Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:5536730.3                       7 END     1           2       14                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012837911 Xl3.1-IMAGE:7202032.5.5 - 36 ESTs
                                                                       ......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:7202032.5.5                                     CAGAGAGGGTATAGGAAAGAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGTCTCTTACAGTTGGTGCGCTCTCTACTTTGGAACCCCTTTCTGTACCTGGGTCATTATGGCTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCCCTTGCTGCCTCCATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACCCATCAGGATTTAGCTGGTTCAATGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCCAGTTCGCCCTCTTTGTTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGTCAGTGGAGCAAATCTTGTATCCTCTCCTTCCTACCTATTGGGCAGGGTTGCAGACTGTGTTGGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACATAAGGTGTATGGAGCTATTCTAGTTGCAGTGGAACGTCTCCTCAAGATGAAAGCTCGCTCCTCTGATTTAACCTCATCTGCCATGCCTTCTTTACCCCACGCTTCAATCTGCTCACCCCCCTCGGTATCCTTACTAGAGATGTACAGTGAACTTGTACTGCTTCTTGGAGACAGTCTAGCTGTGCGTTTTGGAACTGGTGGAAACCAATCACATCATGGTGGGGCACCACAGAACATACAGGAATCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCAGCGCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGCTTGGATCGCTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGTTTTAAACCTACTGCACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCGCATAGCTATTTATCACTGTATACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTTGATTGTCGAAAAATATAAAGGACAAATGTTTTTGTAAAGACTG
                                                  Xl3.1-CHK-1012721868                                           GGGTATAGGAAAGAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGTCTCTTACAGTTGGTGCGCTCTCTACTTTGGAACCCCTTTCTGTACCTGGGTCATTATGGCTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCCCTTGCTGCCTCCATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACCCATCAGGATTTAGCTGGTTCAATGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCCAGTTCGCCCTCTTTGTTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGTCAGTGGAGCAAATCTTGTATCCTCTCCTTCCTACCTATTGGGCAGGGTTGCAGACTGTGTTGGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACATAAGGTGTATGGAGCTATTCTAGTTGCAGTGGAACGTCTCCTCAAGATGAAAGCTCGCTCCTCTGATTTAACCTCATCTGCCATGCCTTCTTTACCCCACGCTTCAATCTGCTCACCCCCCTCGGTATCCTTACTAGAGATGTACAGxxxAxxTGTACTxxTxxTTGGAGACAGTCTAGCTGTGCGTTTTGGAACTGGTGGAAACCAATCACATCATGGTGGGGCACCACAGAACATACAGGAATCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCAGCGCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGTTTGGATCGCTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGTTTTAAACCTACTGCACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCGCATAGCTATATATCACTGTATACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTTGATTGTCGAAAAATATAAAGGACAAATGTTTTTGTAAAGACTGGAGAAC
                                                      consensus depths                                          3     5     5     6    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    15    14    15    15    15    15    15    15    15    15    15    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    16    17    16    17    16    18    16    18    16    18    16    18    16    18    16    18    15    19    15    19    15    19    15    18    14    18    14    18    14    18    14    17    14    17    14    17    11    17    13    17    12    17    11    17    12    19    10    19    10    18    10    18    10    18     8    15     6    12     6    12     5    11     5    11     5    10     5    10     5     9     5     9     5     8     5     8     5     8     5     8     4     7     4     6     5     7     6     7     6     6     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     6     5     6     5     6     5     6     5     6     5     6     4     5     4     5     4     6     4     6     4     6     4     8     5     7     