Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8070322.3                      13 END     1           3        7                MGC82128 protein [Xenopus laevis]
     2   1.0    0Xl3.1-IMAGE:4678568.5                       4 END     1           3       25                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xl225l09.5                           15 PI      90         53      750                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:8070322.3                      13 PI      87       1247     1621                MGC82128 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012837938 Xl3.1-xl291l02.5.5 - 28 ESTs
                                                                       .....-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xl291l02.5.5                          ATTGCCGGGTTGTCACTCTCGGTAAAGGCGCTGGTATCTTTTTGGTGATCTCTGGGTGCTGTTGCTGATTTCTTAGCTACCGCTGAGGCGTCTGAACGGATTTAATCCACTCAACGTGCACCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAACTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTACTGACTCAGTTGGATGCTGCCAAAACTAGAAAAGATCCAGAAGGAAAAAGCTCTGCAAAAGGTCCTGGGCCAGATAATGAGAACTTGGTGACATACGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCCCAGGCTGCAAAGATGGCTGAGCTAGAGAAACGCTTGGGGGAGCTTGAGGCTGCTGTGCGTTGTGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACGGTTGAAATTCTACAGGCTAAAGTCAATCTGTTAGATGTGGCATCTCTGGACCAAGTCGAGGCCAGACTACAGAGTGTCTTGGGGAAAATGAATGAAATTGCCAAGCACAAAGCCACCATTGAGGATGCCGACACTGAAAGCAAGGTGCACCAACTCTATGAGACAGTGCAGAAGTGGGATTCTATGTCTATCACTCTTCCACAGGTTGTCCAGAGACTGCTAACGTTAAAGCAGCTTCATGAGCAAGCCATGCAGTTCGGGCAGCTCCTCACCCACTTGGACACGACACAGCAGATGATATCAAATTCTTTGAAGGACAATACGAATGCATTAGCCATGGTCCAGAAGGCCATGAAGGAGAACCTGGCTACTGTGGAAGACAATTTTTCCAGTATTGATGGCAGAATAAAGAAACTAAGCAAATGAGCTGCACTTCTTCACTTCAAACCTCATTCCCTATAATATCAAGAAAAGAAGATTTTCTGCAGACTCTGCACTAAGAAATCTATTCCCTCCCCTACAAAAGAGAGGTTTTACCATTGTACATATGTCTTGTTACTCCCCCCCCCCCCCGGTCTCCTAAGAATGGTTTCTTCTGTACCCGCTCATGCATGGAAACTTACTGGGGGTTATTTATAAACACTGGGCAGTAACCTATGGCAACCAATCAGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCGCTGATTGGTTGCTATGGGTTACTATTCAGGGGCATAGTGTTTATAAAGGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTTCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCACCAATCAGAGGAGAACGTCCATAGACCTTTTATTTATATATATATTGTTCTTATCACCTTTCTTTTGTGGCCATCAGTGCATAGAGTAAACTGTAATGCCCAGCCGAGAGACGTTCATTAACCTAGTTAATTAATAATGCCTTACTCTAACCAGCCACCTGATCATTGCTCTCACTAAATTATACTTCTTAACCTGCCTACACTTTATAGCCTCTTACTGCTTCTTATA
                                                  Xl3.1-CHK-1012722789                                GGGTTGTCACTCTCGGTAAAGGCGCTGGTATCTTTTTGGTGATCTCTGGGTGCTGTTGCTGATTTCTTAGCTACCGCTGAGGCGTCTGAACGGATTTAATCCACTCAACGTGCACCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAACTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTACTGACTCAGTTGGATGCTGCCAAAACTAGAAAAGATCCAGAAGGAAAAAGCTCTGCAAAAGGTCCTGGGCCAGATAATGAGAACTTGGTGACATACGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCCCAGGCTGCAAAGATGGCTGAGCTAGAGAAACGCTTGGGGGAGCTTGAGGCTGCTGTGCGTTGTGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACGGTTGAAATTCTACAGGCTAAAGTCAATCTGTTAGATGTGGCATCTCTGGACCAAGTCGAGGCCAGACTACAGAGTGTCTTGGGGAAAATGAATGAAATTGCCAAGCACAAAGCCACCATTGAGGATGCCGACACTGAAAGCAAGGTGCACCAACTCTATGAGACAGTGCAGAAGTGGGATTCTATGTCTATCACTCTTCCACAGGTTGTCCAGAGACTGCTAACGTTAAAGCAGCTTCATGAGCAAGCCATGCAGTTCGGGCAGCTCCTCACCCACTTGGACACGACACAGCAGATGATATCAAATTCTTTGAAGGACAATACGAATGCATTAGCCATGGTCCAGAAGGCCATGAAGGAGAACCTGGCTACTGTGGAAGACAATTTTTCCAGTATTGATGGCAGAATAAAGAAACTAAGCAAATGAGCTGCACTTCTTCACTTCAAACCTCATTCCCTATAATATCAAGAAAAGAAGATTTTCTGCAGACTCTGCACTAAGAAATCTATTCCCTCCCCTACAAAAGAGAGGTTTTACCATTGTACATATGTCTTGTTAxxCxCCCCCCCCCCCGGTCTCCTAAGAATGGTTTCTTCTGTACCCGCTCATGCATGGAAACTTACTGGGGGTTATTTATAAACACTGGGCAGTAACCTATGGCAACCAATCAGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCGCTGATTGGTTGCTATGGGTTACTATTCAGGGGCATAGTGTTTATAAAGGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTTCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCACCAATCAGAGGAGAACGTCCATAGACCTTTTATTTATATATATATTGTTCTTATCACCTTTCTTTTGTGGCCATCAGTGCATAGAGTAAACTGTAATGCCCAGCCGAGAGACGTTCATTAACCTAGTTAATTAATAATGCCTTACTCTAACCAGCCACCTGATCATTGCTCTCACTAAATTATACTTCTTAACCTGCCTACACTTTATAGCCTCTTACTGCTTCTTATAAAACTG
                                                      consensus depths                               2     2     3     3     3     5     5     5     6     6     6     7     7    10     7    10     7    10     7    10     7    10     7    10     8    11     8    11     8    11     8    11     8    11     8    11     8    11     9    11     9    11    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    12    12    12    13    12    12    12    12    12    12    12    12    12    12    11    11    11    11    12    12    12    12    11    11    11    11    11    11    11    11    11    11     9     9     9     9     7     8     7     8     7     8     7     8     6     7     6     7     6     7     7     8     7     8     7     8     7     7     7     7     7     7     6     6     6     6     6     6     7     7     5     6     5     6     5     6     5     6     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     7     9     8     8     9     9     9     9     9    10     9    10     9    10     8     9     7     8    11    11    11    11    11    11     9     9    11    11    11    11    11    11     8    10     9    10     9    11     8    10     9    11     9    11     8     9     9    11     9    11     9    11     8    10     8    10     9    11     8     9     9    10     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     6     9     6     9     6     8     4     5     5     5     3     4
  5   1   2      ests                                 Xl3.1-xl291l02.5                          ATTGCCGGGTTGTCACTCTCGGTAAAGGCGCTGGTATCTTTTTGGTGATCTCTGGGTGCTGTTGCTGATTTCTTAGCTACCGCTGAGGCGTCTGAACGGATTTAATCCACTCAACGTGCACCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAACTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTACTGACTCAGTTGGATGCTGCCAAAACTAGAAAAGATCCAGAAGGAAAAAGCTCTGCAAAAGGTCCTGGGCCAGATAATGAGAACTTGGTGACATACGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCCCAGGCTGCAAAGATGGCTGAGCTAGAGAAACGCTTGGGGGAGCTTGAGGCTGCTGTGCGTTGTGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACGGTTGAAATTCTACAGGCTAAAGTCAATCTGTTAGATGTGGCATCTCTGGACCAAGTCGAGGCCAGACTACAGAGTGTCTTGGGGAAAATGAATGAAATTGCCAAGCACAAAGCCACCATTGAGGATGCCGACACTGAAAGCAAGGTGCACCAACTCTATGAGACAGTGCAGAAGTGGGATTCTATGTCTATCACTCTTCCACAGGTTGTCCAGAGACTGCTAACGTTAAAGCAGCTTCATGAGCAAGCCATGCAGTTCGGGCAGCTCCTCACCCACTTGGACACGACACAGCAGATGATATCAAATTCTTTGAAGGACAATACGAATGCATTAGCCATGGTCCAGAAGGCCATGAAGGAGAACCTGGCTACTGTGGAAGACAATTTTTCCAGTATTGATGGCAGAATAAAGAAACTAAGCAAATGAGCTGCACTTCTTCACTTCAAACCTCATTCCCTATAATATCAAGAAAAGAAGATTTTCTGCAGACTCTGCACTAAGAAA
