Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL520d19ex.5                         12 END     1           2        8                CCR4-NOT transcription complex, subunit 8 [Xenopus laevis]
     2   2.0    0Xl3.1-IMAGE:8074520.3                      10 END     5          12       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:7009540.5                       4 PI      88       1282     1440                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012837930 Xl3.1-IMAGE:6958083.5.5 - 41 ESTs
                                                                       ........-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6958083.5.5                                                                                                                                                                                                                                                                                                                                                             TAAATATGCGAGCGCAGGGGCTGCTAGGGAGCTGCAGAGCTGGGAGGTTGTATGTCCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTCACACACACACGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAAATTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGGAAAAAACAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTTGCTCATACCAGTGAACACTTTCCCTCGTATTTTCCTCTATCATCCAACTTGATTTAATTTCTTACCTTTATTTTTCGTTGTTGTGGAGAATTATGGAAATGCGGAAGAGTTACATATACAATGTACATGGGGGGGGGCAGTTTAGAGGGCTAAAGAGAGAAGAAAATGCTGTAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTGCATAATGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATAGAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTACTGTAATTATGAAGTATTTTTAATTAAATATTTTGTGTAAATATAAATTTGTGTTTTTTTTTTTTAATCTCCTGGGGGTTCCATTCCTATTTGGATAAGAAAATATACAGCGATCTATCAAGAATT
                                                  Xl3.1-CHK-1012721874                                                                                                                                                                                                                                                                                                                                                                   TGCGAGCGCAGGGGCTGCTAGGGAGCTGCAGAGCTGGGAGGTTGTATGTCCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTCACACACACACGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAAATTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGGAAAAAGCAACGTACACATCACTTTCTTACACCACGAAxAAxxxAxxxxTATGCCATTTGCTCATACCAGTGAACACTTTCCCTCGTATTTTCCTCTATCATCCAACTTGATTTAATTTCTTxxxTTTATTTTTCGTTGTTGTGGAGAATTATGGAAATGCGGAAGAGTTACATATACAATGTACATGGGGGGGGGCAGTTTAGAGGGCTAAAGAGAGAAGAAAATGCTGTAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTGCATAATGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATAGAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTACTGTAATTATGAAGTATTTTTAATTAAATATTTTGTGTAAATATAAATTTGTGTTTTTTTTTTTTAATCTCCTGGGGGTTCCATTCCTATTTGGATAAGAAAATATACAGCGATCTATCAAGAATTTGTTAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                  2     3     3     3     4     4     4     8     7    14     9    19     9    21     9    22     9    22     9    22    10    22    10    22    10    22    10    22    10    22    10    21    10    21    10    22     9    21     9    21     9    21     9    21     9    21     9    21     9    21     9    21     9    21     9    22    20    22    22    23    22    23    22    23    22    23    22    23    22    23    22    23    23    23    24    26    24    26    24    26    24    26    24    27    26    28    26    28    26    28    25    29    24    28    23    28    24    28    24    28    24    27    24    27    21    26    20    26    24    26    20    26    20    27    19    25    21    27    20    27    17    28    16    25    15    25    14    25    15    25    14    25    14    24    12    24    12    23    12    22    10    21     9    21     4    19     4    21     4    21     5    19     5    18     5    17     5    16     5    16     5    16     5    15     5    16     5    16     5    16     5    16     5    16     5    15     5    14     5    14     5    14     5    14     5    14     5    14     6    15     6    15    10    15     9    14     9    14     9    14     9    14     9    14     8    12     8    11     8    11     8    11     8     9     8     8     8     8     7     8     7     7     7     7     6     6     4     5     3     5     4     4     4     4     4     4     4     4     3     3
  5   1   2       e50                            Xl3.1-IMAGE:6958083.5                                                                                                                                                                                                                                                                                                                                                             TAAATATGCGAGCGCAGGGGCTGCTAGGGAGCTGCAGAGCTGGGAGGTTGTATGTCCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTCACACACACACGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAAATTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGGAAAAAACAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTTGCTCATACCAGTGAACACTTTCCCTCGTATTTTCCTCTATCATCCAACTTGATTTAATTTCTTACCTTTTTTTGTTTGTTGTGAAGAATTATGGAAATGCGGAAGAGTCAGATATACAATGTACCTGGGAGGGGGCAGTTTAGAGGGCTAGAGAGAGAGAGAGAATATGCTATAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATAATTTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTACATATTGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATATAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTACTGTAATTATGAAGTATTTTTAATTAAATATTTTGTGTAAAT