3     7     3     7     4     9     4     9     5     9     5    10     5     9     6    10     6    10     6    11     7    12     7    13     8    12     9    12     9    12    11    12     9    12    10    12    10    11    10    11    10    11    10    11    11    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    11    13    12    13    12    13    11    13    10    13    11    13    11    13    11    13     8    13    10    13    10    13    10    13    10    12    10    12     9    12     8    12     9    12     9    12     9    12     9    12     9    12     9    12     8    12     7    12     8    13     9    13     9    13     9    13     9    13     7    13     6    10     6     8     5     6
  5   1   2       e>1                            Xl3.1-IMAGE:7202032.5                                GGCAGCAGAGAGGGTATAGGAAAGAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGTCTCTTACAGTTGGTGCGCTCTCTACTTTGGAACCCCTTTCTGTACCTGGGTCATTATGGCTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCCCTTGCTGCCTCCATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACCCATCAGGATTTAGCTGGTTCAATGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCCAGTTCGCCCTCTTTGTTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGTCAGTGGAGCAAATCTTGTATCCTCTCCTTCCTACCTATTGGGCAGGGTTGCAGACTGTGTTGGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACATAAGGTGTATGGAGCTATTCTAGTTGCAGTGGAACGTCTC
  5   1   2       e>1                            Xl3.1-IMAGE:7981772.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTGGTTCAATGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCCAGTTCGCCCTCTTTGTTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGTCAGTGGAGCAAATCTTGTATCCTCTCCTTCCTACCTATTGGGCAGGGTTGCAGACTGTGTTGGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACATAAGGTGTATGGAGCTATTCTAGTTGCAGTGGAACGTCTCCTCAAGATGAAAGCTCGCTCCTCTGATTTAACCTCATCTGCCATGCCTTCTTTACCCCACGCTTCAATCTGCTCACCCCCCTCGGTATCCTTACTAGAGATGTACAGTGAACTGTACTGCTTCTTTGGAGACAGTCTAGCTGTGCGTTTTGGAACTGGTGGAAACCAATCACATCATGGTGGGGCACCACAGAACATACAGGAATCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCAGCGCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGTTTGGATCGCTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGTTTTAAACCTACTGCACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCGCATAGCTATATATCACTGTATACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTTGATTGTCGAAAAATATAAAGGACAAATGTTTTTGTAAAGACTGGAGAAC
                                                                   SNP                                                                                                                                                             ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-----C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         G-----------
                                               BLH ATG      96    1320                                     
                                               BLH MIN      90     214                                     
                                               BLH OVR      96      22                                     
                                               EST CLI       5      11                                     
                                               ORF LNG      96       2                                     
  5   1   2       e>1                            Xl3.1-IMAGE:7202032.5                                GGCAGCAGAGAGGGTATAGGAAAGAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGTCTCTTACAGTTGGTGCGCTCTCTACTTTGGAACCCCTTTCTGTACCTGGGTCATTATGGCTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCCCTTGCTGCCTCCATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACCCATCAGGATTTAGCTGGTTCAATGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCCAGTTCGCCCTCTTTGTTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGTCAGTGGAGCAAATCTTGTATCCTCTCCTTCCTACCTATTGGGCAGGGTTGCAGACTGTGTTGGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACATAAGGTGTATGGAGCTATTCTAGTTGCAGTGGAACGTCTC
