Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 05 Dec 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl313g17.5                            5 END     1           1       20                hypothetical protein LOC734943 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8738156.5.5                   146 PI      89       3402     3537                (no blast hit)
     3   0.0    0Xl3.1-xlk159n17ex.5.5                     127 PI      84       3313     3537                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:6324439.5                      31 PI      87       1607     1757                (no blast hit)
     5   0.0    0Xl3.1-XL204c11.3                           27 PI      82       3343     3536                (no blast hit)
     6   0.0    0Xl3.1-xlk143n22ex.3                        24 PI      89         41     1104                frizzled related protein 2, crescent [Xenopus tropicalis]
     7   0.0    0Xl3.1-PBX0039B04.5                         20 PI      94       3427     3540                (no blast hit)
     8   0.0    0Xl3.1-XL104d11.5                           18 PI      87       1613     1758                (no blast hit)
     9   0.0    0Xl3.1-XL500j02ex.5.5                       17 PI      87       3316     3540                (no blast hit)
    10   0.0    0Xl3.1-IMAGE:8460886.5                      16 PI      87       3345     3537                (no blast hit)
    11   0.0    0Xl3.1-IMAGE:6956578.3                      13 PI      86       3326     3540                PREDICTED: phosphoribosyl pyrophosphate amidotransferase [Gallus gallus]
    12   0.0    0Xl3.1-XL472h04ex.3                         13 PI      82       3338     3537                (no blast hit)
    13   0.0    0Xl3.1-xl289p06.3                           12 PI      90       3397     3537                (no blast hit)
    14   0.0    0Xl3.1-XL496j03ex.5                         12 PI      89       3347     3537                (no blast hit)
    15   0.0    0Xl3.1-XL435h11ex.3                         12 PI      86       3314     3535                (no blast hit)
    16   0.0    0Xl3.1-xl278g01.3                           12 PI      85       3311     3538                PREDICTED: similar to Meteorin, glial cell differentiation regulator-like [Bos taurus]
    17   0.0    0Xl3.1-IMAGE:7008738.5                      11 PI      80       3307     3540                (no blast hit)
    18   0.0    0Xl3.1-IMAGE:6638961.5                      11 PI      80       3331     3540                (no blast hit)
    19   0.0    0Xl3.1-IMAGE:7764940.3                      10 PI      87       1609     1757                (no blast hit)
    20   0.0    0Xl3.1-IMAGE:5506678.5                      10 PI      84       3316     3540                (no blast hit)
    21   0.0    0Xl3.1-IMAGE:3200279.3                       9 PI      88       3326     3522                (no blast hit)
    22   0.0    0Xl3.1-IMAGE:8073664.5                       9 PI      87       1604     1756                (no blast hit)
    23   0.0    0Xl3.1-IMAGE:4783772.5                       9 PI      85       3308     3535                (no blast hit)
    24   0.0    0Xl3.1-IMAGE:3400253.3                       9 PI      83       3313     3540                (no blast hit)
    25   0.0    0Xl3.1-PBX0102B05.5                          9 PI      82       3314     3537                (no blast hit)
    26   0.0    0Xl3.1-XL420f24ex.5                          9 PI      82       3331     3540                (no blast hit)
    27   0.0    0Xl3.1-xlk163e04ex.3                         8 PI      86       2416     2616                (no blast hit)
    28   0.0    0Xl3.1-XL412n13ex.5                          8 PI      86       3331     3512                (no blast hit)
    29   0.0    0Xl3.1-IMAGE:6957025.3                       8 PI      85       3340     3526                (no blast hit)
    30   0.0    0Xl3.1-XL492d21ex.3                          8 PI      85       3346     3529                (no blast hit)
    31   0.0    0Xl3.1-IMAGE:4406904.5                       7 PI      83       3330     3535                (no blast hit)
    32   0.0    0Xl3.1-XL069g15.3                            7 PI      81       3310     3540                (no blast hit)
    33   0.0    0Xl3.1-IMAGE:3548220.3                       6 PI      84       3315     3539                (no blast hit)
    34   0.0    0Xl3.1-xl297i12.5                            6 PI      84       3316     3503                (no blast hit)
    35   0.0    0Xl3.1-xl238g19.5                            5 PI      90       3406     3540                (no blast hit)
    36   0.0    0Xl3.1-XL064o16.5                            5 PI      88       3314     3529                (no blast hit)
    37   0.0    0Xl3.1-IMAGE:3379511-IMAGp.5                 5 PI      85       3314     3540                (no blast hit)
    38   0.0    0Xl3.1-IMAGE:6949953.5                       5 PI      82       3311     3537                (no blast hit)
    39   0.0    0Xl3.1-IMAGE:3200165-IMAGp.5                 4 PI      93       3417     3540                (no blast hit)
    40   0.0    0Xl3.1-xl318l12.3                            4 PI      92       1604     1729                (no blast hit)
    41   0.0    0Xl3.1-IMAGE:8069594.3                       4 PI      89       3354     3537                (no blast hit)
    42   0.0    0Xl3.1-IMAGE:6636785.5                       4 PI      88       3375     3540                GASTRULA ZINC FINGER PROTEIN XLCGF46.1
    43   0.0    0Xl3.1-IMAGE:6326651.5                       4 PI      87       3314     3536                (no blast hit)
    44   0.0    0Xl3.1-IMAGE:4743651-IMAGp.5                 4 PI      87       1604     1757                (no blast hit)
    45   0.0    0Xl3.1-XL093l16.3                            4 PI      87       1605     1757                (no blast hit)
    46   0.0    0Xl3.1-IMAGE:3580408-IMAGp.5                 4 PI      86       3304     3481                (no blast hit)
    47   0.0    0Xl3.1-XL068p05.3                            4 PI      86       3374     3537                (no blast hit)
    48   0.0    0Xl3.1-xl286f12.3                            4 PI      85       3313     3540                (no blast hit)
    49   0.0    0Xl3.1-IMAGE:4755669-IMAGp.5                 4 PI      85       3314     3540                (no blast hit)
    50   0.0    0Xl3.1-IMAGE:6880702.5                       4 PI      84       3314     3537                (no blast hit)
    51   0.0    0Xl3.1-IMAGE:8531640.5                       4 PI      84       3314     3537                (no blast hit)
    52   0.0    0Xl3.1-IMAGE:6877297.3                       4 PI      84       3330     3540                (no blast hit)
    53   0.0    0Xl3.1-IMAGE:8077290.5                       4 PI      84       3334     3537                (no blast hit)
    54   0.0    0Xl3.1-IMAGE:5047492-IMAGp.5                 4 PI      83       3338     3534                (no blast hit)
    55   0.0    0Xl3.1-IMAGE:6877460.3                       4 PI      82       3314     3533                (no blast hit)
    56   0.0    0Xl3.1-IMAGE:8462308.5                       4 PI      81       3314     3514                (no blast hit)
    57   0.0    0Xl3.1-rxlk60i18ex.3                         3 PI      90       3313     3515                (no blast hit)
    58   0.0    0Xl3.1-xlk1f13ex.3                           3 PI      89       3403     3540                (no blast hit)
    59   0.0    0Xl3.1-IMAGE:3199960.3                       3 PI      88       3346     3529                (no blast hit)