  5   1   2       e50                            Xl3.1-IMAGE:7765095.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCAGAGCCAGAGAGGAGAGAGACCAAATTAGAGAATAAGGGAGGGGAAAGGAAAAGCAGACAAAAGAGGGGAAAAAAAGCAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTCGCTCATACCACTGAACACTTTCCCTCTTTTTTTATTTTTCGTTGTTGTGGAGAATTATGGAAATGCGGAAGAGTTACATATACAATGTACATGGGGGGGGGCAGTTTAGAGGGCTAAAGAGAGAAGAAAATGCTGTAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTGCATAATGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATAGAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTACTGTAATTATGAAGTATTTTTAATTAAATATTTTGTGTAAATATAAATTTGTGTTTTTTTTTTTTAATCTCCTGGGGGTTCCATTCCTATTTGGATAAGAAAATATACAGCGATCTATCAAGAATTTGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                             TCCGGCTGACTGATAGGATCCTGCTGTCCCTGCCATTACTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTTACCCAAGCAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCCCCTTATCTAGAAAGAAGAAGCGGCACCTGTATCTTCCCCCACTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGCACAACACACGCAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAACGTACACAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGAAGAATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTATTTTTCGTTGTTGTGGAGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCTCTTTTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAAGAGTTACA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----A-----G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----A----T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-------
                                               BLH ATG     362     412                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MIN     362      45                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MPR     362      45                                                                                                                                                                                                                                                                                                                                                             
                                               BLH OVR     362     340                                                                                                                                                                                                                                                                                                                                                             
                                               CDS MIN     362      45                                                                                                                                                                                                                                                                                                                                                             
                                               EST CLI      34      28                                                                                                                                                                                                                                                                                                                                                             
                                               ORF LNG     362       5                                                                                                                                                                                                                                                                                                                                                             
  5   1   2       e50                            Xl3.1-IMAGE:6958083.5                                                                                                                                                                                                                                                                                                                                                             TAAATATGCGAGCGCAGGGGCTGCTAGGGAGCTGCAGAGCTGGGAGGTTGTATGTCCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTCACACACACACGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAAATTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGGAAAAAACAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTTGCTCATACCAGTGAACACTTTCCCTCGTATTTTCCTCTATCATCCAACTTGATTTAATTTCTTACCTTTTTTTGTTTGTTGTGAAGAATTATGGAAATGCGGAAGAGTCAGATATACAATGTACCTGGGAGGGGGCAGTTTAGAGGGCTAGAGAGAGAGAGAGAATATGCTATAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATAATTTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTACATATTGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATATAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTACTGTAATTATGAAGTATTTTTAATTAAATATTTTGTGTAAAT