                                                  Xl3.1-CHK-1012689934                                      AGAGAGGGTATAGGAAAGAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGTCTCTTACAGTTGGTGCGCTCTCTACTTTGGAACCCCTTTCTGTACCTGGGTCATTATGGCTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCCCTTGCTGCCTCCATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACCCATCAGGATTTAGCTGGTTCAATGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCCAGTTCGCCCTCTTTGTTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGTCAGTGGAGCAAATCTTGTATCCTCTCCTTCCTACCTATTGGGCAGGGTTGCAGACTGTGTTGGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACATAAGGTGTATGGAGCTATTCTAGTTGCAGTGGAACGTCTCCTCAAG
  5   1   2       bld Emb1 5g                         IMAGE:5155223.5p CCACGCGTCCGGGCGGGGCAAAACAGGAAGCGGCAGCAGAGAGGGTATAGGAAAGAAGGGATGATGGACTGTATATTGGTTTCCGCGTAGGCTGTCATGAGAGAATCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTTACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTTNGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGTCTCTTTACAGTTGGNTGCGCTTCTCTACTTTGGAACCCCTTTTCTTGTACCTGGGNTCATTTATG
  5   1   2       bld Emb4 5g                         IMAGE:5515790.5p             CCCACGCGTCCGCCCACGCTTTCCGCCCACGCGTCCGGGAAAGAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCCTTCAGATTTACAGANCAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTGTAAGTGGGTGAAANTCTGTAGTCTGATCTGGACAGCTAGTCGTCTCTACAGTGGTGCGCTTCTACTTTGAACCCTTNCGTAC
  5   1   2       bld Lmb1 5g                         IMAGE:8534950.5p                GGGGGCAACGCGTCNGNGNGAGACCTAAATANTAATCGNCCAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGAATCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAGCTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGACATCCGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATACCAGCGTGTTACACGAGCTGTGCTAGGGGAGACCCAACCTCTTGAAGGTGCCCTTCAGAATTACAGACAATTCAAGAATCCCGCCCTTTAACGTAATTTTTTATTTTGAAGTGGGTGAATCGTGTATCTTATTCGGACGACTTATCGCTCTTAGTTGGTGCGTCTTAGCTGAGA
  5   1   2       bld Te2N 5g3  in                    IMAGE:7202032.5p                                GGCAGCAGAGAGGGTATAGGAAAGAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGCCTCTTACAGTTTGGTGCGCTCTCTACTTTGGAACCCCCTTTCTGTACCTGGGGTCATTATGGGCTGCAGTCTTTATGCAAAGTGTCCTTTACTGGTGTCCCAAACCCCCTTGCTGCCTTCCATTAATCCACTCCAATGACCACTGGAAACCCGCC
  5   1   2       bld FaB  5g                         IMAGE:8072504.5p                                     CAGAGAGGGTATAGGAAAGAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAGATTTACAGACAATTCAAAGATCGCTGCCCTTTTACGTACTTTGTTATGTTGTAGTGGGTGAATCTGTTATCTGATCTGAACAGCTAGTCGCTCTACAGTTGTGCCTCCTACTTTGACCCTT
  5   1   2       bld Emb4 5x3  out                   IMAGE:5440370.5p                                                 AGGAAAGAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAGCTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTTACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGCCTCTTA
  5   1   2       bld Em10 5g                         IMAGE:8320536.5p                                                  GGAAAGAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTNCAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGTCTCTTACAGTTGGTGCGCTCTCTACTTTGGAACCCCTTCTGTACTGGGTCATTATGCTGCAGTCTATGCAGATGTCCTTACTGTG
  5   1   2       bld Tail 5g                         IMAGE:8545073.5p                                                  GGAAAGAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTNCAGATTTACAGACAAATTCAAGATCGCTGCCCTTTTACGTACTTTTGTTATGTGTAGTGGGGTGAATCTGTAGTCATGATCTGAACAGCTAGTCGCTCTACAGTGGTGCCTCTCACTTGGAACCCTTCGTACTGGTCATATGCTGNGTCTATGCAATGTCTTACGGTCCGAGCCTGCGCTCATATCATCAGACCTGACTGCAACTGGCTG
  5   1   2       bld Emb4 5g                         IMAGE:4680544.5p                                                   GAAAGAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGAACTTGGAACTCANGGGACAGTTCCTGCAGCAGTCTCACTCCT