  5   1   2      ests                                 Xl3.1-XL212i18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGTCTCCTAAGAATGGTTTCTTCTGTACCCGCTCATGCATGGAAACTTACTGGGGGATATTTATAAACACTGGGCAGTAACCTATGGCAACCAATCAGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCGCTGATTGGTTGCTATGGGTTACTATTCAGGGGCATAGTGTTTATAAAGGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTTCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCACCAATCAGAGGAGAACGTCCATAGACCTTTTATTTATATATATATTGTTCTTATCACCTTTCTTTTGTGGCCATCAGTGCATAGAGTAAACTGTAATGCCCAGCCGAGAGACGTTCATTAACCTAGTTAATTAATAATGCCTTACTCTAACCAGCCACCTGATCATTGCTCTCACTAAATTATACTTCTTAACCTGCCTACACTTTATAGCCTCTTACTGCTTCTTATAAAACTG
                                                                   SNP                                                                                                                                                  G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------G-
                                               BLH ATG     186    1024                          
                                               BLH MIN     186     245                          
                                               BLH MPR     174     245                          
                                               BLH OVR     186     499                          
                                               CDS MIN     186     245                          
                                               EST CLI      15       1                          
                                               ORF LNG     186      38                          
  5   1   2      ests                                 Xl3.1-xl291l02.5                          ATTGCCGGGTTGTCACTCTCGGTAAAGGCGCTGGTATCTTTTTGGTGATCTCTGGGTGCTGTTGCTGATTTCTTAGCTACCGCTGAGGCGTCTGAACGGATTTAATCCACTCAACGTGCACCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAACTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTACTGACTCAGTTGGATGCTGCCAAAACTAGAAAAGATCCAGAAGGAAAAAGCTCTGCAAAAGGTCCTGGGCCAGATAATGAGAACTTGGTGACATACGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCCCAGGCTGCAAAGATGGCTGAGCTAGAGAAACGCTTGGGGGAGCTTGAGGCTGCTGTGCGTTGTGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACGGTTGAAATTCTACAGGCTAAAGTCAATCTGTTAGATGTGGCATCTCTGGACCAAGTCGAGGCCAGACTACAGAGTGTCTTGGGGAAAATGAATGAAATTGCCAAGCACAAAGCCACCATTGAGGATGCCGACACTGAAAGCAAGGTGCACCAACTCTATGAGACAGTGCAGAAGTGGGATTCTATGTCTATCACTCTTCCACAGGTTGTCCAGAGACTGCTAACGTTAAAGCAGCTTCATGAGCAAGCCATGCAGTTCGGGCAGCTCCTCACCCACTTGGACACGACACAGCAGATGATATCAAATTCTTTGAAGGACAATACGAATGCATTAGCCATGGTCCAGAAGGCCATGAAGGAGAACCTGGCTACTGTGGAAGACAATTTTTCCAGTATTGATGGCAGAATAAAGAAACTAAGCAAATGAGCTGCACTTCTTCACTTCAAACCTCATTCCCTATAATATCAAGAAAAGAAGATTTTCTGCAGACTCTGCACTAAGAAA