                                                  Xl3.1-CHK-1012687482                                                                                                                                                                                                                                                                                                                                                                   TGCGAGCGCAGGGGCTGCTAGGGAGCTGCAGAGCTGGGAGGTTGTATGTCCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTCACACACACACGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAAATTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGGAAAAAGCAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTTGCTCATACCAGTGAACACTTTCCCTCGTATTTTCCTCTATCATCCAACTTGATTTAATTTCTTACCTTTTTTTGTTTGTTGTGAAGAATTATGGAAATGCGGAAGAGTCAGATATACAATGTACCTGGGAGGGGGCAGTTTAGAGGGCTAGAGAGAGAGAGAGAATATGCTATAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATAATTTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTACATATTGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATATAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTACTGTAATTATGAAGTATTTTTAATTAAATATTTTGT
  3  -1   2       bld Tbd7      in                         XL055l23.3p ATTTATTGCATNAAGTGGGTTGACAGCATTGCAGCTAATAACGCACACACATACATATAGTATTAGATTTGTGATGGATCCATAATGACATAAATCACCCATTTGCTACAGGGAGAGTAAATGACAGGCTAGGATGCATTCCCTGTATTCTTCTTTAGACACTTTACAGGTATAGTGATAAGGCTGGGGCTGCTGTGAGCTGATTATACAAAATGCATGGTGTGTGTCCAGTGAGATAGAGATGAAACTTGGGAAAAGTCAGGCTCCTTCTGTACTTGACTCCTCCCCACGTTGTCACTCCTCCCCCCTCCCTGTCCTTTCACCCTCCCCTGCTCCGTGCCTGTTCCATAAATATGCGAGCGCAGGGGCTGCTAGGGAGCTGCAGAGCTGGGAGGTTGTATGTCCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGNTCAGTCGCACGGTAGACAGTCGCTGACTCACACACACAC
  5   1   2       bld Int2 5x3                        IMAGE:8824162.5p                                                                                                                                                                                                                                                                                                                                     CCGGGACATCATAGCCAGTGTGATCCGATTCGTCCCCACAGGGGCTGCTAGGGAGCTGCAGAGCTGGGAGGTTGTATGTCCAGCTGACTGATAGGATCCTGCTGTTCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTCACACACACACGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTCGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCATGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGACAAGCAGGAGACAGTATATTGTGCCGTTGACCATTTTTGAGTGTGCAGCAGCGAATCCAGAGCAGAGAGAAAGAGACCAATTAGAGAATATGAGGGAGAAAGCGACAAAGAGGGTAAAAGCACGTACATCACTTTCTTACCCCCGGAGA
  5  -1   2       bld Tbd7      in                         XL055l23.5p                                                                                                                                                                                                                                                                                                                                                     CTGTTCCATAAATATGCGAGCGCAGGGGCTGCTAGGGAGCTGCAGAGCTGGGAGGTTGTATGTCCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTCACACACACACGAGGCTCCAGGTATTTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCACGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCACCTCGTGCCGAATTNCCTGC
  5   1   2       bld Brn2                             Brn2-za48c06.5p                                                                                                                                                                                                                                                                                                                                                                          tttttttggttttttGAGCTGCAGAGCTGGGAGGTTGCATGTCCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTA
  5   1   2       bld FaBN 5g3  out                   IMAGE:8074520.5p                                                                                                                                                                                                                                                                                                                                                                                           GAGCTGTGAGGTTGCATGTCCGGCTGACTGATAGGATCCTGCTGTCCCTGCCATTACTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTTACCCAAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCTTATCTAGAAAGAAGAAGCGGCACCTGTATCTTCCCCCACTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGCACAACACACGCACACACGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGGCTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGTTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCTACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAGCAAGGAGACAGTATTTTGTGCCCGTAACCATTTTTGAGGTGTGCAGCAGGCGAATCAGAGCCAGAAGAGGAAGAGACAATTAGAGAATAAGGAAGGGAAG
  5  -1   2       bld Brn2                             Brn2-za20c03.5p                                                                                                                                                                                                                                                                                                                                                                                               TGGGAGGTTGTATGTCCGGCTGACTGATAGGATCCTGCTGTCCCTGCCATTACTATCTGCAGAGCTGCCTTCCTGTCATTCGGCTTGAGTGCCCTGTTTACCCAAGCAAATCATGCTTTGTCGCAGCCACAACGGCCTAATAAGAATA