    60   0.0    0Xl3.1-xl277a04.3                            3 PI      87       3309     3519                (no blast hit)
    61   0.0    0Xl3.1-XL191j08.5                            3 PI      87       3374     3540                (no blast hit)
    62   0.0    0Xl3.1-XL489p14ex.3                          3 PI      86       3350     3516                (no blast hit)
    63   0.0    0Xl3.1-XL502i24ex.3                          3 PI      85       3311     3538                (no blast hit)
    64   0.0    0Xl3.1-PBX0061A10.5                          3 PI      85       3309     3529                hypothetical protein LOC549545 [Xenopus tropicalis]
    65   0.0    0Xl3.1-IMAGE:4057445.5                       3 PI      85       3326     3540                (no blast hit)
    66   0.0    0Xl3.1-IMAGE:3300525-IMAGp.5                 3 PI      84       3343     3537                (no blast hit)
    67   0.0    0Xl3.1-xl292o22.5                            3 PI      83       3314     3540                (no blast hit)
    68   0.0    0Xl3.1-xlk161h01ex.5                         3 PI      83       3314     3504                (no blast hit)
    69   0.0    0Xl3.1-IMAGE:4174480.5                       3 PI      82       3331     3525                (no blast hit)
    70   0.0    0Xl3.1-IMAGE:5156912.5                       3 PI      81       3306     3540                (no blast hit)
    71   0.0    0Xl3.1-IMAGE:6950558.3                       3 PI      81       3326     3540                (no blast hit)
    72   0.0    0Xl3.1-IMAGE:4969157.5                       3 PI      81       3310     3522                (no blast hit)
    73   0.0    0Xl3.1-IMAGE:3581682.5                       2 PI      91       3363     3540                (no blast hit)
    74   0.0    0Xl3.1-XL219l22.3                            2 PI      91       3417     3540                (no blast hit)
    75   0.0    0Xl3.1-XL512m11ex.5                          2 PI      89       3343     3519                (no blast hit)
    76   0.0    0Xl3.1-IMAGE:4678018.5                       2 PI      88       3314     3483                (no blast hit)
    77   0.0    0Xl3.1-XL020p11.5                            2 PI      86       3345     3540                (no blast hit)
    78   0.0    0Xl3.1-IMAGE:3302046.3                       2 PI      86       3346     3538                (no blast hit)
    79   0.0    0Xl3.1-IMAGE:8463852.5                       2 PI      86       1605     1756                (no blast hit)
    80   0.0    0Xl3.1-IMAGE:3399564.5                       2 PI      85       3326     3512                (no blast hit)
    81   0.0    0Xl3.1-XL038b01.5                            2 PI      85       3331     3478                (no blast hit)
    82   0.0    0Xl3.1-IMAGE:4202879.5                       2 PI      84       3318     3526                (no blast hit)
    83   0.0    0Xl3.1-XL409j15ex.3                          2 PI      83       3312     3500                DIS3-like exonuclease 2

 This cluster: approximate FL confidence score = 88%

 1012837926 Xl3.1-xlk149f01ex.5.5 - 60 ESTs
                                                                       ...-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-xlk149f01ex.5.5              TCATTTGGGAAGGAGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTGCTGTGCTTCCTTGGCGTGTGGNTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGCCGAGGCAATCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTGCCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGTGGTGAACAATGCCTACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCAGGGGCATTCACGGAACTGTATATAAATACTGTATATATCTATGTTAACTTACTATAAAACCTTATTGATAAAAAGAGCGGAGCGGTCTCCTACTGTTTGAGAGGACACCGTGTCATCAGAAAAGGGCAACAGTATATTATGAATAGATCTTTTAAGAAGAGTGGAGGTGAAATTGTGGGTTCTCTGGCCCCTGACAATGGCTGTAGCATAGGTGATTTCAATTTGACATGGGCTACGTCACCCAGTGCACCCAGTACAACCGGTAGGAATTCAGTGATATTTATAACACAGAATCAGACATGGAGACTCTTTCTAAAAGACACATGGGCTTATTTACTAACATAGCGGCTCAACTGAAATGACCCGATTGGCTGCTTTTAATACAAATACTAATAACTGCATTTGAGCAATTATGTTAGTAAATTAAACCTGCAGTAGTTCTATTGTTTACACCATAGCGAGGAAAGACATTTTCGAAGAACAGAAAAAGCTGCATTTTTTCAAAATATACTGTATATTTTTCTTAAAGGGAAACTGTTGCCAAGGTGAGGGTTTAGTAGAAGCTTCATCATACGGAGGTGAGAAACTTTCTAAATGCAATTAATTAGAAGAGAAACGGATGCTGAGAGAGGGATAGTGAACATAAACTTGATTATTTCAGAAATGGTACAGAATTTTTAATTGATTGTATTTAGAAAGTTTCTCGTTTCAGTATGAGGAAGCTTATATGAAATTTTCATTTTGGTGATAGTTCCCCTTTAGATGAAAAGTCACACAGTACTGTTTAAGTCTGTGTAAAAAAAAGTGGGATATATAAGAGACGTACCTACATGTAGTGACTGCAAAAATCTCTAGTGCACTTATAAATATAAAAATAATGTCATTATATATACTGGGACAGGGATGACGCCACACTAGAGCTTGAACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTACCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCACAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCATGGGGGGCTAAGATCTGTACAATGTGCAGCACATTATCAGATGCTTATGAATATTCAATAAAATGCATTTAAAGGCAAAAAAAAACANTGACTTGGGTCCTCAAAGAAATAAAAGTCACTTTTTTTTAAAGACCTTGACAGGTTTTATATCTTTAGCCTAAGAGTAAANGCCCCAACAAGC------------AAAGCGTGTCCNGATAAAGTTTTNGTATTTTTTTCCTTGCTGCTTGANCAATTCTTGTAGGAACTCACATTTTTGGCTTTGNTG------------CNCACCCTTGGACNGGGGTGAACTATGAGTATGTCTTCCCAATTTACATTCTATTTTTGAAATTGCATTTACTTTAGAAGNGCTCATACAGGTTATTTCCTTTTTTAGGTTTTATCTCTGGGACAAANGATAAAAAAGAAGATCCATCTACAAAGACGACTGCATTTTGTGTAACTATTTTCACACTTTGGCCTTTCTGCCGGTTGGAAATAATTGATAAGTGAACTGCGGCAAGATGTGAACACATTAAGAAAATGTGTTTAAAACGAAGTGTGATTTCCTTTCTTTCCCTCAAGTTTAGCCATTTAAGGATTTACAAAATTAAAAGAGACATATTTCCACCCGTATAGACCTGCAGCAGAAACGTACACATTTCATTTCTATCTAACCCCCCTCTTCTGGACACAATGGTACTCCTGGTACACATTCATAATACAGGTATACAATCTGTTATCCAGAAACCCGTTATCCAGAAAGCCCCTAATTACAGAATGGCCATCTCCCATAGACTCCATTTTATCCAAATAATCCAAACCTTTAAAAATGATTTCCTTTTTCGCTGTAATAATTAAACAGTACATTGTACTTGATCCAAACTAAGATATAATTAATCCTTATTGGAAGCAAAACCAGCCTATTGGGTTTATTTCATGTTTACAT
                                                  Xl3.1-CHK-1012721419                    GGGAAGGAGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTxxxxTGCTTCxTxGxxxxxxGxTxxxxAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGxCxxxGCAATCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTGCCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGTGGTGAACAATGCCTACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCAGGGGCATTCACGxxAxxxTATATAAxxxxxGTATATATCTATGTTAACTTACTATAAAACCTTATTGATAAAAAGAGCGGAGCGGTCTCCTACTGTTTGAGAGGACACCGTGTCATCAGAAAAGGGCAACAGTATATTATGAATAGATCTTTTAAGAAGAGTGGAGGTGAAATTGTGGGTTCTCTGGCCCCTGAxxAxGGCTGTAGCATAGGTGATTTCAATTTGACATGGGCTACGTCACCCAGTGCACCCAGTACAACCGGTAGGAATTCAGTGATATTTATAACACAGAATCAGACATGGAGACTCTTTCTAAAAGACACATGGGCTTATTTACTAACATAGCGGCTCAACTGAAATGACCCGATTGGCTGCTTTTAATACAAATACTAATAACTGCATTTGAGCAATTATGTTAGTAAATTAAACCTGCAGTAGTTCTATTGTTTACACCATAGCGAGGAAAGACATTTTCGAAGAACAGAAAAAGCTGCATTTTTTCAAAATATACTGTATATTTTTCTTAAAGGGAAACTGTTGCCAAGGTGAGGGTTTAGTAGAAGCTTCATCATACGGAGGTGAGAAACTTTCTAAATGCAATTAATTAGAAGAGAAACGGATGCTGAGAGAGGGATAGTGAACATAAACTTGATTATTTCAGAAATGGTACAGAATATTTAATTGATTGTATTTAGAAANTTTCTCGTTTCAGTATGAGGAAGCTTATATGAAATTTTCATTTTGGTGATAGTTCCCCTTTAGATGAAAAGTCACACAGTACTGTTTAAGTCTGTGTAAAAAAAAGTGGGATATATAAGAGACGTACCTACATGTAGTGACTGCAAAAATCTCTAGTGCACTTATAAATATAAAAATAATGTCATTATATATACTGGGACAGGGATGACGCCACACTAGAGCTTGAACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTACCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCACAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCATGGGGGGCTAAGATCTGTACAATGTGCAGCACATTATCAGATGCTTATGAATATTCAATAAAATGCATTTAAAGGCAAAAxxAxxCANTGACTTGGGTCCTCAAAGAAATAAAAGTCACTTTTTTTTAAAGACCTTGACAGGTTTTATATCTTTAGCCTAAGAGTAAANGCCCCA------------CGTGTTAAAGCGTGTCCNGATAAAGTTTTNGTATTTTTTTCCTTGCTGCTTGANCAATTCTTGTAGGAACTCACATTTTTGGCTTTGNTGTCGTTA------------CTTGGACNGGGGTGAACTATGAGTATGTCTTCCCAATTTACATTCTATTTTTGAAATTGCATTTACTTTAGAAGNGCTCATACAGGTTATTTCCTTTTTTAGGTTTTATCTCTGGGACAAxAxAxAAAAxAxAAGATCCATCTACAAAGACGACTGCATTTTGTGTAACTATTTTCACACTTTGGCCTTTCTGCCGGTTGGAAATAATTGATAAGTGAACTGCGGCAAGATGTGAACACATTAAGAAAATGTGTTTAAAACGAAGTGTGATTTCCTTTCTTTCCCTCAAGTTTAGCCATTTAAGGATTTACAAAATTAAAAGAGACATATTTCCACCCGTATAGACCTGCAGCAGAAACGTACACATTTCATTTCTATCTAACCCCCCTCTTCTGGACACAATGGTACTCCTGGTACACATTCATAATACAGGTATAAAATCTGTTATCCAGAAACCCGTTATCCAGAAAGCCCCTAATTACAGAATGGCCATCTCCCATAGACTCCATTTTATCCAAATAATCCAAACCTTTAAAAATGATTTCCTTTTTCGCTGTAATAATTAAACAGTACATTGTACTTGATCCAAACTAAGATATAATTAATCCTTATTGGAAGCAAAACCAGCCTATTGGGTTTATTTCATGTTTACATGATTTT