  5   1   2       bld Emb4 5g3  in                    IMAGE:4960302.5p                                                   GAAAGAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTTAGTATTACCAGCGTGTCACACGAGCTGTG
  5   1   2      seed FaBN 5g3  in                    IMAGE:8075417.5p                                                   GAAAGAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCG
  5   1   2       bld Em10 5g3  in                    IMAGE:7981772.5p                                                       GAAGGGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAACTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGTCTCTTACAGTTGGG
  5   1   2       bld Ov1  5g                         IMAGE:8331740.5p                                                           GGATGATGGACTGGATATTGGTTTCCGCGTAGGCTGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAGCTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAATCTCACTCCTGACAGATGACCTGCTTAAGTATAACCAGCGGGTGACACAAGCTGTGCTAGGGGACGACCCAAGCCTCGTGAAAGTTGCCCTTGCAGATTTACAGACAAAATCAAAGATCGCTAGCCTTTTACCGTACTTGGTTTAGGTAGAAGTGGGGAGAAATCGAG
  5   1   2       bld Emb1 5x                         IMAGE:6634235.5p                                                                                   CCACGCGTCCGGTCATGAGAGACTCGCATCAAAAACGCTTCAGAAATGTCTCACACGGAAGACCGAAGGTATGTTGAGCTCTGTCAGGATTCAGTACGTTTAACAGCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAGGGTCTTAGACATTCAAGGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTTACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGGTAGTCATGATCTGGAACAGCTAAGTCGCCTCTTACAGTTGGTGCGCTCTCTACTTTGGAAACCCCTTTCTGTACCTGGGTCATTATGGCTGCAGGTCTTATGGCAGAATGGCCCTTTTACTGGGGCCACAGGAACCCCCTTTGCTGCCCTCCATTTAATCCCAGTCCAATGGACCCCCTGGAACCCCTGCGAAGAAATAATGGGGGGCTGGGCCCTTTTTATAACCCCTTTAATTT
  5   1   2       bld Emb4                            IMAGE:5440368.5p                                                                                                                                                 CGAAGGTAAGTTGAGCTCATGTCAGGATTCAGTACGTTTAACACCAGAAAGTGTGGGTCTGGATATCACAGATGAGGTCGCTGCATTACTCGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACATGGTCTTAGACATTCAATGAGGCGCAGACTGACAGTGGAGGATTTCAACCGCGCTTTGAGGTGGAGCAATGTAGAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACTAATATCCCCAAAGGCACACGCAGAGACTGCTGTACGAGTTCATGTCTCGCAATTGGACGGAAAGGGGAACTTGGAACATCTGGGAACAGTTCCTTGCAGCAGTCTCTCTCCTGACTAATGACATGCTTAAGTTGTACCAGCGCGTTTCACGAGCTGTGCTATGGGACTACCCACACAACATGAATGTTGCCTCTTCAGATTTACAGACAATATCAAAGATCGTTGCCTATCTACCGTAtttttttcttttGTAAATGGGGCGAATTTGTTCTGTACGATTTGAAACGCTATTCCCCTTCTA
  5   1   2       chi Em10      in                    IMAGE:7980283.5p                                                                                                                                                                                                                     GTTTGGCACATGTTTCACCTTGAGAAAGGTCCCAACAGGGACCGAAACGTAACGTCGGTTACATATGCAATAACACTCTTTTACTCACAGAAACCCTGGTGTTGCTGGTCTCTTCTTTATTCTACATACTAATCTTACCGTGCACCCAGGCGGTATGTGGTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCATATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTACTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGCCTCTTACAGTTGGTGCGCTCTCTACTTTGGAACCCCTTTCTGTACCTGGGTCATTATGGCTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCCCTTGCTGCCTCCATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGGCTGGTCTTCTCAGCC
  5   1   2       bld Em10                            IMAGE:7979142.5p                                                                                                                                                                                                                                                                                                                                                                                    GTCATGGATCTTCAGATGCAGTGACTTACCGCAGTATTAAAGACGGAGATTGCCACTACACTGAGGACAGAGAAATCAACCTGGTGGAACTGGCACTAGCAACAAATATCCCCAAAGGCACACCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGTCTCTTACAGTTGGTGCGCTCTCTACTTTGGAACCCCTTTCTGTACCTGGGTCATTATGGCTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCCCTTGCTGCCTCCATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACCCATCAGGATTTAGCTGGTTCAATGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCAGTTCGCCCTCTTTGTCTCTTATGGAGCTGTAGTGGGACTGCTGCTTTAGATGAAGTCATGAGCAATCTTGATCCTCTCTCTACTATGGCAGGTGCAACTGGTTGATATCTCATTCAATGCCATCAGCAATGACTAGGATGACTATCATCAGGACTCCTCG
  5   1   2       bld Thy                             IMAGE:8547117.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTAAGCTGCTGNGAGTCCATAATACGATTCGTCCCAGAGACTGCTGTACGAGTTCATGTCTCGTATTTGGATGGAAAGGGGAACTTGGAACATCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTGCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCCCTTTTACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGTCTCTTACAGTTGGTGCGCTCTCTACTTTGGAACCCCTTTCTGTACCTGGGTCATTATGGCTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCCCTTGCTGCCTCCATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACCCATCAGGATTTAGCTGGTTCAATGTATCCACATATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCCAGTTCGCCCTCTTTGTTCTCATTATGGAGCTGTAGTGCGACTGCATGCCTTATGATTGAAGTCAGTGTAGCAATCTTGTATCCTCTCCTTCTACCTATTGGGCATGGTTGAGACTGTGTTGAAGATCTTACATGTCTATGCACAGTCAATCATATGACCTATGTGTTTGACTATCTAGTTCGTGGACGCTCTCAGAATAACTCTTCTCTATTATCTCTCTGCAGCTTCTACCACCTTATTGCTCCCCTCTGTTTTANAGATGTCATATTGTTCTCTAGTAATCTATGGCGTGGATGGG
  5   1   2       bld Tail      in                    IMAGE:8542716.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAACTTGGAACTCAGGGAACAGTTCCTGCAGCAGTCTCACTCCTGACAGATGACCTTCTTAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGACGACCCACACCTCATGAAGGTTGCCCTTCAAGATTTACAGACAAATTCAAAGATCGCTGCTCTTTTACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGTCTCTTACAGTTGGTGCGCTCTCTACTTTGGAACCCCTTTCTGTACCTGGGTCATTATGGCTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCCCTTGCTGCCTCTATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACCCATCAGGATTTAGCTGGTTCAATGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCCAGTTCGCCCTCTTTGTTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGTCAGTGGAGCAAATCTTGTATCCTCTCCTTCCTACCTATTGGGCAGGGTTGCAGACTGTGTTGGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACATAAGGTGTATGGAGCTATTCTAGTTGCAGTGGAACGTCTCCTNCAGATGAAAGCTCGCTCC
  5   1   2       bld DMZ       in                         xl323o03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACCGTACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTAAGTCGTCTCTTACAGTTGGTGCGCTCTCTACTTTGGAACCCCTTTCTGTACCTGGGTCATTATGGCTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCCCTTGCTGCCTCCATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACCCATCAGGATTTAGCTGGTTCAATGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCCAGTTCGCCCTCTTTGTTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGTCAGTGGAGCAAATCTTGTATCCTCTCCTTCCTACCTATTGGGCAGGGTTGCAGACTGTGTTGGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACATAAGGTGTATGGAGCTATTCTAGTTGCAGTGGAACGTCTCCTCAAGATGAAAGCTCGCTCCTCTGATTTAACCTCATCTGCCATGCCTTCTTTACCCCACGCTTCAATCTGCTCACCCCCCTCGGTATCCTTACTAGAGATGTACAGTGAAACTGTACTGCTTCTTTGGAGACAGTCTAGCTGTGCGTTTTGGAACTGGTGGAAACCAATCACATCATGG
  5   1   2       e>1                            Xl3.1-IMAGE:7981772.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTGGTTCAATGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCCAGTTCGCCCTCTTTGTTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGTCAGTGGAGCAAATCTTGTATCCTCTCCTTCCTACCTATTGGGCAGGGTTGCAGACTGTGTTGGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACATAAGGTGTATGGAGCTATTCTAGTTGCAGTGGAACGTCTCCTCAAGATGAAAGCTCGCTCCTCTGATTTAACCTCATCTGCCATGCCTTCTTTACCCCACGCTTCAATCTGCTCACCCCCCTCGGTATCCTTACTAGAGATGTACAGTGAACTGTACTGCTTCTTTGGAGACAGTCTAGCTGTGCGTTTTGGAACTGGTGGAAACCAATCACATCATGGTGGGGCACCACAGAACATACAGGAATCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCAGCGCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGTTTGGATCGCTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGTTTTAAACCTACTGCACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCGCATAGCTATATATCACTGTATACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTTGATTGTCGAAAAATATAAAGGACAAATGTTTTTGTAAAGACTGGAGAAC