  5   1   2       bld Tbd5 5g                         IMAGE:3580163.5p                                                                                                                                                                                                                                                                                                                                                                                               GAGCTGGGAGGTTGTATGTCCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTcacacacacacacGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTAGCACTAGACACACACCCAGTGCTGCTCAAGCAACAGTCACCAACCCAGACCCCTCTT
  5   1   2       bld Emb4 5x3                        IMAGE:5570822.5p                                                                                                                                                                                                                                                                                                                                                                                                 TGAGGTTGCATGTCCGGCTGACTGATAGGATCCTGCTGTCCCTGCCATTACTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTTACCCAAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCTTATCTAGAAAGAAGAAGCGGCACCTGTATCTTCCCCCACTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGCACAACACACGCACACACGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGGCTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGTTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCTACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCCTTAGTGGTGAACAAGCAAGGAGAACAGTATTTTGTGCCGTTAAACCATTTTTTTGAGGGTGTGCAGCAAGGCGAAATCCAGAGCCCAGAAAGAGGGAGGAGAGACCAATTTTGAGNAAAATaaggggggaagggggaagggaaaaaggcagacaaaaaggaaggggaaaaaaaaGCAAACCGTACCCCCATTCACTTGTTCTTTAACCCCCG
  5   1   2       bld Emb4 5x                         IMAGE:4680370.5p                                                                                                                                                                                                                                                                                                                                                                                                    CCCACGCGTCCGGTCCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTcacacacacacacGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGAA
  5   1   2       bld Emb4 5x3                        IMAGE:5542811.5p                                                                                                                                                                                                                                                                                                                                                                                                       GGAGGTTGTATGTCCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTcacacacacacaAGGCTCCAGGTATTTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGGCGTTGAACCATTTTTGAGGTGTGCAGGCAGGCGAATTCAGAAGCCAGAAGAGGAAGAAAGACAAATTAGagaaaataggggagggggaaaggaaaagccagaaaaaaaaagggggaaaaaaaaGGCAACCGGAACACCATCCACTTTTC
  5   1   2       bld Emb4 5x3                        IMAGE:5440325.5p                                                                                                                                                                                                                                                                                                                                                                                                       TGCATGTCCGGCTGACTGATAGGATCCTGCTGTCCCTGCCATTACTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTTACCCAAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCTTATCTAGAAAGAAGAAGCGGCACCTGTATCTTCCCCCACTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGCACAACACACGCACACACGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGGCTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGTTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCTACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAAACAGCAGGAGACAGTATTTTGTGCCCGTAACCATTTTTTGAGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAAGAGAGAGACAANTTAGAGAAATNANGGNAGGGGAANGGAAAGCAGACNNAAGAGG
  5   1   2      seed DMZ  5g3  in                         xl307i24.5p                                                                                                                                                                                                                                                                                                                                                                                                       GGAGGTTGTATGTCCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTCACACACACACGAGGCTCCAGGTATTTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGCCTGCCTTAGTGGTGAACAAGCAAGGA
  5   1   2       bld Te2N      in                    IMAGE:7765095.5p                                                                                                                                                                                                                                                                                                                                                                                                        GAGGTTGTATGTCCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTCACACACACACGAGGCTCCAGGTATTTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCACGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCAGGACCCTCTTACGGACCTCATACTGACCCGGCTGGCTTAGTGGTGAACAGCAAGAGACAGTA
