Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:3745782.3                       4 END     1           3       25                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl264h03.5                           10 PI      93        150     1244                MAD homolog 1 [Xenopus tropicalis]
     3   0.0    0Xl3.1-IMAGE:6643837.5                       7 PI      89       1074     2004                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:3437397-IMAGp.5                 5 PI      79        368      707                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012837871 Xl3.1-IMAGE:6860267.5.5 - 29 ESTs
                                                                       ....-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6860267.5.5                         CTTTGCAGACGCTCCCTGCCTGGGTGTGTATGTTGTGTATTGGCAGCTGGGCGGCTTCGACTCCCTGACGCCAGAGAGTCCAGATCAATCCAGGCAGCCGGGGAGAGAGGAGGAGAAGGAGGGAGCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCGTATCATTACAAACGAGTGGAGAGTCCTGTCTTGCCACCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCACAGCACAGTCTCCTTGCGCAATTCCGAAACTTGGAGCCAAGCGAGCCACATATGCCTCACAACGCAACTTTTCCAGACTCTTTCCAGCAGCCAAACAGCCATCCGTTCCCTCACTCGCCGAACAGCAGCTACCCAAACTCTCCGGGAAGCGGCAGTACTTATCCTCACTCACCAGCGAGCTCTGATCCTGGGAGCCCTTTTCAAATACCAGCTGACACCCCTCCTCCAGCTTATATGCCTCCCGAGGATCAGATGACGCAAGACAACTCTCAGCCAATGGACACAAATCTGATGGTGCCTAACATCTCTCAAGATATCAATAGAGCAGATGTCCAGGCTGTTGCATATGAAGAGCCAAAACACTGGTGCTCCATTGTCTATTATGAGCTCAACAACCGTGTTGGAGAAGCTTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGCTTCACTGATCCTTCAAACAACAGGAACAGATTTTGCCTTGGGCTTCTGTCTAATGTGAACCGAAACTCGACCATTGAGAACACCAGGCGGCATATTGGAAAAGGTGTGCATTTATACTATGTTGGGGGTGAAGTCTATGCCGAATGCTTAAGTGACAGCAGCATTTTTGTTCAGAGCCGGAATTGTAACTTTCACCACGGTTTCCATCCTACAACTGTGTGTAAAATCCCCAGCGGATGCAGCCTAAAGATTTTTAACAACCAAGAATTTGCTCAGCTTTTGGCCCAGTCTGTAAACCATGGCTTTGAAACTGTCTATGAACTGACAAAGATGTGCACTATTCGGATGAGTTTTGTCAAGGGATGGGGTGCAGAATATCATCGCCAGGATGTCACAAGCACCCCCTGCTGGATTGAGATTCACCTGCACGGCCCCCTTCAATGGCTGGATAAAGTACTAACTCAGATGGGCTCACCCCATAATCCCATCTCCTCGGTCTCTTAATGGATTAGGATGTTCCTGCCTCTGGATTCATTGGAGCCATGCATGTACTTGAAGGAGTCAGACNCTTACTGGCAAATGGGACATTGGTAGTTTTTTTTTTTTTAAAGTCTTGGGGGAGCGATAAGCCCCTCATCTACTTGATGTTTGTGACCAACTCTTACAAGAGGAGCTCTATAGAGCCAATGCCCTGCTCTTCTGCTGTTGCCTAATTTAATATGGCTCCCTAAGCAGCAGCCGATATTAATTTTCTAATCCAG
                                                  Xl3.1-CHK-1012722772                               AGACGCTCCCTGCCTGGGTGTGTATGTTGTGTATTGGCAGCTGGGCGGCTTCGACTCCCTGACGCCAGAGAGTCCAGATCAATCCAGGCAGCCGGGGAGAGAGGAGGAGAAGGAGGGAGCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCGTATCATTACAAACGAGTGGAGAGTCCTGTCTTGCCACCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCACAGCACAGTCTCCTTGCGCAATTCCGAAACTTGGAGCCAAGCGAGCCACATATGCCTCACAACGCAACTTTTCCAGACTCTTTCCAGCAGCCAAACAGCCATCCGTTCCCTCACTCGCCGAACAGCAGCTACCCAAACTCTCCGGGAAGCGGCAGTACTTATCCTCACTCACCAGCGAGCTCTGATCCTGGGAGCCCTTTTCAAATACCAGCTGACACCCCTCCTCCAGCTTATATGCCTCCCGAGGATCAGATGACGCAAGACAACTCTCAGCCAATGGACACAAATCTGATGGTGCCTAACATCTCTCAAGATATCAATAGAGCAGATGTCCAGGCTGTTGCATATGAAGAGCCAAAACACTGGTGCTCCATTGTCTATTATGAGCTCAACAACCGTGTTGGAGAAGCTTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGCTTCACTGATCCTTCAAACAACAGGAACAGATTTTGCCTTGGGCTTCTGTCTAATGTGAACCGAAACTCGACCATTGAGAACACCAGGCGGCATATTGGAAAAGGTGTGCATTTATACTATGTTGGGGGTGAAGTCTATGCCGAATGCTTAAGTGACAGCAGCATTTTTGTTCAGAGCCGGAATTGTAACTTTCACCACGGTTTCCATCCTACAACTGTGTGTAAAATCCCCAGCGGATGCAGCCTAAAGATTTTTAACAACCAAGAATTTGCTCAGCTTTTGGCCCAGTCTGTAAACCATGGCTTTGAAACTGTCTATGAACTGACAAAGATGTGCACTATTCGGATGAGTTTTGTCAAGGGATGGGGTGCAGAATATCATCGCCAGGATGTCACAAGCACCCCCTGCTGGATTGAGATTCACCTGCACGGCCCCCTTCAATGGCTGGATAAAGTACTAACTCAGATGGGCTCACCCCATAATCCCATCTCCTCGGTCTCTTAATGGATTAGGATGTTCCTGCCTCTGGATTCATTGGAGCCATGCATGTACTTGAAGGAGTCAGACACTTACTGGCAAATGGGACATTGGTAGTTTTTTTTTTTTTAAAGTCTTGGGGGAGCGATAAGCCCCTCATCTACTTGATGTTTGTGACCAACTCTTACAAGAGGAGCTCTATAGAGCCAATGCCCTGCTCTTCTGCTGTTGCCTAATTTAATATGGCTCCCTAAGCAGCAGCCGATATTAATTTTCTAATCCAGTTTAGC