                                                  Xl3.1-CHK-1012691081                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCAATGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCCAGTTCGCCCTCTTTGTTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGTCAGTGGAGCAAATCTTGTATCCTCTCCTTCCTACCTATTGGGCAGGGTTGCAGACTGTGTTGGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACATAAGGTGTATGGAGCTATTCTAGTTGCAGTGGAACGTCTCCTCAAGATGAAAGCTCGCTCCTCTGATTTAACCTCATCTGCCATGCCTTCTTTACCCCACGCTTCAATCTGCTCACCCCCCTCGGTATCCTTACTAGAGATGTACAGTGAACTGTACTGCTTCTTTGGAGACAGTCTAGCTGTGCGTTTTGGAACTGGTGGAAACCAATCACATCATGGTGGGGCACCACAGAACATACAGGAATCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCAGCGCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGCTTGGATCGCTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGTTTTAAACCTACTGCACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCGCATAGCTATTTATCACTGTATACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTTGATTGTCGAAAAATATAAAGGACAAATGTTTTTGTAAAGACTGGAGAACTGGTTG
  5   1   1       add Bone                            IMAGE:8739723.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAGATTGTTCAAATTATTCTTTTGAATTGTTCATTAACTTTTATCTATAACTATGGTCACTAATGCTGACAACTAGGGGTTATTGTGGATGACTGGATAGTATGGCTGTTACCATAGCTGTTACCATAGCTACCACTGTGAGTGGTAGCTGCTAGGACTGCTAAGGACTTTAACTGTTAATTAACAATGACTTCTTTTATATTACATTGAGGAGGAAGATGAGTAAAAATTTTCTTTTTTGATCCCAGGACCCATCAGGATTTAGCTGGTTCAATGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCCAGTTCGCCCTCTTTGTTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGTCAGTGGAGCAAATCTTGTATCCTCTCCTTCCTACCTATTGGGCAGGGTTGCAGACTGTGTTGGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACATAAGGTGTATGGAGCTATTCTAGTTGCAGTGGAACGTCTCCTCAAGATGAAAGCTCGCTCCTCTGATTTAACCTCATCTGCCATGCCTTCTTTACCCCACGCTTCAATCTGCTCACCCCCCTCGGTATCCTTACTAGAGATGTACAGGTGAACTGTACTGCTTCTTTGGAGAACAGTTCTAGCTGGGGCGTTTTGGACTGGTGGAAACATCACATCATGGGTGGGGCACCACAGGAACATACAGGAATTCAAAAGGATGTACTGGGATGGGACAGGAAGATGCCCTCACTCCATGCAATGAAAGTATGAGACAGGTTACTTGGTGGGAAAACGTGTCAGCGCCTCCCCTCTAAACGTCCG
  5   1   2       bld Bla1                   IMAGE:3380041-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGGGGGAACCCCTCCAGGGATTTAGCTGGTTCAATGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCCAGTTCGCCCTCTTTGTTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGTCAGTGGAGCAAATCTTGTATCCTCTCCTTCCTACCTATTGGGCAGGGTTGCAGACTGTGTTGGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACATAAGGTGTATGGAGCTATTCTAGTTGCAGTGGAACGTCTCCTCAAGATGAAAGCTCGCTCCTCTGATTTAACCTCATCTGCCATGCCTTCTTTACCCCACGCTTCAATCTGCTCACCCCCCTCGGTATCCTTACTAGAGATGTACAGTGAACTGTACTGCTTCTTTGGAGACAGTCTAGCTGTGCGTTTTGGAACTGGTGGAAACCAATCACATCATGGTGGGGCACCACAGAACATACAGGAATCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCAGCGCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGCTTGGATCGCTGTCTAACTTTAAAACGTCCGGCTGGAGTGCTAAATTTAATAT
  5   1   2       bld Bla1      in                    IMAGE:3380041.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTTGGAGACCCAGTTCGCCCTCTTTGTTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGTCAGTGGAGCAAATCTTGTATCCTCTCCTTCCTACCTATTGGGCAGGGTTGCAGACTGTGTTGGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACATAAGGTGTATGGAGCTATTCTAGTTGCAGTGGAACGTCTCCTCAAGATGAAAGCTCGCTCCTCTGATTTAACCTCATCTGCCATGCCTTCTTTACCCCACGCTTCAATCTGCTCACCCCCCTCGGTATCCTTACTAGAGATGTACAGTGAACTGTACTGCTTCTTTGGAGACAGTCTAGCTGTGCGTTTTGGAACTGGTGGAAACCAATCACATCATGGTGGGGCACCACAGAACATACAGGAATCCAAAAAAGAATGTACTGNGGATGGGACAAGATAGATGCCTCAACTCACTG