  5   1   2       bld Eye1      in                    IMAGE:6957107.5p                                                                                                                                                                                                                                                                                                                                                                                                          TTGTATGTCCAGCTGACTGATAGCATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTcacacacacacacGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCCACCACCCAGGACCCCTCTTACGGAACCTAATACTTGACCCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGAACGTATAATGTGCCGGTTGAACCCTTTTTTGAAGGGTGCCCCATGCGAAATCCCTAGCCCGTAAAAGGAGATAGACCAATTCTGAGAAATAAGGGTAGGGgaaaggaaaaatcaaccaaaaatggggaaaaaaaaGCTACGGTACACTCCTTTTTCTTTAATCCCACCaaaaaaaaTTATTCCAAGAGCCATTTCGCATCAA
  5   1   2       bld Eye1 5x3                        IMAGE:6958083.5p                                                                                                                                                                                                                                                                                                                                                                                                              GTATGTCCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTCACACACACACGAGGCTCCAGGTATTTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCCGAAGAGGAGAGAGACAAATTAGagaaataagggaaggggagggaaaagcagacnaaaagagggggaaaaaaaaGCAAACGTACACATTCACTTTTTCTTACAACCACGA
  5   1   2       bld FaBN 5x3                        IMAGE:8078330.5p                                                                                                                                                                                                                                                                                                                                                                                                                   GTCAGCTGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTCACACACACACGAGGCTCCAGGTATTTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCACGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGCCGTTTGAACATTTTTGANGTGTGCAGCAGGCGAATCCAGAGC
  5   1   2       bld Eye1 5g3  in                    IMAGE:6949080.5p                                                                                                                                                                                                                                                                                                                                                                                                                    GAATTCTCGGGATGATCCTGCTGTCCCTGCCATTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTcacacacacacacGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATTTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCCAGCAGGCGAATCCAGAGCCCGAAGAGGAGAGAGACAAATTAGagaaataagggaggggaaagaaaagccgacaaaagaggggaaaaaaaaGCAACGTACACATTCACTTTCTTACACCCACGAAAATATATTCCCTATGGCCATTTCGA
  5   1   2       bld Tbd7      in                         XL075m06.5p                                                                                                                                                                                                                                                                                                                                                                                                                        TGACTGATAGGATCCTGCTGTCCCTGCCTTATTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTcacacacacacacGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAA
  5   1   2       bld Tbd7 5g3  in                         XL063p21.5p                                                                                                                                                                                                                                                                                                                                                                                                                         GATAGGATCCTGCTGTCCCTGCCTTACTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTTACCCAAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCTTATCTAGAAAGAAGAAGCGGCACCTGTATCTTCCCCCACTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCGGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGCACAACACACGCACACACGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGGCTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTT
  5   1   2       bld Ga18      in                       xlk78l15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                           TGACTGATAGGATCCTGCTGTCCCTGCCATTATTATCTGCNGANNNCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGNCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTCACACACACACGAGGCTCCAGGTATTTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGNNNNNNGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCACGTTATTGACTATATCTTGGATCTGCAGTTGGNGCTAGNNACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAANAAGCAAGGAGACAGTATATTGTGCCNNTGAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGNNANNTAGAGAANNAANGGNGGGGNAG
  5   1   2       bld Tbd7 5g3  in                         XL059p14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGCCTGCTGTCCCTGCCTTATTATCTGCAGAGCTGCCTTCCTGTCTTCCGCCTGAGTGCCCTGTTATCCCGAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCCTTATCTAGAAAGAAGCGGCACCTGTATCTTCCCCCAGTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGACTCACACACACACGAGGCTCCAGGTATTTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCACGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAG
