAATAAAAAAAAAAA
  3   1   2       bld Egg2      in                    IMAGE:5162441.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGAGCTAAAAGTGAAGAACAATCACGTTTAGCAGCAAGAAAATATGCCAGAGTTGTACAGAAACTCGGATTTCCAGCCAAGTTTTTAGATTTTAAAATACAAAATATGGTGGGAAGCTGCGATGTGAAATTCCCTATCAGATTAGAGGGACTGGTCCTTACACATCAGCAGTTTAGCAGTTATGAGCCTGAACTGTTTCCAGGTCTTATCTACAGAATGATCAAACCAAGAATTGTCCTGCTTATTTTTGTTTCTGGAAAGGTTGTACTGACAGGTGCTAAAGTTCGAGCAGAGATCTATGAAGCTTTTGAAAACATCTATCCTATCCTAAAAGGCTTTAGAAAAACAACGTAACTGCTGGATTTTTTTTAAGGGTTTTTATGTAATATAGAAAATTTTTGTACAGGATATGATGCAACAGTGGCAGAAGACCCCTACATTTATCTATGGTGTTTCATTGAAATCAGTATATTTGTGGGGCTTTGTTTCATGGAGGACAATGGTTTTACATGGACTTTTAAGTGTTTTTTTTGTTTTGTTTTTATTTTTTTTTTAACAATGTGGTTTTATCAAGAATGTTACCTTTTACATTAGTAGAAGGATGGTCAACAGGAAT
  3   1   2       bld Spl  5g3  in                    IMAGE:8464041.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGATGTCGCATGATATCATAGGAGTGTGATCNTCTGAGATGCTCCTGCATGCATAACTGATTCAGTTATTCGAGATCACCAGATGTCTGTATTTGTTTGAAGTGTATGACAGTGTAAGTCAGCAGAATTATGAGCTTGAAAACATTATCTATCTAAAAGCTTAGAAAAACACGTACTGCTGATTTTTTTAAGGGTTTTATGTAATTAGAAAATTTTGTACAGGATATGATGCAACAGTGGCAGAAGACCCCTACATTTATCTATGGTGTTTCATTGAAATCAGTATATTTGTGGGGCTTTGTTTCATGGAGGACAATGGTTTTACATGGACTTTTAAGTGTTTTTTTTTTGTTTTGTTTTGTTTTTTATTATTTTTTTTAACAATGTGGTTTTATCAAGAATGTTACCTTTTACATTAGTAGAAGGATGGTCAACAGGAATTTTAGATCTGCTTCCATATGTTCTGGACTAAATCAGATCAAGAGAATGCGGGTACTGTAAGGAGCCCCAATTGTAAATAGATTTAGTAAATTCATTATAATAATAATGACCGTTTTATTTCTGCACTTGAACTTATGAATATGAACCAGTAAGTTTTATTATCTAATGTGATTTATGTGAGCTTTCAGCTCATTATTCTGTTAGAATTTTTTTATTAACTAACCTTGGGATGCCTGAAACTTGAGCAACAATAACTTTTACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAAACCTGTCTTTTGTGTTTTACTTGCTTTGTGCCAAACATTCCCCCTTCGCCGAATTCAAGGGTACATCTATACCCGG
  5   1   2       bld Egg1                               PBX0047A05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGTCCTGCTTATTTTTGTTTCTGGAAAGGTTGTACTGACAGGTGCTAAAGTTCGAGCAGAGATCTATGAAGCTTTTGAAAACATCTATCCTATCCTAGAAGGCTTTAGAAAAACAACGTAACTGCTGGAttttttttAAGGGTTTTTATGTAATATAGAAAATTTTTGTACAGGATATGATGCAACAGTGGCAGAAGACCCCTACATTTATCTATGGTGTTTCATTGAAATCAGTATATTTGTGGGGCTTTGTTTCATGGAGGACAATGGTTTTACATGGACttttaagtgttttttttgatttgtctgtattttttttttAACAATGTGGTTTTATCAAGAATGTTACCTTTTACATTAGTAGAAGGATGGTCAACAGGAATTTTAGATCTGCTTCCATATGTTCTGGACTAAATCAGATCAAGAGAATGCGGGTACTGTAAGGAGCCCCAATTGTAAATAGATTTAGTAAATTCATTATAATAATAATGACTGGTTTATTTCTGCACTTGAACTTATGAATATGAACCA