  3   1   2       bld Tail      in                    IMAGE:8542716.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGGTTCAATTTCGGCTTCAACCCCCCCTTCGGTATCCTTACTAAGAGATGTACAGTGAACTGTACTGGCTTCTTGGAGACAGTCCTAGCTGTGCGTTTGGAACTGGTGGAAACCCAATCACCATCATGGTGGGGCACCCCCAGAACCATACAGGAATCCCAAAAAAAGAATGTACTGGGGATGGGACAAGAAAAGATGCCTCAACTCACTGCCCATGGAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCAGCGCCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCATCGCCCCCTCGCAGGGTAGCACAAGCAGAACTCTCTCTCTATCTGCCACTGTAGTTTGGATCGCTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGGTTTAAACCTACTGCACCCTATAGAAATCAGTGTCTGTTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCGCATAGCTATATATCACTGTGTACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTTGATTGTCGAAAAATATAAAGGACAAATGTTTTTGTAAAGACTGGAGAAACCCCCCCTC
  3   1   2       add Ga18      in                      xlk160g03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCCCCCTCGGTNNCCTTACTAGAGATGTACAGTGNNNTGTNCTGCTTCNTNGGAGACAGTCTANCTGTGCGTTTTGGAACTGGTGGAANCCAATCACATCATGGTGGGNNACCACAGAACATACAGGAATCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATNNCTCAACTCACTGCCCATGGAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCANNNCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACANCTTCTCNCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCANNNNNGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGCTTGGATCGCTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGTTTTAAACCTACTGCACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCNCATAGCTATTTATCACTGTATACNNNNCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTTNNNNNCGAAAA
  5   1   2       bld Ga18      in                      xlk160g03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCCTCGGTATCCTTACTAGAGATGTACAGTGAACTGTACTGCTTCTTTGGAGACAGTCTAGCTGTNNNTTTGGAACTGGTGGAAACCAATCACATCATGGTGGGGCACCACAGAACATACAGGAATCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCAGCGCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGCTTGGATCGCTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGTTTTAAACCTACTGCACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCGCANNNNNTTTATCACTGTATACACACTCACGTCTGCAANTTATTTTCTGTTTAACTCTACTNGTATACAATGTTCTGTAATTTGATTNTCGAAAAANATAAAGGANAAATGTTTTTNTAAA
  3   1   2       bld Em10 5g3  in                    IMAGE:7981772.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTGCTTCTTTGGAGACAGTCTAGCTGTGCGTTTTGAAACTGGTGGAAACCAATCACATCATGGTGGGGCACCACAGAACATACAGGAATCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCAGCGCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGCTTGGATCGCTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGTTTTAAACCTACTGCACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCGCATAGCTATTTATCACTGTATACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTGATGTCGAAAAAAAAAGGGAA
  3   1   2       add FaBN 5g3  in                    IMAGE:8075417.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTTTTTGGGGACAGTCTAGCTGTGCGTTTTGGACTGGTGGAAACCATTCACATCATGGTGGGGCACCACAGAACATACAGGAATCCAAAAAGAATTGTACTGGGGATGGGACAAGAAGGATGCTTCAACTCACTGCCCATGGAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCAGCGCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTATTTGGATCGCTGTCTAACTTTAAAACGTTCGGATGAGTGCTAATTTAATATTGACAGGGTCAAAGATTGGTATAACCATATAGAAATCAGTGTATGATATAGTGCCAGACAGAAAATGGCATGGAACAGTTGCAAAGGACCATGCCAATATGTTGCGCATAGCTATATATCACTGTGTACACACTCACGTCTGCAATTTATTTTCTGTTTACTCTACTGGTATACAATGTTCTGAANNGANGCGTTTTATGTACCTATTTTTT
  3   1   2       add Te2N 5g3  in                    IMAGE:7202032.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGACTGTGNNAACCATCACATCATGTGGGCACCACAGACNATACAGGATCCAAAAAAGAATTACTGGGGATGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCAGCGCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGTTTGGATCGCTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGGTATAAACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCGCATAGCTATATATCACTGTGTACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTTGATTGTCGAAAAATATAAAGGACAAATGTTTTTGTAAAGACTGGAGAACTGGTTGCAATTGATTAAGTAATTTCAATCGTACTTA