                                                      consensus depths                              5     5     6     6     6     6     6     6     6     6     6     6     6     8     7     8     8     8     9    10    10    11    11    12    11    14    12    14    13    14    13    14    13    14    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    15    15    15    15    13    15    15    15    15    15    15    15    13    14    14    14    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    13    14    12    14    12    14    12    14    12    14    12    14    12    14    10    11    10    11     8    10     8    10     9    11     7     9     7     9     7     9     7     9     3     6     2     6     2     5     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     1     1     1     3     1     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     4     3     5     3     5     3     6     3     6     4     6     5     7     6     7     6     7     5     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     7     8     8     9     6     9     7     9     6    10    10    11     6    11    10    10     8    10     8    10    11    11    11    11     9    11     9    11    11    11     9    11     8    11     6    11    10    11     8    11    10    11    11    11     8    11     7    11     7    10     7    10     7    10     7    10     7    10     5     6     5     6     5     6     5     6     3     4     3     4
  5   1   2      ests                            Xl3.1-IMAGE:6860267.5                         CTTTGCAGACGCTCCCTGCCTGGGTGTGTATGTTGTGTATTGGCAGCTGGGCGGCTTCGACTCCCTGACGCCAGAGAGTCCAGATCAATCCAGGCAGCCGGGGAGAGAGGAGGAGAAGGAGGGAGCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCGTATCATTACAAACGAGTGGAGAGTCCTGTCTTGCCACCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCACAGCACAGTCTCCTTGCGCAATTCCGAAACTTGGAGCCAAGCGAGCCACATATGCCTCACAACGCAACTTTTCCAGACTCTTTCCAGCAGCCAAACAGCCATCCGTTCCCTCACTCGCCGAACAGCAGCTACCCAAACTCTCCGGGAAGCGGCAGTACTTATCCTCACTCACCAGCGAGCTCTGATCCTGGGAGCCCTTTTCAAATACCAGCTGACACCCCTCCTCCAGCTTATAT
  5   1   2      ests                            Xl3.1-IMAGE:6322929.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAATCTGATGGTGCCTAACATCTCTCAAGATATCAATAGAGCAGATGTCCAGGCTGTTGCATATGAAGAGCCAAAACACTGGTGCTCCATTGTCTATTATGAGCTCAACAACCGTGTTGGAGAAGCTTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGCTTCACTGATCCTTCAAACAACAGGAACAGATTTTGCCTTGGGCTTCTGTCTAATGTGAACCGAAACTCGACCATTGAGAACACCAGGCGGCATATTGGAAAAGGTGTGCATTTATACTATGTTGGGGGTGAAGTCTATGCCGAATGCTTAAGTGACAGCAGCATTTTTGTTCAGAGCCGGAATTGTAACTTTCACCACGGTTTCCATCCTACAACTGTGTGTAAAATCCCCAGCGGATGCAGCCTAAAGATTTTTAACAACCAAGAATTTGCTCAGCTTTTGGCCCAGTCTGTAAACCATGGCTTTGAAACTGTCTATGAACTGACAAAGATGTGCACTATTCGGATGAGTTTTGTCAAGGGATGGGGTGCAGAATATCATCGCCAGGATGTCACAAGCACCCCCTGCTGGATTGAGATTCACCTGCACGGCCCCCTTCAATGGCTGGATAAAGTACTAACTCAGATGGGCTCACCCCATAATCCCATCTCCTCGGTCTCTTAATGGATTAGGATGTTCCTGCCTCTGGATTCATTGGAGCCATGCATGTACTTGAAGGAGTCAGACNCTTACTGGCAAATGGGACATTGGTAGTTTTTTTTTTTTTAAAGTCTTGGGGGAGCGATAAGCCCCTCATCTACTTGATGTTTGTGACCAACTCTTACAAGAGGAGCTCTATAGAGCCAATGCCCTGCTCTTCTGCTGTTGCCTAATTTAATATGGCTCCCTAAGCAGCAGCCGATATTAATTTTCTAATCCA
                                                                   SNP                                                                                                                                                                                                                                     --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                 -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                             ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------A-
                                               BLH ATG     352    2531                         
                                               BLH MIN     352     385                         