                                                      consensus depths                   4     7     7    13    10    18    10    18    10    18    10    18    10    18    10    18     7    19     9    19    10    19    11    20    11    20    12    21    12    21    12    21    12    21    12    21    12    22    12    23    11    24    10    26    22    26    20    27    22    27    22    27    22    27    21    26    21    27    21    27    22    28    22    28    21    27    19    27    10    28    20    28    19    27    19    27    20    27    20    27    20    27    20    27    20    27    20    28    15    28    18    28    20    29    20    29    21    29    21    29    21    29    20    29    21    29    21    29    19    27    19    27    19    25    18    25    16    24    15    22    14    22    14    18    11    16    13    16    11    16    11    16    11    16    13    16    12    15    10    15    10    15     7    15     7    15     8    15     7    15     7    15     7    13     8    13     8    13     8    12     8    12     8    12     8    12     6    11     5    10     4     8     4     5     4     5     4     5     2     5     2     5     2     5     2     5     2     5     2     4     1     3     1     3     1     3     1     3     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     2     2     2     2     1     2     1     2     1     2     1     2     1     3     2     5     2     4     2     6     3     6     3     6     4     6     5     6     4     6     6     8     6     8     6     9     6     9     7     9     7     9     7    10     6    10     8    12     8    12     8    12     9    12    10    13    10    13     9    15    11    15    11    14    13    14    14    14    13    14    14    14    12    14    14    14    14    14    13    14    15    15    15    15    16    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    16    18    15    18    15    18    16    18    15    18    17    20    17    20    18    21    18    20    18    20    17    20    18    20    16    19    17    19    17    19    17    19    16    19    16    20    17    20     6    20     4    11     4     5     2     3     2     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     0     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     0     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2      ests                              Xl3.1-xlk149f01ex.5              TCATTTGGGAAGGAGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTGCTGTGCTTCCTTGGCGTGTGGNTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGCCGAGGCAATCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTGCCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGTGGTGAACAATGCCTACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCAGGGGCATTCACGGAACTGTATATAAATACTGTATATATCTATGTTAACTTACTATAAAACCTTATTGATAAAAAGAGCGGAGCGGTCTCCTACTGTTTGAGAGGACACCGTGTCATCAGAAAAGGGCAACAGTATATTATGAAT
  5   1   2      ests                              Xl3.1-xlk157c05ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATAAACTTGATTATTTCAGAAATGGTACAGAATATTTAATTGATTGTATTTAGAAANTTTCTCGTTTCAGTATGAGGAAGCTTATATGAAATTTTCATTTTGGTGATAGTTCCCCTTTAGATGAAAAGTCACACAGTACTGTTTAAGTCTGTGTAAAAAAAAGTGGGATATATAAGAGACGTACCTACATGTAGTGACTGCAAAAATCTCTAGTGCACTTATAAATATAAAAATAATGTCATTATATATACTGGGACAGGGATGACGCCACACTAGAGCTTGAACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTACCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCACAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCATGGGGGGCTAAGATCTGTACAATGTGCAGCACATTATCAGATGCTTATGAATATTCAATAAAATGCATTTAAAGGCAAA
  5  -1   2      3-95                                 Xl3.1-XL057f10.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTGGCTCTCTGCCCTTTTTTTTTTAANAAACATCACAGGAANGTGATTTAGGCTGTCGTTTGCAGAAATATTACCGAAACGATTCANTGACTTGGGTCCTCAAAGAAATAAAAGTCACTTTTTTTTAAAGACCTTGACAGGTTTTATATCTTTAGCCTAAGAGTAAANGCCCCAACAAG------------TAAAGCGTGTCCNGATAAAGTTTTNGTATTTTTTTCCTTGCTGCTTGANCAATTCTTGTAGGAACTCACATTTTTGGCTTTGNT------------ACNCACCCTTGGACNGGGGTGAACTATGAGTATGTCTTCCCAATTTACATTCTATTTTTGAAATTGCATTTACTTTAGAAGNGCTCATACAGGTTATTTCCTTTTTTAGGTTTTATCTCTGGGACAAANGATAAAAAAGAAGATCCATCTACAAAGACGACTGCATTTTGTGTAACTATTTTCACACTTTGGCCTTTCTGCCGGTTGGAAATAATTGATAAGTGAACTGCGGCAAGATGTGAACACATTAAGAAAATGTGTTTAAAACGAAGTGTGATTTCCTTTCTTTCCCTCAAGTTTAGCCATTTAAGGATTTACAAAATTAAAAGAGACATATTTCCACCCGTATAGACCTGCAGCAGAAACGTACACATTTCATTTCTATCTAACCCCCCTCTTCTGGACACAATGGTACTCCTGGTACACATTCATAATACAGGTATAAAATCTGTTATCCAGAAACCCGTTATCCAGAAAGCCCCTAATTACAGAATGGCCATCTCCCATAGACTCCATTTTATCCAAATAATCCAAACCTTTAAAAATGATTTCCTTTTTCGCTGTAATAATTAAACAGTACATTGTACTTGATCCAAACTAAGATATAATTAATCCTTATTGGAAGCAAAACCAGCCTATTGGGTTTATTTCATGTTTACATGATTTTCTAGCAGGCCCGGACTGGCAATCTGTGGATTCTGGCAATTTGCCATAGACAGTCACTATATATTGGGCCGTGGGGGGCTGTTTGGGCTGCTGTGTGGCCTGTTTGGGCCTCTGTGTACCTGAAATACCGGGGCCTATTTTGAATCTCAGGCCATGCCTGTTTTCAGAAAACGGGCATGGAGTGGGATTATAAAGATCCAAATTATGAAATGATCCGTTATCCGGAAAACCCCAGGTTCCGAGCAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTATCTCAACTATCACAAATGATACTGGCTCTACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAATGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACCTTTACGAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCAAACTTGAG
                                                                   SNP                                                                                                                                      C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------T-----
                                               BLH MIN     225      89              
                                               BLH OVR     420     222              
                                               EST CLI      -4      36              
                                               ORF LNG     420      10              
  5   1   2      ests                              Xl3.1-xlk149f01ex.5              TCATTTGGGAAGGAGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTGCTGTGCTTCCTTGGCGTGTGGNTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGCCGAGGCAATCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTGCCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGTGGTGAACAATGCCTACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCAGGGGCATTCACGGAACTGTATATAAATACTGTATATATCTATGTTAACTTACTATAAAACCTTATTGATAAAAAGAGCGGAGCGGTCTCCTACTGTTTGAGAGGACACCGTGTCATCAGAAAAGGGCAACAGTATATTATGAAT
                                                  Xl3.1-CHK-1012687562                    GGGAAGGAGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTxxxxTGCTTCxTxGxxxxxxGxTxxxxAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGxCxxxGCAATCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTGCCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGTGGTGAACAATGCCTACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCAGGGGCATTCACGxxAxxxTATATAAxxxxxGTATATATCTATGTTAACTTACTATAAAACCTTATTGATAAAAAGAGCGGAGCGGTCTCCTACTGTTTGAGAGGACACCGTGTCATCAGAAAAGGGCAACAGTATATTATGAATAGATCT