  5   1   2       bld Neu7 5g3  out                        XL040c08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCTGCCTTACTATCTGCAGAGCTGCCTTCCTGTCATTCCGCCTGAGTGCCCTGTTTACCCAAGCAAACAGCTGCTTTGTAGCAGCCACAACGAGCCTAATAAGGAATTGCATTTGCCAAGCAGTTGGTGCCCCTTATCTAGAAAGAAGAAGCGGCACCTGTATCTTCCCCCACTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCTGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGCACAACACACGCACACACGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGGCTCGTGCCCACCATTCCA
  5   1   2       bld Tbd7 5g3  out                        XL069a24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGCAGTTGGTGCCCCTTATCTAGAAAGAAGAAGCGGCACCTGTATCTTCCCCCACTGTCTCTGCGTTGGATTGACAGTCGCATGGTCTATTTCGGTTGCTGTTCAGTCGCACGGTAGACAGTCGCTGCACAACACACGCACACACGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGGCTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGTTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCTACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATTTTGTGCCGTTAAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAAATTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGA
  5   1   2       bld Emb3 5g3  out                   IMAGE:3399628.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGCTGCACAACACACGCACACACGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTTCAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGGCTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGTTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCTACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATTTTGTGCCGTTAAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAAATTAGAGAAATA
  5   1   2       bld Eye1 5x3                        IMAGE:6947517.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTCGAGGCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGGCTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGTTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCTACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATTTTGTGCCGTTAAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAAATTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGAAAAAAGCAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTTGCTCATACCAGTGAACACTTTCCCTCGTATTTTCCTCTATCATCCCACTTGATTTTATTTCTTACCttttttttGTTGTTGGGAAAAATTATGGGAATGCGGAAAGAATCAAATATACAATGTTACCTGGGAGGGGGGCAGTTTATAAGGGCTCCATACaaaaaaaaaaaaaaTGCCAATATTAAGAAAGAAACTGAATTATTAGAAACTTTTTAACTAGTATTACCAATAAGCCTTTTGTGAAAAATAACTTTTTCTTGCTACCTCCCGAATTGGTTTCTAAAAGCTACACTCGAGTTTTTTATTCTGGAGGCTTTCGAGGGAAA
  5   1   2       bld Emb3 5x3               IMAGE:3399628-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTCCAGGTATCTGCTGCCATGAAAGCTGTCAGTCCAGTGCGCCCGCAGAGTCGGAAAGCCCAAGTGCCGTCTGTGTGCGGGGAGCTGGCGCTGCATTGCCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTTCAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGGCTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGTTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCTACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATTTTGTGCCGTTAAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCcagaagaggagagagacaaattagagaaataagggaggggaaggaaaagcagacaaaagagGGAAAAAAGCAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTTGCTCATACCAGTGAACACTTTCCCTCGTATTTTCCTCTATCATCCAACTTGATTTAATTTCTTACCTTTTTTTGTTTGTTGTGAAGAATTATGGAAATGCGGAAGAGTCAGATATACAATGTACCTGGGAGGGGGCAGTTTAGAGGGCTagagagagagagagaATATGCTATAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATAAttttttttACATCTATTGTTTAA
  5   1   2       bld Ga18      in                       xlk62f18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTNNCTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCACGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGANACGCACCCAGTGNTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCAGCAGNNGAATCCAgagccagaagaggagagagacaaattagagaaataagggaggggaaggaaaagcagacaaaagaggggaaaaaaaaGCAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTCGCTCATACCACTGAACACTTTCCCTCtttttttatttttCGTTGTTGTGGAGAATTATGGAAATGCGGAAGAGTTACATATACAATGTACATggggggggggNAGNTTAGAGGGCTAAAGAGAGAAG
  3   1   2       bld Eye1 5g3  in                    IMAGE:6949080.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTTTGAGGCACAGCCTCGGGGGTAGCTCGGTACAAGATGGAAGAAGAGGAAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAAGTGGAAATCTTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAAATTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGGAAAAAAAGCAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTCGCTCATACCACTGAACACTTTCCCTCTTATTTTATTTTTCGTTGTTGTGGAGAATTATGGAAATGCGGAAGAGTTACATATACAATGTACATGGGGGGGGGCAGTTTAGAGGGCTAAAGAGAGAAGAAAATGCTGTAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTGCATAATGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATAGAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACCACNGTAGAAG
  5   1   2       bld Ga18      in                      xlk118n03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTCTGAGCACAGCCTCGGGGTAGCTCGCTACAAGATGGAAGAAGAGGAGACCCTGTGCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCACGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGAANGCACCCAGTGNTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCAGCAGGNGAATCCAGAGCCAGAAGAGGAGAGAGACAAATTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGGaaaaaaaaGCAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTCGCTCATACCACTGAACACTTTCCCTCtttttttatttttCGTTGTTNTGGAGAATTATGGAAATGCGGAAGAGTTACATATACAATGTACATgggggggggNNGNTTAGANGNNTAAANNGAGAAGANNNNNTGTANNNT