                                               BLH MPR     310     385                         
                                               BLH OVR     352    1048                         
                                               CDS MIN     352     385                         
                                               ORF LNG     352     114                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 3e-122     NP_498931.2 SMAll body size SMA-2, dwarfin; affects body size and the arrangement ofperipheral sense organs in the male tail; transforming growth factor betapathway component (47.9 kD) (sma-2) [Caenorhabditis elegans] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 0          NP_477017.1 Mothers against dpp CG12399-PA [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ag ---- 0          XP_314661.3 AGAP008551-PA [Anopheles gambiae str. PEST] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Ci ==== 0          NP_001071815.1 Smad1/5 protein [Ciona intestinalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Sp ==== 0          XP_001178940.1 PREDICTED: similar to SMAD5 isoform 5 [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Dr ==== 0          NP_571431.1 MAD homolog 1; SMA- and MAD-related protein 1; MAD (mothers againstdecapentaplegic, Drosophila) homolog 1 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 0          NP_032565.2 MAD homolog 1; Smad 1 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Bt ==== 0          NP_001069691.2 Sma- and Mad-related protein 1 [Bos taurus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Cf ==== 0          XP_867346.1 PREDICTED: similar to Mothers against decapentaplegic homolog 1 (SMAD 1) (Mothers against DPP homolog 1) (Mad-related protein 1) (Transforming growth factor-beta signaling protein-1) (BSP-1) (hSMAD1) (JV4-1) isoform 14 [Canis familiaris] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Hs ==== 0          NP_001003688.1 Sma- and Mad-related protein 1 [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Gg ==== 0          XP_420428.1 PREDICTED: similar to Smad1 [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 0          NP_001007481.1 MAD homolog 1 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 0          AAH89146.1 MADH1 protein [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                               Xl3.1-IMAGE:6860267.5.5                                                                                                                                                                                                                                                                                                                                   TAA---------------------------------------TGA---------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------TAA---------ATG------------------------------ATG------------------------------ATG---------TAG------------TAA---------------------------------TGA------TGA------------------------TAG------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2      ests                            Xl3.1-IMAGE:6860267.5                         CTTTGCAGACGCTCCCTGCCTGGGTGTGTATGTTGTGTATTGGCAGCTGGGCGGCTTCGACTCCCTGACGCCAGAGAGTCCAGATCAATCCAGGCAGCCGGGGAGAGAGGAGGAGAAGGAGGGAGCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCGTATCATTACAAACGAGTGGAGAGTCCTGTCTTGCCACCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCACAGCACAGTCTCCTTGCGCAATTCCGAAACTTGGAGCCAAGCGAGCCACATATGCCTCACAACGCAACTTTTCCAGACTCTTTCCAGCAGCCAAACAGCCATCCGTTCCCTCACTCGCCGAACAGCAGCTACCCAAACTCTCCGGGAAGCGGCAGTACTTATCCTCACTCACCAGCGAGCTCTGATCCTGGGAGCCCTTTTCAAATACCAGCTGACACCCCTCCTCCAGCTTATAT