  5   1   2       bld Emb9      in                    IMAGE:7975754.5p GCCCGGGACATCATTTGAGGAGGAAGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTGTGCTTCTTGGCGTGTGGCTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGAGGCAATCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCAATTTGCTTTGATCGGTATATCTTCCCATGTCGCAATCAGTGTGAGGCTGTAAGGAGCAGCTGTGCCCCTATCATGGCCTGATATGGGTACCCTTGGCCTGAGATCCCTCAATGCGATTAAGTTTCCTGATGACCACCGCATGTGTATCTCAACAATCTCATCTGATACTGGCTCTACCCCGTAAAACAAATGCCCTGAGCCGCCTTGTAAGACTGCGAACTTGAATAAGGCAGCACCTTCCAAGGAGAAACTGGATACAATTCTCCCAAAATGATTTTTTGACTATGTCCGTATCCCAAAATAAACATTC
  5   1   2       bld DMZ       in                         xl285e19.5p  CTCAGCTGTGGTCAGAAGGGGCCATTGGGATTTTCCTTATGGATGCACAAAAGACAAATCCCAATGGCCACTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTGTGCTTCTTGGCGTGTGGCTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGAGGCAATCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTGCCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTANAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAANAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTAC
  5   1   2       bld Ga18      in                       xlk53m03ex.5p          CTCATCATTTGGGAAGGAGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTNNNNNCTTGGCGTGTGGNTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGNNNNNTCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGNNNCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAATGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGNAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCANGGNCCGTATCACCAAAAAGAACANCACTTCCGCTAACCTTTACGACTTTGATTTNGNATTCCAAACTTGAGANCCTGAAACACGGCTCGTNNCCCAAAACAGANGNCCTTCCT
  5   1   2       bld DMZ       in                         xl281d07.5p          CATCATTTGGGAAGGAGGAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTGTGCTTCTTGGCGTGTGGCTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGAGGCAATCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTGCCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATTACAAATGATACTGGCTCTACCCGTAGAATGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTT
  5   1   2       bld Ga18      in                      xlk165a06ex.5p           TCATCATTTGGGAAGNAGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTNNNNNCTTGGCGTGTGGCTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGANNNNTCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTNNCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGANTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCNNTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAANACGGNTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCANNAG
  5   1   2       bld Ga18      in                      xlk105k24ex.5p           TCATCATTTGGGAAGGAGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTGNNNNCTTGGCGTGTGGNTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGNNNNNTCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGNNNNCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAATGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGNCATAATGATTTTGTTGCCAAGGNCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGNTTCCAAACTTGAGATCCTGAAANACGGCTCGTTNCCCAAAACAGANGTCCTTCCTAGGCTT
  5   1   2       bld Ga18      in                      xlk157c05ex.5p           TCATCATTTGGGAAGGAGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTNNNTNCTTGGCGTGTGGCTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGANNNNTCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTNNCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGNCCTTCCTAGGCTTCAGNAGNNNNNGGATCTGGATGCTACCTGTGTNCAGAANATCATGCGTGGGANCCGCACAGGCGTCTATNTGATTTGTGCAGAAGTNNAAGANGGGAAGGNAGTGGTGANNAATGCCTACNCATGGNAGAAAAGANNAAAAACCTGCATTTCGCTGTACGGAAATGGA
  5   1   2       bld Ga18      in                       xlk51a23ex.5p                ATTTGGGAAGGAGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTNNNNNCTTGGCGTGTGGNTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGANNNATCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTNNCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGNCCGTATCACCAAAAAGAACANCACTTCCGCTAACCTTTACGACTTTGATTTGGNANTCCAAACTTGAGATCCTNAAACACGGCTCGTTNCCCAAAACAGACGTCCTTNCCTAGGCTTC
  5   1   2       bld Ga18                              xlk133i20ex.5p                ATTTGGGAAGGAGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTGNNNTCTTGGCGTGTGGCTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGNNNNNTCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTNNCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGNCAGCTGTAGAGNCTGTGAACTTGAAGAAGNCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTNTTGCCAAGGNCCGTATCACCAAAAAGAACATCAC
  5   1   2       bld Ga18      in                        xlk7m13ex.5p                    GGAAGGAGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTGNNNNCTTGGCGTGTGGCTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGAGGNAATCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTNNCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGNTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAATGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACANCACTTCCGCTAACCTTTACGACTTTGANTTGGNNTCCAAACTTGAGATCCTGAAACAC
  5   1   2       bld Ga18      in                      xlk123m02ex.5p                     TGNAGGAGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTGNNTTCTTGGCGTGTGGNTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGNNNNNTCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGNNNCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAATGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGNTGCCAAGGNNCCGTATCACCNAAAAGAACATCACTTCCNCTAACCTTTACGACTTTGATTTGGNNNCCAAACTTGAGNNCCTGAAANACGGCTCGTTGCCCAAAAACNNNCGTCCTTNCCT
  5   1   2       add Ga18      in                       xlk53o11ex.5p                        AGGAGAAANATTTGTCTTTTGTGCATCCNTAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTNNNNNCTTGGNGNGTGGNTCGCAATCTATGTATCTGGACTTCTTTGGNAGCTCCTCAAGATGCATNCGAATCCCAAAGAGNATGGCTCTCTGCTATGACANTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACANGAGANGATGGCCGAGGNNNCCAACAATCCTCAAGCTGGNTACCTCTTTTGGNAAGAGAGNGCCATCCTGATGCAAGAATATTCCT
  3   1   2       bld Ga18      in                       xlk81e03ex.3p                          AGANNNNNTNTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTNTCAGANCNTGGGAAAGCCACTGATTGTTTTGNTGTNCTTCTTGGCGTGTGGCTCGCAATCTATGTATCTGGACTTCTTTGNCANCTCCTCAAGATGCATNCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATNNNCGAGGCAATCCAACAANCCTCAAGCTGGTTNCCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGNACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCANCTGTNCCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGTGGTGAACAANNCNACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCAGGGGNATTCACGAGAANTGTATATAATACTGTA
  5   1   2       bld Ga14                               Ga14-p15g4.5p                           AAAATTTGTCTTTNGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTCGCTGTGCTTCTTGGCGTGTGGCTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGANATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGAGGCAATCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGT
  5   1   2       bld Ga18      in                       xlk81e03ex.5p                           AGAAACATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTNNNNNCTTGGCGTGTGGCTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGAGNNNTCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTNNCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACNNCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCNNNAACACGGCTCGTTNCCCAAAANAGA