  3   1   2       bld Neu7 5g3  in                         XL023e04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATGCAACAGTGACAGAAGACCCCTACATTTATCTATGGTGTTTCATTGAAATCAGTATATTTGTGGGGCTTTGTTTCATGGAGGACAATGGTTTTACATGGACTTTTAAGTGTTTTTTTTGTTTTGTTTTTATTTTTTTTTTAACAATGTGGTTTTATCAAGAATGTTACCTTTTACATTAGTAGAAGGATGGTCAACAGGAATTTTAGATCTGCTTCCATATGTTCTGGACTAAATCAGATCAAGAGAATGCGGGTACTGTAAGGAGCCCCAATTGTAAATAGATTTAGTAAATTCATTATAATAATAATGACTGTTTTATTTCTGCACTTGAACTTATGAATATGAACCAGTAAGTTTTATTATCTAATGTGATTTATGTGAGCTTTCAGCTCATTATTCTGTTAGAATTTTTTTATTAACTAACCTTGGGATGCCTGAAACTTGAGCAACAATAACTTTAACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGCANTATATTAAACCTGTCTTTTGTGTTTAACTTGCTTTGTGCCAAACATTCCCGATTCGCAGAATTCAG
  5   1   2       bld Ga18      in                        xlk4a12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGAAATCAGTATATTTGTGGGGCTTTGTTTCATGGAGGACAATGGTTTTACATGGACTTTTAAGTGttttttttttgttttgttttgttttttattattttttttAACAATGTGGTTTTATCAAGAATGTTACCTTTTACATTAGTAGAAGGATGGTCAACAGGAATTTTAGATCTGCTTCCATATGTTCTGGACTAAATCAGATCAAGAGAATGCGGGTACTGTAAGGAGCCCCAATTGTAAATAGATTTAGTAAATTCATTATAATAATAATGACCGTTTTATTTCTGCACTTGAACTTATGAATATGAACCAGTAAGTTTTATTATCTAATGTGAATTTATGTGAGCTTTCAGCTCATTATTCTGTTAGAATTTTTTTATTAACTAACTGCCTGAAACTTGAGCAACAATAACTTTTACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAAACCTGTCTTTTGTGTTTTACTTGCTTTGTGCCAAACATTCCCGATTCGCAGAATTCAGTGAGACAGATAATTATAATGTNCTGTNNNT
  3   1   2       add Ga18      in                        xlk4a12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATNGAAATCAGTATATTTGTGGGGCTTTNTTTCATGGAGGACAANGNTTTTACANGGNNTTTTAANNNTTTTTTTTnnGTTnTGTTTTGTTTTTTATTATTTTTTTTAACAATGTGGTTTTATCAAGAATGTTNCCTTTTACATTAGTAGAAGGATGGTCAACAGGAATTTTAGATCTGCTTCCATATGTTCTGGACTAAATCAGATCAAGAGAATGCGGGTACTGTAAGGAGCCCCAATTGTAAATAGATTTAGTAAATTCATTATAATAATAATGACCGTTTTATTTCNGCACTTGAACTTATGAATATGAACCAGTAAGTTTTATTATCTAATGTGAATTTATGNNNNNNNCAGCTCATTATTCTGTTAGAATTTTTTTATTANCTAACTGCCTGAAACTTGAGCAACAATAACTTTTACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAANCCTNTCTTTTGTGTTTNACTTGCTTTGTNCCAA
  5   1   2       bld Gas8                            IMAGE:3517185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAATTTTAGATCTGCTTCCATATGTTCTGGATTAAATCAGATCAAGAGAATGCGGGTACTGTAAGGAGCCCCAATTGTAAATAGATTTAGTAAATTCATTATATAATAATGACTGTTTTATTTCTGCACTTGAACTTATGAATATGAACCAGTAAGTTTTATTATCTAATGTGATTTATGTGAGCTTTCAGCTCATTATTCTGTTAGAATTTTTTTATTAACTAACCTTGGGATGCCTGAAACTTGAGCAACAATAACTTTAACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAAACCTGTCTTTTGTGTTTTACTTGCTTTGTGCCAAACATTCCCGATTCGCAGAATTCAGTGAGACAGAATAAATTTATAATGTTTCTGTTaaaaaaaaaaaaa