                                                  Xl3.1-CHK-1012690650                               AGACGCTCCCTGCCTGGGTGTGTATGTTGTGTATTGGCAGCTGGGCGGCTTCGACTCCCTGACGCCAGAGAGTCCAGATCAATCCAGGCAGCCGGGGAGAGAGGAGGAGAAGGAGGGAGCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCGTATCATTACAAACGAGTGGAGAGTCCTGTCTTGCCACCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCACAGCACAGTCTCCTTGCGCAATTCCGAAACTTGGAGCCAAGCGAGCCACATATGCCTCACAACGCAACTTTTCCAGACTCTTTCCAGCAGCCAAACAGCCATCCGTTCCCTCACTCGCCGAACAGCAGCTACCCAAACTCTCCGGGAAGCGGCAGTACTTATCCTCACTCACCAGCGAGCTCTGATCCTGGGAGCCCTTTTCAAATACCAGCTGACACCCCTCCTCCAGC
  5   1   2       bld Oo1  5g                IMAGE:6642557-IMAGp.IMAGp AGGGAATCCTTAGGGGGTTTGTGGCTTTGCAGACGCTCCCTGCCTGGGTGTGTATGTTGTGTATTGGCAGCTGGGCGGCTTCGACTCCCTGACGCCAGAGAGTCCAGATCAATCCAGGCAGCCggggagagaggaggagaaggagggagCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACgaagaagagaaatgggcagagaaagcagtagatgccttggtgaaaaagctgaagaagaaaaaagGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCGTA
  5   1   2       bld Oo1  5g                         IMAGE:6860267.5p             CTTGGGGTTGTGCTTTGCAGACGCTCCCTGCCTGGGTGTGTATGTTGTGTATTGGCAGCTGGGCGGCTTCGACTCCCTGACGCCAGAGAGTCCAGATCAATCCAGGCAGCCggggagagaggaggagaaggagggagCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCGTATCATTACAAACGAGTGGAGAGTCCTGTCTTGGCACCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCACAGCACAGTCTCCCTTGCGCAATTCCCGAAACTTGGGAGCCAAGCCAAGCCCA
  5   1   2       bld Oo1  5g                         IMAGE:6642557.5p              TTGGGGTTGTGCTTTGCAGACGCTCCCTGCCTGGGTGTGTATGTTGTGTATTGGCAGCTGGGCGGCTTCGACTCCCTGACGCCAGAGAGTCCAGATCAATCCAGGCAGCCggggagagaggaggagaaggagggagCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCNGTATCATTACAAACGAGTGGGGAGAGTCCTGGTCTTGCCACCCTGTCCTTGTTCCCACGGCACAGTGGAGTACANNACCCACAGCACANGTCTCCCTTGGGCGCAAATTCCGAANACTTTGGNAGGCCCCAAGCGAGGCCCACATATGGCCCTCACAAACGGCAACTTTTTTC
  5   1   2       add Egg3 5g3  in                    IMAGE:3379416.5p                 CCGGGGTGCTTTGCAGACGCTCCCTGCCTGGGTGTGTATGTTGTGTATTGGCAGCTGGGCGGCTTCGACTCCCTGACGCCAGAGAGTCCAGATCAATCCAGGCAGCCggggagagaggaggagaaggagggagCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGTTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTGACAGCAGTCCTATATAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGATGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGATAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGTACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAAGCTGCGAGTGTCACACCGCAGAGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGGCGGATCTACATAATCACCATGGACTGAAACCCTTGTAGTGCTGCTATGATCCCTTTGGTGCTAAACAGAAG
  5   1   2       bld Ga15 5g3  in                       XL433p01ex.5p                    TTGTGCTTTGCAGACGCTCCCTGCCTGGGTGTGTATGTTGTGTATTGGCAGCTGGGCGGCTTCGACTCCCTGACGCCAGAGAGTCCAGATCAATCCAGGCAGCCggggagagaggaggagaaggagggagCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACA
  5   1   2       bld Ga12 5g3  in                         XL190j13.5p                              CAGACGCTCCCTGCCTGGGTGTGTATGTTGTGTATTGGCAGCTGGGCGGCTTCGACTCCCTGACGCCAGAGAGTCCAGATCAATCCAGGCAGCCggggagagaggaggagaaggagggagCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGTTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTGACAGCAGTCCTATATAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGATGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCT
  5   1   2       bld Egg3 5g                         IMAGE:6327124.5p                                                                                      CGATTCCCCGGGCAGAGAGCCAGATCTCTCAGGCAGCCggggagagaggaggagaaggagggagCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCGTATCATTACAAACGAGTGGAGAGTCCTGTCTTGCCACCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCACAGCACAGTCTCCTTGCGCAATTCCCGAAACTTGGAGCCCAGCGAGCCACATATGCCTCACAACGCAACTTTTTCAGACTCTTTTCAGCAGCCAAACAGCCATCCGTTTCCCTCACTCGCCCAACAGCAGCTACCCAAAACTCTCCGGGAAAGCGGCCAGTACTTATCCCTCACTCACCCAGCGGAGCTTCTGGATCCGTGGA
  5   1   2      seed DMZ  5g                              xl251p21.5p                                                                                         TCGNTTCNNNTTCNGNCGAGGCAATCCAGGCAGCCggggagagaggaggagaaggagggagCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCGTATCATTACAAACGAGTGGAGAGTCCTGTCTTGCCACCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCACAGCACAGTCTCCT
  5   1   2       bld Ga18 5g                           xlk103e04ex.5p                                                                                                                           CCggggagagaggaggagaaggagggagCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGNAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGCCTACCACATGTGATTTATTGCCGTGTGTGGNGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGNCTGCATCAACCCGTATCANTACAAACGAGTGGAGAGTCCTGTCTNGCCACCTGTCCTTGTTCCACGGCACAGTGAGTNCAACCCACAGCACAGTCTCCTTGCGCAANTCCGAAACTTGG
  5   1   2       bld DMZ  5g                              xl233o14.5p                                                                                                                                   GAGGAGGAGAAGGAGGGAGCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAagaagagaaatgggcagagaaagcagtagatgccttggtgaaaaagctgaagaagaaaaaaGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCGTATCATTACAAACGAGTGGAGAGTCCTGTCTTGCCACCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCACAGCACAGTCTCCTTGCG
  5   1   2       bld Em10 5g                         IMAGE:8318909.5p                                                                                                                                        GGAGAAGGAGGGAGCCTCACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCGTATCATTACAAACGAGTGGAGAGTCCTGTCTTGCCACCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCACAGCACAG
  5   1   2       bld Tbd7 5g3  in                         XL101i05.5p                                                                                                                                                         CACATCCCGGGCTGCTGCTGGAGACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCGTATCATTACAAACGAGTGGAGAGTCCTGTCTTGCCA
  5   1   2       bld Neu7 5g3  in                         XL033j12.5p                                                                                                                                                                  GCTGCTGCTGGANACACCGACAAGNCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGTTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTGACAGCAGTCCTATATAAAGTTGACTAGTCACAATGAATGTGACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGATGAAGAAGAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAGGAACTGGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCAGGCTGCAAGTGTCACACCGCAAGGGCCTACCACATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCGTATCATTACAAACGAGTGGAGAGTCCTGTCTTGC
  5   1   2       bld Tbd7 5g                              XL079f09.5p                                                                                                                                                                   CTGCTGCTGGNANACACCGACAAGCTGCGGCAGTGTAACCGACCACCGGGAAAGGGCGATTTGTCCAGCAGATGCTGCTGGCCTTCTGGGAATCCTGGACTGTGATTACTGCGCTGGAGAGCTGTTATCTGTAACTGGAAGACTCTCCATTAACCTGCATTAACAATATTGGCCTGGATTTCACAGCAGTCCTATAAAAAGTTGACTAGTCACAATGAATGTNACGAGCTTGTTCTCCTTCACCAGCCCAGCAGTGAAGAGACTGCTTGGTTGGAAACAGGGAGACGAAGAANAGAAATGGGCAGAGAAAGCAGTAGATGCCTTGGTGAAAAAGCTGAAG
  5   1   2       bld Egg6      out                   IMAGE:4436062.5p                                                                                                                                                                                                                                                                                                                                                                                           GAATGCGACGAGCTTGTTCTCCTTCACCAGCCCAACAGTGAAGAGACTGCTTGGTTGGACACAGGGAGACTAAGAAGATAACTGGGCACAGAGAGCGGTACATGCCTTGGCGACTTAGCTGACCAAGAAAAAAGGAGCCATG