  5   1   2       bld Ga12      in                         XL194f15.5p                                AGGGTCTTTTGTGCATCCATAAGGAAAATACCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTGTGCTTCTTGGCGTGTGGCTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGAGGCAATCCAACAATCCTCAANCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTGCCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGAT
  5   1   2       bld Ga18      in                      xlk149f01ex.5p                                 ATTTGTCTTTTGTGCATCCATAAGGAAAATCCCAATGGCCCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTNNNNNCTTGGCGTGTGGNTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGANNNATCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTNNCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAATGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTNCANNAGTGGNTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGANCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTNNAAGAGGGGAAGGTAGTGGTGAACAATGCCTACGCATGGNAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAG
  5   1   2       bld Ga14                                Ga14-p4f1.5p                                      CTTTTGTGATCCATAAAGAAAATCCCAATGGCNCCTCAGCTGTGTCAGAGCCTGGGAAAGCCACTGATTGTTTTGCTGTGCTTCTTGGCGTGTGGCTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGAGGCAATCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGA
  5   1   2       bld Neu7      in                         XL026m11.5p                                                                                                          GGTTTTGCTGTGCTTCTTGGCGTGTGGCTCGCAATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGAGGCAATCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTGCCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACG
  5   1   2       bld Ga18      in                       xlk69o14ex.5p                                                                                                                                           AATCTATGTATCTGGACTTCTTTGGCAGCTCCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGANNNNTCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTNNCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAATGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACANCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTNAAACACGGCTCGNTNCCCAAAACAGACGTCCTTCCTAGGCTTCANNAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGNNCCGCACAGGCGTCTATGTGATTTGTGCA
  5   1   2       bld Ga18      in                       xlk64g18ex.5p                                                                                                                                                                         CCTCAAGATGCATGCGAATCCCAAAGAGTATGGCTCTCTGCTATGACATTGGATATTCGGAGATGAGGATCCCCAACTTGCTGGAACATGAGACGATGGCCGANNNNTCCAACAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTNNCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTNCNCAAAACAGACGTCCTTCCTAGGCTTCAGNAGTGNNTGGATCTGGATNCTACCTGTGTGCAGAATATCATGCGTGGGNNCCNCACAGGCGTCTATGTGANTTGTGCAGAAGTNNAAGAGGNNNAGGTAGNGNNGAACAATGCNTACGCATGGNAGAAAAAGAACAAAANNTGCATTNCGCTNTACGGAAAT
  3   1   2       bld Ga18      in                      xlk149f01ex.3p                                                                                                                                                                                                                                   TCGNAGATGNGNNNCCCCAACTTGCTGGNACATGAGACGATGNCCGAGGNAANCCAACANNCCTCAAGCTGNTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGNATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCANNTGTGNCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGANCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAATGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTT
  3   1   2       bld Ga18      in                      xlk105k24ex.3p                                                                                                                                                                                                                                       AGATGAGGANCCCCNNCTTGCTGGAACATGAGACGATNNNCGAGGCAATCCANNANNCCTCAAGCTNGTTACNTCTTTTNNNAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCANNTGTGCCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAATGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGTGGTGAACAANNCTACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCAGGGGNATTCACGAGAACTGTATATAATACTGTANANNNCTATNTT
  5   1   2       add Tbd7                                 XL103j20.5p                                                                                                                                                                                                                                                       GCTGGAACATGAGACGATGGCCGAGGCAATCCAACAATCCTCAAGCNGGGNACCTCTTTNGGCAAGAGAGTGCCATCCTGATGCAAGAATATNCCTCTGCTCACTCTTTGCACCTATTAGCTTTGATCGGTATATCTTCCCATGTCNCAGTCTGTGNGAGGCTGCAAGGAGCAGCTGTGCCCCTATCATGGCCTGTTATGGGTACCCT
  5  -1   2       bld Bla2                            IMAGE:7299338.5p                                                                                                                                                                                                                                                               CGGTGTGTCAAGAGATTGACCAAATGACAAGTGTTTTACTGGATGGAAGGTCCATGGACTGAGTGCGGGATCCATCTCAGTGTACTCTTGCAGGAGCCTGAGAAAGAAATTTTTAACATTTGCACTTTTGTTGATCGTAATCTCCCAGTGCAGTTGTGGAGGTTAAGAGCAGCTGTGCCCTTCATGGGCTGTTATGGGTACCCTTGGCCGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAATGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGTGGTGAACAATGCCTACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCAGGGGCATTCACGAGAACTGTATATAATACTGTATATATCTATGTTAACTTACTATAAAACCTTATTGGTaaaaaaaaaaaaaaaaaaaaaaaaaaaaTCTCGAGGGGGGGCCCGTACCCAATCCCCTTGTACC
  3   1   2      seed DMZ       in                         xl285e19.3p                                                                                                                                                                                                                                                                 GAGACGATGGCCGAGGCAATCCAACAATCCTCNAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTGCCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGTGGTGAACAATGCCTACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCAGGGGCATTCACGAGAACCTGTATATAATAC
  5   1   2       bld Ga18      in                       xlk62d14ex.5p                                                                                                                                                                                                                                                                                          CAATCCTCAAGCTGGTTACCTCTTTTGGCAAGAGAGTGCCATCCTGATGCAAGAATATTCCTCTGCTCACTCTTTGCACCTATTTGCTTTGATCGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGNNNNCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCANNAGTGNNTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGANCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTNNAAGAGGGGAAGGTAGTGGTGAACAATGCCTACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTNTACGGAAATGGAAGAATCACANGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCA
  3   1   2       chi Ga18      in                       xlk53o11ex.3p                                                                                                                                                                                                                                                                                                                                                       CTGCTCACTCNTNNNNNCTANTTNNNTNGATCGGTATATCNTCCCANGTCGCAGNNNGTNTGANGNNNTANGGAGCANNTGTNCCCCTATCATGNCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACANTGCCCCGANCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATNCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGTGGTGAACAANCCTNCGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGNAGGGGNATTCACGAGAACTGTATATAATACTGTANNNNNTATNT