  5  -1   2       bld Bla2                            IMAGE:7299699.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAACCATCACTCTGTGGGCACACAGACATCAGATCCCAAAAGATGTACTGGGAGGACAGAAAGATGCCTCACTCACTGCCCATGAGAAGATGAAGCAGTACTGTGGGAAAACAGTGTCAGCGCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGGAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGTAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGTTTGGACCACTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGTTTTAAACCTAGAGCACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCACGCCAATATGTTGCGCATAGCTATATATCCCTGTGCACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTTGATTGTCGAGAAATATAAAGGACAAATGTTTTTGTAAAGACTGGAGAACTGGTTGCAATTTGATTAAGTAAATTTTTCAGATCTGTTTTCCAAC
  3   1   2       bld Em10      in                    IMAGE:7980283.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAAAAGGAATGTACTGGGGATGGGACAAAGAAAGATGCCTCAACTCACTGCCCCATGGAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCAGCGCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGTTTGGACCACTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGTTTTAAACCTACAGCACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCGCATAGCTATATATCACTGTGTACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTTGATTGTCGAAAAATATAAAGGACAAATGTTTTTGTAAAGACTGGAGAACTGGTGCAATTGATTAAAGAATTTG
  3   1   2      seed DMZ       in                         xl323o03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCAGCGCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGCTTGGATCGCTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGTTTTAAACCTACTGCACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCGCATAGCTATTTATCACTGTATACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTTGATTGTCGAAAAATATAAAGGACAAATGTTTTTGTAAAGACTGGAGAACCTGGTGCAATTGA
  3   1   2       bld Tbd7                                 XL081l20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGACAAGAAAGATGCCTCAACTCACTGCCCATGNAGAAGATGAAGCAGTTACTGTGGGAAAACAGTGTCAGCGCCCCCCTCAAACGCAGATTTCTGTTGCATCTAGACCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGTTTGGACCACTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGTTTTAAACCTACAGCACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCGCATAGCTATATATCACTGTGTACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTNGTATACAATGTTCTGTAATTNATGTCGAAAAATATAAAGGACAAA
  3   1   2       bld Bla1      in                    IMAGE:3380041.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGAGAACACAAGGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGCTTGGATCGCTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGTTTTAAACCTACTGCACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCGCATAGCTATTTATCACTGTATACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTTGATTGTCGAAA
  3   1   2       bld Emb4 5g3  in                    IMAGE:4960302.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCATAAGAGAGGCTTTCCAAAGGAGCAGGCTGACACCTCGTGGAACACCGCGTTTTACTTTCTTAATAGGAGGAAGACAAGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAGAGTGTCTTCCAATTGCATACAGGTCCTGCAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCCATGATAGGAAGAGTTGCCAGAGCTGGACGCAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCACTGTAGCTTGGATCGCTGTCTAACTTTAAAACGTTCGGCTGAGTGCTAAATTTAATATTGACAGGGTCAAAGATTGTTTTAAACCTACTGCACCCTATAGAAATCAGTGTCTGCTATTGTGCCCGACAGAAACTGGCATGGAAACCGTTGCAAAGGACCATGCCAATATGTTGCGCATAGCTATTTATCACTGTATACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTTGATTGTCGAAAAATATAAAGGACAAATGTTTTTGTAAAGACTGGAAAAAAAAAAA
  3   1   2       bld Lu1                             IMAGE:4674290.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTGTACACACTCACGTCTGCAATTTATTTTCTGTTTAACTCTACTGGTATACAATGTTCTGTAATTTGATTGTCGAAAAATATAAAGGACAAATGTTTTTGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)