  5   1   2       bld Ga12      in                         XL175i03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATGTGATTTATTGCCGTGTGTGGCGTTGGCCGGATCTACAAAGTCACCATGAACTGAAACCCTTGGAGTGCTGCGAGTATCCCTTTGGTTCTAAACAGAAGGAGGTCTGCATCAACCCGTATCATTACAAACGAGTGGAGAGTCCTGTCTTGCCACCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCACAGCACAGTCTCCTTGCGCAATTCCGAAACTTGGAGCCAAGCGAGCCACATATGCCTCACAACGCAACTTTTCCAGACTCTTTCCAGCAGCCAAACAGCCATCCGTTCCCTCACTCGCCGAACAGCAGCTACCCAAACTCTCCGGGAAGCGGCAGTACTTATCCTCACTCACCAGCGAGCTCTGATCCTGGGAGCCCTTTTCAAATACCAGCTGACACCCCTCCTCCAGCTTATATGCCT
  5   1   2       bld Egg4      in                    IMAGE:3744591.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTGGAGAGTCCTGTCTTGCCACCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCACAGCACAGTCTCCTTGCGCAATTCCGAAACTTGGAGCCAAGCGAGCCACATATGCCTCACAACGCAACTTTTCCAGACTCTTTCCAGCAGCCAAACAGCCATCCGTTCCCTCACTCGCCGAACAGCAGCTACCCAAACTCTCCGGGAAGCGGCAGTACTTATCCTCACTCACCAGCGAGCTCTGATCCTGGGAGCCCTTTTCAAATACCAGCTGACACCCCTCCTCCAGCTTATATGCCTCCCGAGGATCAGATGACGCAAGACAACTCTCAGCCAATGGACACAAATCTGATGGTGCCTAACATCTCTCAAGATATCAATAGAGCAGATGTCCAGGCTGTTGCATATGAAGAGCCAAAACACTGGTGCTCCATTGTCTATTATGAGCTCAACAACCGTGTTGGAGAAGCTNTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGCTTCACTGATCCTTCAAACAACAGGAACAGANTTTGCCTTGGGCTTCTGTCTAATGTGAAACCGAACTCGACCATTGAGAACACCAGGCGGCATATTGGAAAAGGTGTGCATTTATAC
  5   1   2      ests                            Xl3.1-IMAGE:6322929.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAATCTGATGGTGCCTAACATCTCTCAAGATATCAATAGAGCAGATGTCCAGGCTGTTGCATATGAAGAGCCAAAACACTGGTGCTCCATTGTCTATTATGAGCTCAACAACCGTGTTGGAGAAGCTTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGCTTCACTGATCCTTCAAACAACAGGAACAGATTTTGCCTTGGGCTTCTGTCTAATGTGAACCGAAACTCGACCATTGAGAACACCAGGCGGCATATTGGAAAAGGTGTGCATTTATACTATGTTGGGGGTGAAGTCTATGCCGAATGCTTAAGTGACAGCAGCATTTTTGTTCAGAGCCGGAATTGTAACTTTCACCACGGTTTCCATCCTACAACTGTGTGTAAAATCCCCAGCGGATGCAGCCTAAAGATTTTTAACAACCAAGAATTTGCTCAGCTTTTGGCCCAGTCTGTAAACCATGGCTTTGAAACTGTCTATGAACTGACAAAGATGTGCACTATTCGGATGAGTTTTGTCAAGGGATGGGGTGCAGAATATCATCGCCAGGATGTCACAAGCACCCCCTGCTGGATTGAGATTCACCTGCACGGCCCCCTTCAATGGCTGGATAAAGTACTAACTCAGATGGGCTCACCCCATAATCCCATCTCCTCGGTCTCTTAATGGATTAGGATGTTCCTGCCTCTGGATTCATTGGAGCCATGCATGTACTTGAAGGAGTCAGACNCTTACTGGCAAATGGGACATTGGTAGTTTTTTTTTTTTTAAAGTCTTGGGGGAGCGATAAGCCCCTCATCTACTTGATGTTTGTGACCAACTCTTACAAGAGGAGCTCTATAGAGCCAATGCCCTGCTCTTCTGCTGTTGCCTAATTTAATATGGCTCCCTAAGCAGCAGCCGATATTAATTTTCTAATCCA
                                                  Xl3.1-CHK-1012693995                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGATGGTGCCTAACATCTCTCAAGATATCAATAGAGCAGATGTCCAGGCTGTTGCATATGAAGAGCCAAAACACTGGTGCTCCATTGTCTATTATGAGCTCAACAACCGTGTTGGAGAAGCTTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGCTTCACTGATCCTTCAAACAACAGGAACAGATTTTGCCTTGGGCTTCTGTCTAATGTGAACCGAAACTCGACCATTGAGAACACCAGGCGGCATATTGGAAAAGGTGTGCATTTATACTATGTTGGGGGTGAAGTCTATGCCGAATGCTTAAGTGACAGCAGCATTTTTGTTCAGAGCCGGAATTGTAACTTTCACCACGGTTTCCATCCTACAACTGTGTGTAAAATCCCCAGCGGATGCAGCCTAAAGATTTTTAACAACCAAGAATTTGCTCAGCTTTTGGCCCAGTCTGTAAACCATGGCTTTGAAACTGTCTATGAACTGACAAAGATGTGCACTATTCGGATGAGTTTTGTCAAGGGATGGGGTGCAGAATATCATCGCCAGGATGTCACAAGCACCCCCTGCTGGATTGAGATTCACCTGCACGGCCCCCTTCAATGGCTGGATAAAGTACTAACTCAGATGGGCTCACCCCATAATCCCATCTCCTCGGTCTCTTAATGGATTAGGATGTTCCTGCCTCTGGATTCATTGGAGCCATGCATGTACTTGAAGGAGTCAGACACTTACTGGCAAATGGGACATTGGTAGTTTTTTTTTTTTTAAAGTCTTGGGGGAGCGATAAGCCCCTCATCTACTTGATGTTTGTGACCAACTCTTACAAGAGGAGCTCTATAGAGCCAATGCCCTGCTCTTCTGCTGTTGCCTAATTTAATATGGCTCCCTAAGCAGCAGCCGATATTAATTTTCTAATCCAGTTTAG