  3   1   2       bld Ga18                             rxlk108g16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAGNNGNCCCNNNNCCTGCAGTATGATATGAATGACTGTTACAGCCGNCTCAAGANNCTCNNGCCCNCCNTTCCNCCCANNAAGAAAGTCAGCAAAGTGGAANTCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGTNAGANNNNNACCCAGTGCTGCTCAGNCAACANCCACCTACCAGGACCCCTCTTACGGNCCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATTTTGTGCCGTTAANCCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAAATTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGAAAAAAGCAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTTGCTCATACCAGTGAACACTTTCCCTCGTATTTTCCTCTATCATCCAACTTGATTTAATTTCTTACCTTTTTTTGTTTGTTGTGAAGAATTATGGAAATGCGGAAGAGTCAGATATACAATGTACCTGGGAGGGGGCAGTTTAGAGGGCTAGAGAGAGAGAGAGAATATGCTATAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATAATTTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTACATATTGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATATAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGNCTACNGTAATTATGAAG
  3   1   2       bld DMZ  5g3  in                         xl307i24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCTGCAGTATGATATGAATGACTGTTACAGCCGGCTCAAGAGACTCGTGCCCACCATTCCACCCAACAAGAAAGTCAGCAAAGTGGAAATCCTGCAGCATGTTATTGACTATATCTTGGATCTGCAGTTGGCGCTAGACACGCACCCAGTGCTGCTCAGGCAACAGCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGCCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAAATTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGGAAAAAAAGCAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTCGCTCATACCACTGAACACTTTCCCTCTTTTTTTATTTTTCGTTGTTGTGGAGAATTATGGAAATGCGGAAGAGTTACATATACAATGTACATGGGGGGGGCAGAGGGCTAAAGAGAGAAGAAAATGCTGTAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTGCATAATGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATAGAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTA
  3   1   2       bld Tbd7 5g3  in                         XL063p21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAACAGCCNCCNTACCAGGACCCNTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATTTTGTGCCGTTAAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAAATTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGAAAAAAGCAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTTGCTCATACCAGTGAACACTTTCCCTCGTATTTTCCTCTATCATCCAACTTGATTTAATTTCTTACCTTTTTTTGTTTGTTGTGAAGAATTATGGAAATGCGGAAGAGTCAGATATACAATGTACCTGGGAGGGGGCAGTTTAGAGGGCTAGAGAGAGAGAGAGAATATGCTATAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATAATTTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTACATATTGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATATAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTACTGTAATTATGAAGTATTTTTAATTAAATATTTTGTGTAAATA
  3   1   2       bld Tbd7 5g3  in                         XL059p14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGNCAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGTCAAATTANAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGGAAAAAAAGCAACGTACACATCACTTTCTTACACCACGAAGAATATATTCNTATGCCATTCGCTCATACCANTGAACACTTTCCCTCTTTTTTTATTTTTCGTTGTTGTGGAGAATTATGGAAATGCGGAAGAGTTACATANNCAATGTACATGGGGGGGGGGCAGTTTAGAGGGCTAAAGAGAGAAGAAAATGCTGTAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCNTGCAGGNATGTTGCATAATGTATAGAGAAANCCGAGTGACATTTCATACTATGTA
  3   1   2       bld Tbd7 5x3  out                        XL059p15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGCCTTAGTGGTGACCAAGCAAGGAGNCAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGNCAAATTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAnAGGGGAAAAAAAGCAACGTACACATCACTTTCTTACACCNCGAAGAATATATTCCTATGCCATTCGCTCATACCACTGAACACTTTCCCTCTTTTTTTATTTTTCGTTGTTGTGGAGAATTATGGAAATGCGGAAGAGTTACATATNCAATGTACATGGGGGGGGGGCAGTTTAGAGGGCTAAAGAGAGAAGAAAATGCTGTAATATGAAGAACTGAATATTGAAGCTTCNCTTAATATACCAGAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTGCATAATGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATAGAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGAC
  5   1   2       bld Emb4      out                   IMAGE:4203477.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGCCTATCGTCGACCCACGCGTCCGCGAAGAATTATTCCTATGCCATTTGCTCATACCAGTGAACACTTTCCCTCGTATTTTCCTCTATCATCCAACTTGATTTAATTTCTTACCTTTTTTTGTTTGTTGTGAAGAATTATGGAAATGCGGAAGAGTCAGATATACAATGTACCTGGGAGGGGGCAGTTTAGAGGGCTagagagagagagagaATATGCTATAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATAAttttttttACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTACATATTGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATATAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTactgtaattatgaagtatttttaattaaatattttgtgtaaatataagtttgtgtttttttAATCTCC
  3   1   2       add Tbd7      in                         XL075m06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CANAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATANATGATTTTATTGGTTCAGGGAATTTTTNTTCCCTGCAGGAATGTTGCATAATGTAT
  5   1   2       e50                            Xl3.1-IMAGE:7765095.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCAGAGCCAGAGAGGAGAGAGACCAAATTAGAGAATAAGGGAGGGGAAAGGAAAAGCAGACAAAAGAGGGGAAAAAAAGCAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTCGCTCATACCACTGAACACTTTCCCTCTTTTTTTATTTTTCGTTGTTGTGGAGAATTATGGAAATGCGGAAGAGTTACATATACAATGTACATGGGGGGGGGCAGTTTAGAGGGCTAAAGAGAGAAGAAAATGCTGTAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTGCATAATGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATAGAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTACTGTAATTATGAAGTATTTTTAATTAAATATTTTGTGTAAATATAAATTTGTGTTTTTTTTTTTTAATCTCCTGGGGGTTCCATTCCTATTTGGATAAGAAAATATACAGCGATCTATCAAGAATTTGTT