  5   1   2       bld Tbd7      in                         XL060m02.5p                                                                                                                                                                                                                                                                                                                                                                            GATTTGCTCCAGGTATATCTTCCCATGTCGCAGTCTGTGTGAGGCTGTAAGGAGCAGCTGTGCCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGTGGTGAACAATGCCTACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTA
  3   1   2       bld Ga18      in                       xlk51a23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                         TAANGNNGCANNNGTGCCCNNNTCATNNCCTGNNATGGGTNCCCTTGGCCNTGAGANCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGANCCAGCTGTAGAGACTGTGANCTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATNCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGTGGTGAACAANNCTACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGNAGGGGNATTCNCGAGAACTGTATATAATACTGTANNNNNTAT
  3   1   2       bld Neu7      in                         XL026m11.3p                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAGCAGCTGTGCCCCTATCATGGCCTGTTATGGGTACCCTTGGCCTGAGATCCTCAAATGCGATAAGTTTCCTGAAGACCACGGCATGTGTATCTCAACTATCACAAATGATACTGGCTCTACCCGTAGAACAGTGCCCCGAGCCAGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGTGGTGAACAATGCCTACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCAGGGGCATTCACGAGAACTG
  5   1   2       bld Neu7      in                         XL027f23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACTGGCTCTACCCGTAGAATGCCCCGANCCGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAACAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGTGGTGAACAATGCCTACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCAGGGGCATTCACGAGAACTGTATATAATACTGTATATATCTATGTTAACTTACTATAAAACCTTATTGATAAAAAGAGCGGAGCGGTCTCCTACTGTTTGAGAGGACACCGTGTCATCAGAAAAGGGCAACAGTATATTATGAATAGATCTT
  5   1   2       bld Ga12      in                         XL189o22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCTGTAGAGACTGTGAACTTGAAGAAGGCAGCACTTCCAAGGAGATACTGGATACATTCTGCCATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCCGCTAACCTTTACGACTTTGATTTGGATTCCAAACTTGAGATCCTGAAACACGGCTCGTTGCCCAAAAAAGACGTCCTTCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCGTCTATGTGATTTGTGCAGAAGTGCAAGAGGGGAAGGTAGAGGTGAACAATGCCTACGCATGGCAGAAAAAGAACAAAAACCTGCATTTCGCTGTACGGAAATGGAAGAATCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCAGGGGCATTCACGAGAACTGTATATAATACTGTATATATCTATGTTAACTTACTATAAAACCTTATTGATAAAAAGAAGCGGAGCGGTCTCCTACTGTTTGAGAGGACACCGTGTCATCAGAAAAGGGCAACAGTATATTATGAATAGATCTTTTAAGAAGAGTGGAGGTGGAAAATTGTGGGTTCTCTGGCCCCTGAGGACAATGGCTGTAGCATA
  3   1   2       add Ga18                             rxlk160p01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCNAAAANNNNNNNCCTTNCTANNNTTCAGCAGTGGCTGGATCTGGATNCTNNCTGTGTGCAGAATNTCANGCNNNGGACCNGNACAGGCGTCTATGTGATTTGTGCAGAAGTGNAAGAGGNNNAGGTAGTGGTGAACAANNNNNACGCATGGCAGAAAAAGAACAAAANCCTGCATTTCGCTGTACGGAAATGGAAGANTCACAAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCAGGGGCATTCACGAGAACTGTATATAATACTGTATATATCTATGTTAACTTACTATAAAACCTTATTGATAAAAAGAGCGGAGCGNTCTCCTACTGTTTGAGAGGACACCGTGTCATCAGAAAAGGGCAACAGTATATTATGAATAGATCTTTTAAGAAGAGTGGAGGTGAAATTGTGGGTTCTCTGGCCCCTGAGGACAATGGCTGTAGCATAGGTGATTTCAATTTGACATGGGCTACGTCACCCAGTGCACCCAGTACAACCGGTAGGAATTCAGTGATATTTATAACACAGAATCAGACACGGAGACTCTTTCTAAAAGACACATGGGCTTATTTACTAACATAGCGGCTCAACTGAAATGACCCGATTGGCTGCTTTTAATACAAATACTAATAACTGCATTTGAGCAATTATGTTAGTAAATTAAACCTGCAGTAGTTCTATTGTTTACACCATAGCGAGGAAAGACATTTTCGAAGAACAGAAAAAGCTGCATTTTTTCAAAATATACTGTATANNNNCNTAAAGGGAAACTATTNNCAAAA
  5   1   2       add Ga18      in                      xlk150m18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGTGTCGACCATAGGAATTCCCAATTCGTTGTACAGAAACCAAAGTCCTGTGTTGTGAAATAGTAGAAGCAGNNNNTTCACGAGAACTGTATATAATACTGTATATATCTATGTTAACTTACTATAAAACCTTATTGATAAAAAGAGCGGNNNNCTCCTACTGTTTGAGAGGACACCGTGTCATCAGAAAAGGGCAACAGTATATTATGAATAGATCTTTTAAGAAGAGTGGAGGTGAAATTGTGGGNTCTCTGGCCCCTGAGGACAATGGCTGTAGNATAGGTGATTTCAATTTGACATGGGCTACGTCACCCAGTGCACCCAGTACAACCGGTAGGAATTCAGTGATATTTATAACACAGAATCAGACATGGAGACTCTTTCTAAAAGACACATGGGCTTATTTACTAACATAGCGGCTCAACTGAAATGACCCGATTGGCTGCTTTTAATACAAATACTAATAACTGCATTTGAGCAATTATGTTAGTAAATTAAACCTGCAGTAGTTCTATTGTTTACACCATAGCGAGGAAAGACATTTTCGAAGAACAGAAAAAGCTGCATTTTTTCAAAATATACTGTATATTTTTCTTAAAGGGAAACTGTTGCCAGAATGAAAATTTNATAGAAGCTTCATCATACGGNGATGAGAAANTTTCTAAATGNANTAATTAGANAGAAACGGATGCTGAGAGANGGATAGTGANNNTAAACTTGATNNTT
  5   1   2      ests                              Xl3.1-xlk157c05ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATAAACTTGATTATTTCAGAAATGGTACAGAATATTTAATTGATTGTATTTAGAAANTTTCTCGTTTCAGTATGAGGAAGCTTATATGAAATTTTCATTTTGGTGATAGTTCCCCTTTAGATGAAAAGTCACACAGTACTGTTTAAGTCTGTGTAAAAAAAAGTGGGATATATAAGAGACGTACCTACATGTAGTGACTGCAAAAATCTCTAGTGCACTTATAAATATAAAAATAATGTCATTATATATACTGGGACAGGGATGACGCCACACTAGAGCTTGAACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTACCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCACAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCATGGGGGGCTAAGATCTGTACAATGTGCAGCACATTATCAGATGCTTATGAATATTCAATAAAATGCATTTAAAGGCAAA
                                                  Xl3.1-CHK-1012689321                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGATTATTTCAGAAATGGTACAGAATTTTTAATTGATTGTATTTAGAAAGTTTCTCGTTTCAGTATGAGGAAGCTTATATGAAATTTTCATTTTGGTGATAGTTCCCCTTTAGATGAAAAGTCACACAGTACTGTTTAAGTCTGTGTAAAAAAAAGTGGGATATATAAGAGACGTACCTACATGTAGTGACTGCAAAAATCTCTAGTGCACTTATAAATATAAAAATAATGTCATTATATATACTGGGACAGGGATGACGCCACACTAGAGCTTGAACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTACCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCACAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCATGGGGGGCTAAGATCTGTACAATGTGCAGCACATTATCAGATGCTTATGAATATTCAATAAAATGCATTTAAAGGCAAAAAAAAA
  3   1   2       bld DMZ       in                         xl281d07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAGGACAATGGCTGTAGCATAGGTGATTTCAATTTGACATGGGCTACGTCACCCAGTGCACCCAGTACAACCGGTAGGAATTCAGTGATATTTATAACACAGAATCAGACATGGAGACTCTTTCTAAAAGACACATGGGCTTATTTACTAACATAGCGGCTCAACTGAAATGACCCGATTGGCTGCTTTTAATACAAATACTAATAACTGCATTTGAGCAATTATGTTAGTAAATTAAACCTGCAGTAGTTCTATTGTTTACACCATAGCGAGGAAAGACATTTTCGAAGAACAGAAAAAGCTGCATTTTTTCAAAATATACTGTATATTTTTCTTAAAGGGAAACTGTTGCCAAGGTGAGGGTTTAGTAGAAGCTTCATCATACGGAGGTGAGAAACTTTCTAAATGCAATTAATTAGAAGAGAAACGGATGCTGAGAGAGGGATAGTGAACATAAACTTGATTATTTCAGAAATGGTACAGAATATTTAATTGATTGTATTTAGAAAGTTTCTCGTTTCAGTATGAGGAAGCTTATATGAAATTTTCATTTTGTTGATAGTTCCCCTTTAGATGAAAAGTCACACAGTACTGTTTAAGTCTGTGTAAAAAAAAGTGGGATATATAAGAGACGTACCTACATGTAGTGACTGCAAAAATCTCTAGTGCACTTATAAATATAAAAATAATGTCATTATATATACTGGGACCAGGGATGACGCCACACTAGAGCTGA
  3   1   2       bld Ga18      in                       xlk64g18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGNTGCTNAGAGAGGGATAGTGNNNATNANCTNGATNNTTTCATAAATGGTACAGANTTTTANTTGATTGTATTTAGAAANTTTCTCGTTTCAGTATGAGGANNCTTATGTGAAATTTTCATTTTGGTGATAGTTCCCCTTTAGATGAAAANTCACACAGTACTGTTTAAGTCTGTGTAAAAAAAAGTGGGATATANAAGAGACGTACCTACATGTAGTGACTGNAAAANTCTCTAGTGNACTTATAAATATAAAAATAATGTCATTATATATACTGGGACAGGGATGACGCCACACTAGAGCTTGAACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTACCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCACAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCATGGGGGGCTAAGATCTGTACAATGTNCAGCACNNNNNAGATGCTTANGA