  5   1   2      seed Egg3                            IMAGE:6322929.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTCCCGGGCGATGACGAAGACACTCTCGCCATGGACACAAATCTGATGGTGCCTAACATCTCTCAAGATATCAATAGAGCAGATGTCCAGGCTGTTGCATATGAAGAGCCAAAACACTGGTGCTCCATTGTCTATTATGAGCTCAACAACCGTGTTGGAGAAGCTTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGCTTCACTGATCCTTCAAACAACAGGAACAGATTTTGCCTTGGGCTTCTGTCTAATGTGAACCGAAACTCGACCATTGAGAACACCAGGCGGCATATTGGAAAAGGTGTGCATTTATACTATGTTGGGGGTGAAGTCTATGCCGAATGCTTAAGTGACAGCAGCATTTTTGTTCAGAGCCGGAATTGTAACTTTCACCACGGTTTCCATCCTACAACTGTGTGTAAAATCCCCAGCGGATGCAGCCTAAAGATTTTTAACAACCAAGAATTTGCTCAGCTTTTGGCCCAGTCTGTAAACCATGGCTTTGAAACTGTCTATGAACTGACAAAGATGTGCACTATTCGGATGAGTTTTGTCAAGGGATGGGGTGCAGAATATCATCGCCAGGATGTCACAAGCACCCCCTGCTGGATTGAGATTCACCTGCACGGCCCCCTTCAATGGCTGGATAAAGTACTAACTCAGATGGGCTCACCCCATAATCCCATCTCCTCGGTCTCTTAATGGATTAGGATGTTCCTGCCTCTGGATTCATTGGAGCCATGCATGTACTTGAAGGAGTCAGACACTTACTGGCAAATGGGACATTGGTAGtttttttttttttttttAAGTCTTGGGGAACGTAGCCCTCACTACTGAGTTGTGCCACTCTACAGAGAATTTAAGCAACCGCCCTCGTGGCATAATGCCAA
  5   1   2       add Ooc1                             Ooc1-db28h09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGTCGACCCACGCGTCCGCTCTCAGCCAATGGACACAAATCTGATGGTGCCTAACATCTCTCAAGATATCAATAGAGCAGATGTCCAGGCTGTTGCATATGAAGAGCCAAAACACTGGTGCTCCATTGTCTATTATGAGCTCAACAACCGTGTTGGAGAAGCTTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGCTTCACTGATCCTTCAAACAACAGGAACAGATTTTGCCTTGGGCTTCTGTCTAATGTGAACCGAAACTCGACCATTGAGAACACCAGGCGGCATATTGGAAAAGGTGTGCATTTATACTATGTTGGGGGTGAAGTCTATGCCGAATGCTTAAGTGACAGCAGCATTTTTGTTCAGAGCCGGAATTGTAACTTTCACCACGGTTTCCATCCTACAACTGTGTGTAAAATCCCCAGCGGATGCAGCCTAAAGATTTTTAACAACCAAGAATTTGCTCAGCTTTTGGCCCAGTCTGTAAACCATGGCTGTGAAACTGTCTATGAACTGACAAAGATGTGCACTATTCGGATGAGTGAGGCAAGGGATGGGGTGCAGAATATAATCGTCAGTATGTCACAAGCACCCACTGATGGATTGAGATGCACCTGCACGGCCC
  5   1   2       add Ga18      ?                       xlk144l06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAACACTGGTGCTCCATTGTCTATTATGAGCTCAACAACCGTGTTGGAGAAGCTTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGCTTCACTGATCCTTCAAACAACAGGAACAGATTTTGCCTTGGNNNCTGTCTAATGTGAACCGAAACTCGACCATTGAGAACACCAGGCGGCATATTGGAAAAGGTGTGCATTTATACTATGTTGGGGGTGAAGTCTATGCCGAATGCTTAAGCGANNNNNCATTTTTGTTCAGAGCCGGAATTGTAACTTTCACCACGGTTTCCATCCTACAACTGTGTGTAAAATCCCCAGCGGNNNNNCCTAAAGATTTTTAACAACCAAGAATTTGCTCAGCTTTTGGCCCAGTCTGTAAACCATGGCTTTGAAACTGTCTATGAACTGACAAAGATGTGCACTATTCGGATGAGTTTTGTCAAGGGATGGGGTGCAGAATATCATCGCCAGGATGTCACAAGCACCCCCTGCTGGATTGAGATTCACCTGCACGGCCCCCTTCAATGGCTGGATAAAGTACTAACTCAGATGGGCTCACCCCATAATCCCATCTCCTCGGTCTCTTAATGGATTAGGATGTTCCTGCCTCTGGATTCATTGGAGCCATNNATGTACTTGAAGGAGNCAGACACTTACTGGCAAATGGGNNNNTGGTAGtttttttttttttttttAAAGTCTNGGGGGAGNGA
  5  -1   2       bld Bla2                            IMAGE:7298571.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTAAGTCACACGGTGAGAGTTCAGCTCTCACAGGGTGTGATGCTCATGTCTCAAACACAGACAGATTGCNTGGCTCTGTTATGTGACCGAACTCGCCATGAGACACCAGCGGCAATGGAAAAGGGTGCATTTTACTATGTGGGGGTGAAGTTATGCCGAATGCTAAGCGACAGCAGCATTTTTTTCAGAGCCGGAATTGTAACTTTCACCACGGTTTCCATCCTACAACTGTGTGTAAAATCCCCAGCGGATGCAGCCTAAAGATTTTTAACAACCAAGAATTTGCTCAGCTTTTGGCCCAGTCTGTAAACCATGGCTTTGAAACTGTCTATGAACTGACAAAGATGTGCACTATTCGGATGAGTTTTGTCAAGGGATGGGGTGCAGAATATCATCGCCAGGATGTCACAAGCACCCCCTGCTGGATTGAGATTCACCTGCACGGCCCCCTTCAATGGCTGGATAAAGTACTAACTCAGATGGGCTCACCCCATAATCCCATCTCCTCGGTCTCTTAATAGATTAGGATGTTCCTGCCTCTGGATTCATTGGAGCCATGCATGTACTTGAAGGAGTCAGACACTTACTGGCAAATGGGACATTGGTAGtttttttttttttAAAGTCTTGGGGGAGCGATAAGCCCCTCATCTACTTGATGTTTGTGACCAACTCTTACAAGAGGAGCTCTATAGAGCCAATGCCCTGCTCTTCTGCTGTTGCCTAATTTAATATGGCTCCCTAAGCAGCAGCCGATATTAATTTTCTAATCCAGTTTAGCATTGTGATATAATCAATGCTGTGTaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCGCCTAAGATGGGT
  3   1   2       bld Egg4      in                    IMAGE:3744591.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TACTATGTTGGGGGTGAAGTCTATGCGAAATGCTTAAGCGACAGCAGCATTTTTGTTCAGAGCCGAAATTGTAACTTTCACCACGGTTTCCATCCTACAACTGTGTGTAAAATCCCNAGCGGATGCAGCCTAAAGATTTTTAACAACCAAGAATTTGCTCAGCTTTTGGCCCAGTCTGTAAACCATGGCTTTGAAACTGTCTATGAACTGACAAAGATGTGCACTATTCGGATGAGTTTTGTCAAGGGATGGGGTGCAGAATATCATCGCCAGGATGTCACAAGCACCCCCTGCTGGATTGAGATTCACCTGCACGGCCCCCTTCAATGGCTGGATAAAGTACTAACTCAGATGGGCTCACCCCATAATCCCATCTCCTCGGTCTCTTAATGGATTAGGATGTTCCTGCCTCTGGATTCATTGGAGCCATGCATGTACTTGAAGGAGTCAGACACTTACTGGCAAATGGGACATTGGTAGTTTTTTTTTTTTTTTAAAGTCTTGGGGGAGCGATAAGCCCCTCATCTACTTGATGTTTGTGACCAACTCTTACAAGAGGAGCTCTATAGAGCCAATGCCCTGCTCTTCTGCTGTTGCCTAATTTAATATGGCTCCCTAAGCAGCAGCCGATATTAATTTTCTAATCCAGTTTAGCATTGTGATATACCGTAATCAATGCTGTGTAA