                                                  Xl3.1-CHK-1012704990                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCAGAxxxGxxAGAGACxAAxTxxxxxAATAAGGGxxGGGxAAGGAAAAGCAGACAAAAGAGGGGAAAAAAAGCAACGTACACATCACTTTCTTTCACCACGAAGAATATATTCCTATGCCATTCGCTCATACCACTGAACACTTTCCCTCTTTTTTTATTTTTCGTTGTTGTGGAGAATTATGGAAATGCGGAAGAGTTACATATACAATGTACATGGGGGGGGGCAGTTTAGAGGGCTAAAGAGAGAAGAAAATGCTGTAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTGCATAATGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATAGAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTACTGTAATTATGAAGTATTTTTAATTAAATATTTTGTGTAAATATAAATTTGTGTTTTTTTTTTTTAATCTCCTGGGGGTTCCATTCCTATTTGGATAAGAAAATATACAGCGATCTATCAAGAATTTGTTAAANCC
  3   1   2       bld Ga18      in                      xlk118n03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGNNCCTGCAGTNTNANNNTNAATNACTNTTNCANNCNGCTCAANNAGACTNGNNCCCNNCNTNCCNCCCANNAAGAAANTCANNAAANNGGAAATCNNGCAGCANNNNNTNACNTATATCTNNNNNCNNNAGTTGNNGCNAGANNNNCNCCNAGTGCTGCTNANNNNNCAGCCNCCANCCAGGNCCCNTNTTACGGNCCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGCCGTTGANCCATTTTTGAGGTGTGCAGNAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAAnTTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGGAAAAAAAAGCAACGTACACATNNNTTTCTTACNCCACGAAGAATATATTCCTATNCCATTNGCTCATACCNCTGAANNCTTTCCCTCTTTTTTTATTTTTCGTTGTTGTGGAGAATTATGGAAATGCGGAAGAGTTACATATACAATGTACATGGGGGGGGGCAGTTTAGAGGGCTAAAGAGAGAAGAAAATGCTGTAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTGCATAATGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATAGAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTACTGTAATTATGAAGTATTTTTAATTAAATATTTTGTGTAAATATAAATTTGTGTTTTTTTTTTTTAATCTCCTGGGGGTTCCATTCCTATTTGGATAAGAAAATATACAGCGATCTATCAAGAATTTGTTAAANCCANTCATTTGCTNNC
  3   1   0       chi Eye1      in                    IMAGE:6957107.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAAATTTGGGCTCCCCCCCTTTCCACACCCAAAAAAAGAAATTTCCCCACAAAGGTGGAAATGCCTGGCAGCCCAGGTTTTTGAACAATATTCTGGGATCTGCCAATGGGGGCTAAACCCCGCACCCCATGTCTGGTTCAGGCACACAGCTCCCCCACCCGGACCTGCTCTATGGGGACCTCAATAACGGCCCCGGCTACCTTAGGTGGGGGACCAGCCAAGGAGACAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCCGGAAGAGGAGAGAGACAAATTAGAGAAATAAGGGAGGGGAAGTGAAAAGCAGACAAAAGAGGGGAAAAAAAGCAACGTACACATCACTTTCTTTCACCACGAAGAATATATTCCTATGCCATTCGCTCATACCACTGAACACTTTCCCTCTTATTTTATTTTTCGTTGTTGTGGAGAATTATGGAAATGCGGAAGAGTTACATATACAATGTACATGGGGGGGGGCAGTTTAGAGGGCTAAAGAGAGAAGAAAATGCTGTAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTGCATAATGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATAGAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTACTGTAATTATGAAGTATTTTTAATTAAATATTTTGTGTATAATATAAATTTGTGTTTTTTTTTGGAATCTCCTGGGGGTTCCATTCCTATTTGGATAAGAAAATATACAGCGATCTTCAGGGAATGTTAAAACCAGTCATCTGCTGTCGAAGCCCTTCCACCC
  3   1   2       chi Te2N      in                    IMAGE:7765095.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAGAGGAGACTGGTGCATAGTAGATGCTTACAGCGGTCAGAACTCTCCCACATTCACCACAGAAAGTCAGCAGTGGAATCTGCAGCCGTTATGACTAATCTGGATCGCAGTTGCGCTAGACACGCCCCAGTGTGCTCAGCACAGCCCACCAACCAGGACCCCTCTTACGGACCTCAATACTGACCCGGCTGCCTTAGTGGTGAACAAGCAAGGAGACAGTATATTGTGCCGTTGAACCATTTTTGAGGTGTGCAGCAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAAATTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGGAAAAAAAGCAACGTACACATCACTTTCTTACACCACGAAGAATATATTCCTATGCCATTCGCTCATACCACTGAACACTTTCCCTCTTTTTTTATTTTTCGTTGTTGTGGAGAATTATGGAAATGCGGAAGAGTTACATATACAATGTACATGGGGGGGGGCAGTTTAGAGGGCTAAAGAGAGAAGAAAATGCTGTAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTGCATAATGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATAGAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTACTGTAATTATGAAGTATTTTTAATTAAATATTTTGTGTAAATATAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       chi Ga18      in                       xlk78l15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCTNAGNNAANANCCNCNANCCNAGGNCCCCNNNNNNNGNNCCTNANTACTGNCCCGNCTGCNTTAGTGGNGNANAAGCANGGAGACAGTATATTGTGCCGTTGANCCNTTTTTGAGGTGTGCANNAGGCGAATCCAGAGCCAGAAGAGGAGAGAGACAANTTAGAGAAATAAGGGAGGGGAAGGAAAAGCAGACAAAAGAGGGGAAAAAAAGCAACGTACNCATNNCTTTCTTNCACCNCGAAGAANATATTCCTATNCCATTNGCTCATACCNCTGAACNCTTTCCCTCTTTTTTTATTTTTCGTTGTTGTGGAGAATTATGGAAATGCGGAAGAGTTACATATACAATGTACATGGGGGGGGGCAGTTTAGAGGGCTAAAGAGAGAAGAAAATGCTGTAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTGCATAATGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATAGAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTACTGTAATTATGAAGTATTTTTAATTAAATATTTTGTGTAAATATAAATTTGTGTTTTTTTTTTTTAATCTCCTGGGGGTTCCATTCCTATTTGGATAAGAAAATATACAGCGATCTATCAAGAATTTGTTAAANCCAGTCATTTGCT
  3   1   2      seed Ga18      in                       xlk62f18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ANGNGGAGAGAGNCAAATTTAGNNAANNANGGGAGGGGNNGGAAAAGCAGNCAAAAGAGGGGGAAAAAAAAGCACCGTNCNNNTCNCTNNNNTNNNNCCNCGAAGAATATATTCCTATNCCATTCGCTCATNCCNCTGAACNCTTTCCCTCTTTTTTTATTTTTCGTTGTTGNGGAGAATTATGGAAATGCGGAAGAGTTACATATACAATGTACATGGGGGGGGGCAGTTTAGAGGGCTAAAGAGAGAAGAAAATGCTGTAATATGAAGAACTGAATATTGAAGCTTTACTAATATACCAGAGCTTTGTAGATACAATTTTTTTACATCTATTGTTTAAAATAGATGATTTTATTGGTTCAGGGAATTTTTCTTCCCTGCAGGAATGTTGCATAATGTATAGAGAAATCCGAGTGACATTTCATACTATGTATATAGAGAGATGTTCTATAAGTGTAAGTGATAAAGTATATGCTTTAATAGACTACTGTAATTATGAAGTATTTTTAATTAAATATTTTGTGTAAATATAAATTTGTGTTTTTTTTTTTTAATCTCCTGGGGGTTCCATTCCTATTTGGATAAGAAAATATACAGCGATCTATCAAGAATTTGTTAAANCCANTCATTTGCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)