  3   1   2       bld Ga18      in                       xlk69o14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ANNGGGATAGNGAACNNNNNTNGATTNTTTCAGAAATGGTACAGAANNNTTAATTGATTGTATTTAGNAAANTTTCTCATTTCAGTATGAGGAAGCTTATATGAANTTTNCATTTTGGTGATAGTTCCCCTTTAGATGNAAAGTCACACAGTACTGTTTAAGTCTGTGTAAAAAAAAGTGGGATATANAAGAGACGNACCTACATGTAGTGNCTGCAAAANTCTCTAGTGNACTTATAAATATAAAAATAATGTCATTATATATACTGGGACAGGGATGACGCCACACTAGAGCTTGAACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTACCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTAAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCGCAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCACGGGGGGTTAAGATCTGTACAATGNNNNGCACATTATCAGATG
  5   1   2       bld Ga18      in                      xlk156a10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGNNAGTGAACATAAACTTGATTATTTCATAAATGGTACAGAATTTTTAATTGATTGTATTTGGAAAGTTTCTCGTTTCAGTATGAGGAAGCTTATATGGAATTTTCATTTTGGTGATAGTTCCCCTTTAGATGAAAAGTCACACAGTACTGTTTAAGTCTGTGTaaaaaaaaGTGGGATATATAAGAGACGTACCTACATGTAGTGACTGCAAAAATCTCTAGTGCACTTATAAATATAAAAATAATGTCATTATATATACTGGGACAGGGATGACGCCACACTAGAGCTTGAACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTACCAAAGACAGAAGGGTGGCTGAGAGGNCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAgtacttgatccaaactcagatataattaatccttattggaagcagaaccagcctattgggtttatttcatgttttcaCAAGACTTAAGGNATGAAGATCCAAAATTCAGAAATATCCaaaaaaaaaCATTCTGCATAACCGANTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAANAGCCATGAAAGTGAAAGNCCTTAATACCNAAAATAATGACTTAATGATTTNCTATTAGNTAATTNCCCCACAGTCAATACGAGA
  3   1   2      seed Ga18      in                      xlk157c05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TNNTTTCANAAATGGTANNGAATTTTTAATTGATNGTATTTAGAAANTTTCTCATTTCAGTATGAGGAAGCTTATATGAAATTTTCNTTTTGGTGATAGTTCCCCTTNAGATGAAAANTCACACAGTACTGTTTAAGTCTGTGTAAAAAAAAGTGGGATATATAAGAGACGNNNCTACATGTAGTGACTGCAAAANTCTCTAGTGCACTTATAAATATAAAAATAATGTCATTATATATACTGGGACAGGGATGACGCCACACTAGAGCTTGAACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTNCCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCACAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCATGGGGGGCTAAGATCTGTACAATGTNCAGCACNTNNCAGATGCTTA
  3   1   2       bld Ga18      in                      xlk156a10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTNTTTCNNNAATGGTNNNNAATTTTTNNTTGATNNTATTNNNNAAGTTNCTCGTTTCAGTATGAGGAANNNNNTATGGAATTTCATTTTGNTNATANTTCCCCTTTAGATGAAAAGTCACACAGTNCTGTTTAAGTCTGTGTAAAAAAAAGTGGGATATATAAGAGACGTACCTACATGTAGTGACTGCAAAANTCTCTAGTGCACTTATAAATATAAAAATAATGTCATTATATATACTGGGACAGGGATGNCGCCACACTAGAGCTTGAACATACACTGGCNCCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTACCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCACAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCATGGGGGGCTAAGATCTGTACAATGTNCAGCNNNTTTTCAGATGNNTANNAA
  3   1   2       bld Ga18      in                      xlk101m17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGAATTTTCATTTTGTTGATAGTTNCCCCTTTAGATGAAAANTCACACAGTACTGTTTAAGTCTGNGTAAAAAAAAGTGGGATATANNGAGACGNACCTACATGTAGTGACTGCAAAAATCTCTAGTGNACTTATAAATATAAAAATAATGTCATTATATATACTGGGACAGGGATGACGCCACACTAGAGCTTGAACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTACCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCACAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCATGGGGGGCTAAGATCTGTACAATGTNCAGCNNNNNNCAGATGCTTANNA
  5   1   2       bld Ga18      in                      xlk101m17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGAATTTTCATTTTGTTGATAGTTCCCCTTTAGATGAAAAGTCACACAGTACTGTTTAAGTCTGTGTaaaaaaaaGTGGGATATATAAGAGACGTACCTACATGTAGTGACTGCAAAAATCTCTAGTGCACTTATAAATATAAAAATAATGTCATTATATATACTGGGACAGGGATGACGCCACACTAGAGCTTGAACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTACCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAgtacttgatccaaactcagatataattaatccttattggaagcagaaccagcctattgggnttatttcatgttttcaCAAGACTTAAGGNATGAAGATCCAAAANTCAGAAATATCCaaaaaaaaaCATTCTGCATAACCGATTNCATACCTGTACNTNCATACAAACTGTANNNNTGTCTNNGGAAANAGCCATGAAAGTGAAAGTCCTTNNNANCGAAAA
  3   1   2       bld Ga18      in                      xlk165a06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TNNCCNNTnnnnnnnnAAAGTCACnnnGTAnnnnTTAAGTCTGnnnAAAAAAAAGTNGGANNNNNNAGAGNCGNACCNNCATGTAGTGNCTGCAAAAATCTCTAGNGNNCTTATAAATATAAAAATAATGTCATTATATATACTGGGACAGGGATGNCNCCACACTAGAGCTNGAACATACACTGNCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTACCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTAAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCGCAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCACGGGGGGTTAAGATCTGTACAATGTNCANCNNATTNNCAGATGCTTA
  3   1   2       bld Ga18      in                       xlk53m03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAAAAAANNNGGNNNTNNNNAGNCGTACCTACATGTAGTGNCTGNAAAAATCNCTAGTGNNCTTANNATATAAAAATAATGTCNTTATATATACTGGGACAGGGATGNCNCCACACTAGAGCTTGAACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTACCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCACAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCATGGGGGGCTAAGATCTGTACAATGTNCAGNNNNTTCAGANNC
  3   1   2       bld Ga18      in                      xlk123m02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGNNGTACCTACATGTAGTGNCTGCAAAATCTCTAGNGNNCTNATAAATATAAAAAAAATGTCNNNTATATNCTGGGACAGGGATGNCGCCACNCTAGAGCTTGAACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGNNTAGCTTCCCCGTGACTACAGTGNCTNCCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAANCTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCANTTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACTCCACAGTCAATACAAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCACGGGGGGTTAAGATCTGTACAATGTNCANNNNATTNTCAGATGCTTANNA
  3   1   2       bld Ga18      in                      xlk150m18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGNACCTACATGTAGTGNCTGNAAAATCNNTAGTGNACTNATAANNNTAAAAATAATGTCNNTANATATACNGGGACAGGGATGACNCCACACTAGAGCTNGNACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTNCCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGNCTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCACAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCATGGGGGGCTAAGATCTGTACAATGTNCANNNNNTTCAGATNC
  3   1   2       bld Ga18      in                       xlk62d14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ANNNNAAAAAAAATGTCNTNATANANNCTGGNACAGGGATGNCNNNNNCTAGAGCTNGANCATANNCTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGNCNACAGTGACTNCCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTNAGTGTAATGTGAAAAANCTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAANCCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACTCCACAGTCAATACAAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCACGGGGGGTTAAGATCTGTACAATGTGCAGCNCATTNTCAGATGCT
  3   1   2       bld Ga18      in                        xlk7m13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGNNNNGGGATGNNNNCCNNNCNNAGAGCNNGANCANACNNNGCACCCAATNAAAGATGAANTAATAAAGCAGTGAGNATAGCTTCCCCGTGNCTACAGTGNCTNCCAAAGACAGAAGGGTGGCTGAGAGGGCAATGNAATTATATTTTAGTGTAATGTGAAAAANCTGGGGAAGGGANGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGNTCCGTTATCTGTAANCCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCACAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCATGGGGGGCTAAGATCTGTACAATGTNCAGCNCNNNTCAGATGCTT
  3   1   2       bld Emb9      in                    IMAGE:7975754.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGGATGACGCCACACTAGAGCTTGAACATACACTGGCACCCAATAAAAGATGAAATAATAAAGCAGTGAGAATAGCTTCCCCGTGACTACAGTGACTACCAAAGACAGAAGGGTGGCTGAGAGGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACTCCACAGTCAATACAAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCACGGGGGGTTAAGATCTGTACAATGCGCAGCACATCTCAGAGCCTNG