  3   1   2       add Egg3 5g3  in                    IMAGE:3379416.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGCAATGCTTAAGCGCAGCAAGATTTTTGTTCAAAGCCGGAATTGGAACTCTCCACCACGGTTTCATTCCTACAACTGTATGTAAAATCACCAACGGATCCAGCCTAAAGATTTTTAACAACCAAGAATTTGCTCAGCTTTTGGCCCAGTCTGTAAACCATGGCTTTGAAACTGTCTATGAACTGACAAAGATGTGCACTATTCGGATGAGTTTTGTCAAGGGATGGGGTGCAGAATATCATCGCCAGGATGTCACAAGCACCCCCTGCTGGATTGAGATTCACCTGCACGGCCCCCTTCAATGGCTGGATAAAGTACTAACTCAGATGGGCTCACCCCATAATCCCATCTCCTCGGTCTCTTAATGGATTAGGATGTTCCTGCCTCTGGATTCATTGGAGCCATGCATGTACTTGAAGGAGTCAGACACTTACTGGCAAATGGGACATTGGTAGTTTTTTTTTTTTTAAAGTCTTGGGGGAGCGATAAGCCCCTCATCTACTTGATGTTTGTGACCAACTCTTACAAGAGGAGCTCTATAGAGCCAATGCCCTGCTCTTCTGCTGTTGCCTAATTTAATATGGCTCCCTAAGCAGCAGCCGATATTAATTTTCTAATCCAGTTTAGCATT
  3   1   2       add Neu7 5g3  in                         XL033j12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTAACTTTCACCACGGTTTCCATCCTACAACTGTGTGTAAAATCCCCAGCGGATGCAGCCTAAAGATTTTTAACAACCAAGAATTTGCTCAGCTTTTGGCCCAGTNTGTAAACCATGGCTTTGAAACTGTNTATGAACTGACAAANATGTGCNCTATTCGGATGAGTTTTGTCAAGGGATGGGGTGCANAANATCATCGCCAGGATGTCNCAAGCACCCCCTGCTGGATTGANATTCACCTGCACGGCCCCCTTCAATGGCTGGATAAAGTACTAACTCAGATGGGCTCACCCCATAATCCCATCTCCTCGGTCTCTTAATGGATTAGGATGTTCCTGCCTCTGGATTCATTGGAGCCATGCATGTACTTNAAGGAGTCAGACNCTTACTGGCAAATGGGACATTGGTAGTTTTTTTTTTTTTAAAGTCTTGGGGGAGCGATAAGCCCCTCATCTACTTGATGTTTGTGACCAACTCTTACAAGAGGAGCTCTATAGAGCCNATGCCCTGCTCTT
  3   1   2       add Ga12 5g3  in                         XL190j13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TNGGATGAGTTTTGTCAAGGGATGGGGNGCAGAATATNATNGCCAGGATGTCNCAAGCNCCCCCTGGTGGATTGAGATTNACCTGCNCGGCCCCCTTCAATGGGTGGATAAAGTNNTAACTCAGATGGGNTCNCCCCATAATCCCATTTCCTCGGTTTTTTAANGGATTAGGANGTTCCTGCCTTTGGATTCATTGGAGCCATGCATGTNCTTGAAGGAGTCAGACNCTTNCTGGCAAATGGGACATTGGTAGTTTTTTTTTTTTTAAAGTCTTGGGGGAGCGATAAGCCCCTCATCTACTTGATGTTTGTGACCAACTCTTACAAGAGGAGCTCTATAGAGCCAATGCCCTGCTCTTCTGCTGTTGCCTAATTTAATATGGCTCCCTAAGCAGCAGCCGATATTAATTTTCTAATCCAGTTTAGCAT
  3   1   2       add Ga15 5g3  in                       XL433p01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ANGAATTTTNTCAAGGGATGGGGNGCANAATATCATCGCCAGGANGTCNCAAGCNCCCCCTGCTGGATTGANATTCNCCTGCNCGGCCCCCTTCAANGGNNGGATAAAGTNCTAACTCAGATGGGCTCNCCCCATAATCCCATNTCCTCGGTTTTTTAANGGATTAGGANGTTCCTNCCTNTGGATTCATTGGAGCCANGCATGTNCTTGAAGGAGTCAGACNCTTNCTGGCAAANGGGACNTTGGTAGTTTTTTTTTTTTTAAAGTCTTGGGGGAGCGATAAGCCCCTCATCTACTTGATGTTTGTGACCAACTCTTACAAGAGGAGCTCTATAGAGCCAATGCCCTGCTCTTCTGCTGTTGCCTAATTTAATATGGCTCCCTAAGCAGCAGCCGATA
  3   1   2       add Tbd7 5g3  in                         XL101i05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCAGGATGTCNCAAGCNCCCCCTGCTGGATTNANATTCACCTGCACGGCCCCCTTCAATGGCTGGATAAAGTACTAACTCAGATGGGCTCNCCCCATAATCCCATCTCCTCGGTCTCTTAATGGATTAGGATGTTCCTGCCTCTGGATTCATTGGANCCATGCATGNACTTGAAGGAGTCAGACNCNTACTGGCAAATGGGACATTGGTAGTTTTTTTTTTTTTAAAGTGCTTGGGGGAGCGATAAGCCCCTCATCTNACTTGATGTTTGTGACCACACTCTNCCAAGAGGAGCTCTATAGAGCCAANGCCCNG
  3   1   2       add Ga12                                 XL165i09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGCNCCCCCTGGTGGATTGAGATTCNCCTGCNCGGCCCCCTTCAATGGNTGGATAAAGTTNTAANTCAGATGGGNTCNCCCCATAATCCCATTTCCTCGGTTTTTTAANGGATTAGGANGTTCCTGCCTNTGGATTCATTGGAGCCANGCANGTNCTTGAAGGAGTCAGACNCTTACTGGCAAANGGGACATTGGTANTTTTTTTTTTTTTAAAGTCTTGGGGGAGCGATAAGCCCCTCATCTACTTGATGTTTGTGACCAACTCTTACAAGAGGAGCTNTATAGAGCCAATGCCCTGCTCTTCTGCTGTTGCNTAATTTAATATGGCTCCCTAAGCAGCAGCCGATAT
  3   1   2       add Ga12      in                         XL175i03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCAGATGGGCTCACCCCATAATCCCATNTCCTCGGTNTTTTAATGGATTAGGATGTTCCTGCCTNTGGATTCATTGGANCCATGCATGNACTTGAAGGAGTCAGACNCTTACTGGCAAATGGGACATTGGTAGTTTTTTTTTTTTTAAAGTCTTGGGGGAGCGATAAGCCCCTCATCTACTTGATGTTTGTGACCAACTCTTACAAGAGGAGCTCTATAGAGCCAATGCCCTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)