  3   1   2       bld Ooc1                             Ooc1-db33h11.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTAAATCAGATCAAGAGAATGCGGGTACTGTAAGGAGCCCCAATTGTAAATAGATTTAGTAAATTCATTATAATAATGACTGTTTTATTTCTGCACTTGAACTTATGAATATGAACCAGTAAGTTTTATTATCTAATGTGATTTATGTGAGCTTTCAGCTCATTATTCTGTTAGAATTTTTTTATTAACTAACCTTGGGATGCCTGAAACTTGAGCAACAATAACTTTAACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAAACCTGTCTTTTGTGTTTTACTTGCTTTGTGCCAAACATTCCCGATTCGCAGAATTCAGTGAGACAGAATAAATTTATAATGTTTCTGTTCAAAAAAAAAAAAAAAA
  3   1   2      seed Ooc1 5g3  in                     Ooc1-db26h10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAATCAGATCAAGAGAATGCGGGTACTGTAAGGAGCCCCAATTGTAAATAGATTTAGTAAATTCATTATAATAATGACTGTTTTATTTCTGCACTTGAACTTATGAATATGAACCAGTAAGTTTTATTATCTAATGTGATTTATGTGAGCTTTCAGCTCATTATTCTGTTAGAATTTTTTTATTAACTAACCTTGGGATGCCTGAAACTTGAGCAACAATAACTTTAACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAAACCTGTCTTTTGTGTTTTACTTGCTTTGTGCCAAACATTCCCGATTCGCAGAATTCAGTGAGACAGAATAAATTTATAATGTTTCTGTTAAAAAAAAAAAAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073624.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACTTATGAATATGAACCAGTAAGTTTTATTATCTAATGTGATTTATGTGAGCTTTCAGCTCATTATTCTGTTAGAATTTTTTTATTAACTAACCTTGGGATGCCTGAAACTTGAGCAACAATAACTTTAACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAAACCTGTCTTTTGTGTTTTACTTGCTTTGTGCCAAACATTCCCGATTCGCAGAATTCAGTGAGACAGAATAAATTTATAATGTTTCTGTTAAAAAAAAAAAAAAAAG
  3   1   2       bld Ga18      in                      xlk162g02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCTAGATCGCGNNNNNCGCCCTTTTTTTTTTTAACTAACTGCCTGAAACTTGAGCAACAATAACTTTTACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAAACCTGTCTTTTGTGTTTTACTTGCTTTGTNCCAANCNTTCCCGATTCNCAG
  5   1   2       bld Ga18      in                      xlk162g02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            tAACTAACTGCCTGAAACTTGAGCAACAATAACTTTTACTACAAGTTGATTTGATTTGGCCGATACTTTAATTGCTTGTAGATTGTATTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAAACCTGTCTTTTGTGTTTTACTTGCTTTGTGCCAAACATTCCCGATTCGCAGAATTCAGTGAGACAGAATAAATTTATAATGTTTCTGTTaaaaaaaaaa
  3   1   2       add Ga12 5g3  in                         XL220c13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTACAAGTTGATNNGATTTGNCCGATACTTTAATTGCTTGTAGATTGTANTACATCTGAAACCACTCAGAACTGTATTATATGCTCAAAAGACTATATTAAACCTGTCTTTTGTGTTTTACTTGCTTTGTGCCAAACATTCCCGATTCGCAGAATTCAGTGAGACAGAATAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)