  3   1   2       bld Tbd7      in                         XL060m02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGCAATGTAATTATATTTTAGTGTAATGTGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCACAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCATGGGGGGCTAAGATCTGTACAATGTGCAGCACATTTTCAGAGNCTTANNAATATTCAATAAAA
  3   1   2       bld Ga12      in                         XL189o22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAAAAAACTGGGGAAGGGAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACCCCACAGTCAATACGAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCATGGGGGGCTAAGATCTGTACAATGTGCAGCACATTTTCAGATGCTTATGAATAT
  3   1   2       bld Neu7      in                         XL027f23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAGCTTTTGCTATTCTGCTCAGCTATCTGGGCAATTTTATTTATAGGGTATATGTCCCCTTTAATTAGTACAGGTATGGGATCCGTTATCTGTAAACCCGTTATCCAGAAAATTCTGAATTACAGAAAGGCCATCTCTCATAGACTCCATTTTATTCAAATAATCCAAATTTTTAAAAATGATTTCCTTTTTCTCAAGTACTTGATCCAAACTCAGATATAATTAATCCTTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATGTTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACTCCACAGTCAATACAAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCACGGGGGGTTAAGATCTGTACAATGTGCAGCACATTATCAGATGNCTTANAATATTCAATAAAA
  3   1   2       bld Ga12      in                         XL194f15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTATTGGAAGCAGAACCAGCCTATTGGGTTTATTTCATATTTTCACAAGACTTAAGGTATGAAGATCCAAAATTCAGAAATATCCAAAAAAAAACATTCTGCATAACCGATTCCATACCTGTACTTCCATACAAACTGTAATTCTGTCTTTGGGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACTCCACAGTCAATACAAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCACGGGGGGTTAAGATCTGTACAATGTGCAGCACATTATCAGATGC
  3   1   2       add Ga18      in                        xlk4m17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAAACAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACTCCACAGTCAATACAAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCACGGGGGGTTAAGATCTGTACAATGTNCAGCACANTNNCAGANGCTTATG
  5   1   2       bld Ga18      in                        xlk4m17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAAANAGCCATGAAAGTGAAAGTCCTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACTCCACAGTCAATACAAGAGCACTGTTGGTTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGTCACGGGGGGTTAAGATCTGTACAATGTGCAGCACATTATCAGATGCTTATGAATATTCAATAAAATGCATTTAAAGGCaaaaaaaaaa
  5   1   2       bld Ga18                                xlk4l17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTAATACCGAAAATAATGACTTAATGATTTGCTATTAGTTAATTACTCCACAGTCAATACAAGAGCNCTGTTGGNTAAATAGCAATCTTAGTGGAATGTAAAATATTTAAGGGGGNCACGGGGGGNTAAGATCTGTACAATGTGCAGCACATTATCAGATGCTTATGAATATTCNATAAAATGCATTTAAAGGCaaaaaaaaaa
  5  -1   2      3-95                                 Xl3.1-XL057f10.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTGGCTCTCTGCCCTTTTTTTTTTAANAAACATCACAGGAANGTGATTTAGGCTGTCGTTTGCAGAAATATTACCGAAACGATTCANTGACTTGGGTCCTCAAAGAAATAAAAGTCACTTTTTTTTAAAGACCTTGACAGGTTTTATATCTTTAGCCTAAGAGTAAANGCCCCAACAAG------------TAAAGCGTGTCCNGATAAAGTTTTNGTATTTTTTTCCTTGCTGCTTGANCAATTCTTGTAGGAACTCACATTTTTGGCTTTGNT------------ACNCACCCTTGGACNGGGGTGAACTATGAGTATGTCTTCCCAATTTACATTCTATTTTTGAAATTGCATTTACTTTAGAAGNGCTCATACAGGTTATTTCCTTTTTTAGGTTTTATCTCTGGGACAAANGATAAAAAAGAAGATCCATCTACAAAGACGACTGCATTTTGTGTAACTATTTTCACACTTTGGCCTTTCTGCCGGTTGGAAATAATTGATAAGTGAACTGCGGCAAGATGTGAACACATTAAGAAAATGTGTTTAAAACGAAGTGTGATTTCCTTTCTTTCCCTCAAGTTTAGCCATTTAAGGATTTACAAAATTAAAAGAGACATATTTCCACCCGTATAGACCTGCAGCAGAAACGTACACATTTCATTTCTATCTAACCCCCCTCTTCTGGACACAATGGTACTCCTGGTACACATTCATAATACAGGTATAAAATCTGTTATCCAGAAACCCGTTATCCAGAAAGCCCCTAATTACAGAATGGCCATCTCCCATAGACTCCATTTTATCCAAATAATCCAAACCTTTAAAAATGATTTCCTTTTTCGCTGTAATAATTAAACAGTACATTGTACTTGATCCAAACTAAGATATAATTAATCCTTATTGGAAGCAAAACCAGCCTATTGGGTTTATTTCATGTTTACATGATTTTCTAGCAGGCCCGGACTGGCAATCTGTGGATTCTGGCAATTTGCCATAGACAGTCACTATATATTGGGCCGTGGGGGGCTGTTTGGGCTGCTGTGTGGCCTGTTTGGGCCTCTGTGTACCTGAAATACCGGGGCCTATTTTGAATCTCAGGCCATGCCTGTTTTCAGAAAACGGGCATGGAGTGGGATTATAAAGATCCAAATTATGAAATGATCCGTTATCCGGAAAACCCCAGGTTCCGAGCAT
                                                  Xl3.1-CHK-1012710826                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTCTGCCCTTTTTTTTTTAANAAACATCACAGGAANGTGATTTAGGCTGTCGTTTGCAGAAATATTACCGAAACGATTCANTGACTTGGGTCCTCAAAGAAATAAAAGTCACTTTTTTTTAAAGACCTTGACAGGTTTTATATCTTTAGCCTAAGAGTAAANGCCCCAACAAGCACNAANCGTGTTAAAGCGTGTCCNGATAAAGTTTTNGTATTTTTTTCCTTGCTGCTTGANCAATTCTTGTAGGAACTCACATTTTTGGCTTTGNTGTCGTT------------CCTTGGACNGGGGTGAACTATGAGTATGTCTTCCCAATTTACATTCTATTTTTGAAATTGCATTTACTTTAGAAGNGCTCATACAGGTTATTTCCTTTTTTAGGTTTTATCTCTGGGACAxxAxAxAAAAxAGAAGATCCATCTACAAAGACGACTGCATTTTGTGTAACTATTTTCACACTTTGGCCTTTCTGCCGGTTGGAAATAATTGATAAGTGAACTGCGGCAAGATGTGAACACATTAAGAAAATGTGTTTAAAACGAAGTGTGATTTCCTTTCTTTCCCTCAAGTTTAGCCATTTAAGGATTTACAAAATTAAAAGAGACATATTTCCACCCGTATAGACCTGCAGCAGAAACGTACACATTTCATTTCTATCTAACCCCCCTCTTCTGGACACAATGGTACTCCTGGTACACATTCATAATACAGGTATAAAATCTGTTATCCAGAAACCCGTTATCCAGAAAGCCCCTAATTACAGAATGGCCATCTCCCATAGACTCCATTTTATCCAAATAATCCAAACCTTTAAAAATGATTTCCTTTTTCGCTGTAATAATTAAACAGTACATTGTACTTGATCCAAACTAAGATATAATTAATCCTTATTGGAAGCAAAACCAGCCTATTGGGTTTATTTCATGTTTACATGATTTTCTAGCAGGCCCGGACTGGCAATCTGTGGATTCTGGCAATTTGCCATAGACAGTCACTATATATTGGGCCGTGGGGGGCTGTTTGGGCTGCTGTGTGGCCTGTTTGGGCCTCTGTGTACCTGAAATACCGGGGCCTATTTTGAATCTCAGGCCATGCCTGTTTTCAGAAAACGGGCATGGAGTGGGATTATAAAGATCCAAATTATGAAATGATCCGTTATCCGGAAAACCCCAGGTTCC
  3  -1   2       bld DMZ  5g3  out                        xl313g17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGCACTCTGGCTCTCTGCCCTTTTTTTTTTAANAAACATCACAGGAANGTGATTTAGGCTGTCGTTTGCAGAAATATTACCGAAACGATTCANTGACTTGGGTCCTCAAAGAAATAAAAGTCACTTTTTTTTAAAGACCTTGACAGGTTTTATATCTTTAGCCTAAGAGTAAANGCCCCAACAAGCACNAANCGTGTTAAAGCGTGTCCNGATAAAGTTTTNGTATTTTTTTCCTTGCTGCTTGANCAATTCTTGTAGGAACTCACATTTTTGGCTTTGNTGTCGTTANGNATACNCACCCTTGGACNGGGGTGAACTATGAGTATGTCTTCCCAATTTACATTCTATTTTTGAAATTGCATTTACTTTAGAAGNGCTCATACAGGTTATTTCCTTTTTTAGGTTTTATCTCTGGGACAAANGATAAAAAAGAAGATCCATCTACAAAGACGACTGCATTTTGTGTAACTATTTTCACACTTTGGCCTTTCTGCCGGTTGGAAATAATTGATAAGTGAACTGCGGCAAGATGTGAACACATTAAGAAAATGTGTTTAAAACNAAGTGTGATTTCCTTTCTTTCCCTCANG
  3  -1   2      seed Tbd7                                 XL057f10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGATAAAAAAGAAGCATCCATCTACAAAGGACGACTGCATTTTGTGTAACTATTTTCACACTTTGGCCTTTCTGCCGGTTGGAAATAATTGATAAGTGAACTGCGGCAAGATGTGAACACATTAAGAAAATGTGTTTAAAACGAAGTGTGATTTCCTTTCTTTCCCTCAAGTTTAGCCATTTAAGGATTTACAAAATTAAAAGAGACATATTTCCACCCGTATAGACCTGCAGCAGAAACGTACACATTTCATTTCTATCTAACCCCCCTCTTCTGGACACAATGGTACTCCTGGTACACATTCATAATACAGGTATACAATCTGTTATCCAGAAACCCGTTATCCAGAAAGCCCCTAATTACAGAATGGCCATCTCCCATAGACTCCATTTTATCCAAATAATCCAAACCTTTAAAAATGATTTCCTTTTTCGCTGTAATAATTAAACAGTACATTGTACTTGATCCAAACTAAGATATAATTAATCCTTATTGGAAGCAAAACCAGCCTATTGGGTTTATTTCATGTTTACATGATTTTCT
  5  -1   2       bld Ga12      ?                          XL188c12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TNGGAAATAATTGATAAGTGAACTGCGGCAAGATGTGAACACATTAAGAAAATGTGTTTAAAACGAAGTGTGATTTCCTTTCTTTCCCTCAAGTTTAGCCATTTAAGGATTTACAAAATTAAAAGAGACATATATCCACCCGTATAGACCTGCAGCAGAAATGTACACATTTCATTTCTATCTAACCCCCCTCTTCTGGACACAATGGTACTCCTGGTACACATTCATAATACAGGTATAAAATCTGTTATCCAGAAACCCGTTATCCAGAAAGCCCCTAATTACAGAATGGCCatctcccatagactccattttatccaaataatccaaacctttaaaaatgatttcctttttcgctgtaataattaaacagtacattgtacttgatccaaactaagatataattaatccttattggaagcaaaaccagcctattgggtttatttcatgtttacatgattttctagcagGCCCGGACTGGCAATCTGTGGATTCTGGCAATTTGCCATAGACAGTCACTATATATTGGGCCGTGGGGGGCTGTTTGGGCTGCTGTGTGGCCTGTTTGGGCCTCTGTGTACCTGAAATACCGGGGCCTATTTTGAATCTCAGGCCATGCCTGTTTTCAGAAAACGGGCATGGAGTGGGATTATAAAGATCCAAATTATGAAATGATCCGTTATCCGGAAAACCCCAGGTTCCGAGCAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)