                                                  Xl3.1-CHK-1012689860                                GGGTTGTCACTCTCGGTAAAGGCGCTGGTATCTTTTTGGTGATCTCTGGGTGCTGTTGCTGATTTCTTAGCTACCGCTGAGGCGTCTGAACGGATTTAATCCACTCAACGTGCACCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAACTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTACTGACTCAGTTGGATGCTGCCAAAACTAGAAAAGATCCAGAAGGAAAAAGCTCTGCAAAAGGTCCTGGGCCAGATAATGAGAACTTGGTGACATACGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCCCAGGCTGCAAAGATGGCTGAGCTAGAGAAACGCTTGGGGGAGCTTGAGGCTGCTGTGCGTTGTGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACGGTTGAAATTCTACAGGCTAAAGTCAATCTGTTAGATGTGGCATCTCTGGACCAAGTCGAGGCCAGACTACAGAGTGTCTTGGGGAAAATGAATGAAATTGCCAAGCACAAAGCCACCATTGAGGATGCCGACACTGAAAGCAAGGTGCACCAACTCTATGAGACAGTGCAGAAGTGGGATTCTATGTCTATCACTCTTCCACAGGTTGTCCAGAGACTGCTAACGTTAAAGCAGCTTCATGAGCAAGCCATGCAGTTCGGGCAGCTCCTCACCCACTTGGACACGACACAGCAGATGATATCAAATTCTTTGAAGGACAATACGAATGCATTAGCCATGGTCCAGAAGGCCATGAAGGAGAACCTGGCTACTGTGGAAGACAATTTTTCCAGTATTGATGGCAGAATAAAGAAACTAAGCAAATGAGCTGCACTTCTTCACTTCAAACCTCATTCCCTATAATATCAAGAAAAGAAGATTTTCTGCAGACTCTGCACTAAGAAATCTATT
  5   1   2       bld Emb1 5x3  out                   IMAGE:3403158.5p GACGCGTGGGCGCGAGGTTTCCATCATTGCCGGGTTGTCACTCTCGGTAAAGGTGCTGGTATCTTTTTGGTGATCTCTGGGTGCTGTTGCTGATTTCTTAGCTACCGCTGAGGCGTCTGAACGGATTTAATCCACTCAACGTGCACCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAAGAAACTCCACAGCAGAAGTAT
  5   1   2       bld FaB  5g                         IMAGE:8072533.5p                          ATTGCCGGGTTGTCACTCTCGGTAAAGGCGCTGGTATCTTTTTGGTGATCTCTGGGTGCTGTTGCTGATTTCTTAGCTACCGCTGAGGCGTCTGAACGGATTTAATCCACTCAACGTGCAGCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAACTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTACTGACTCAGTTGGATGCTGCCAAAAC
  5   1   2       chi Ov1                             IMAGE:6316685.5p                           TTGCCGGGTTGTCACTCTCGGTAAAGGCGCTGGTATCTTTTTGGTGATCTCTGGGTGCTGTTGCTGATTTCTTAGCTACCGCTGAGGCGTCTGAACGGATTTAATCCACTCAACGTGCACCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAAAAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAACTTTGACTGAACCCAGATGGGTGCCCCTGGGCAAAAGCGGTTTTACCTGGACTTCAAACTTGGGAAAGGCTGTGCCCAAAAACCTATAGAAAAAGGATTCCCCGGAAAGAGGaaaaaaaaaGCCTTCTTGCCCA
  5   1   2       bld Emb4 5g                         IMAGE:4679745.5p                                         GGACGCTTGGGGGCGCTGGTATCTTTTTGGTGATCTCTGGGTGCTGTTGCTGATTTCTTAGCTACCGCTGAGGCGTCTGAACGGATTTAATCCACTCAACGTGCAGCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAA
  5   1   2       bld Egg1 5g                            PBX0135D09.5p                                          GGCACGAGGAGGTGCTGGTATCTTTTTGGTGATCTCTGGGTGCTGTTGCTGATTTCTTAGCTACCGCTGAGGCGTCTGAACGGATTTAATCCACTCAACGTGCACCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATTCAAGAGAACAAGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTATGTATAAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTG
  5   1   2       bld Ga12 5g3  in                         XL212i18.5p                                                                         GAGGCTGGGTGCTGTTGCTGATTTCTTAGCTACCGCTGAGGCGTCTGAACGGATTTAATCCACTCAACGTGCAGCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAACTTGACTGAC
  5   1   2       bld Neu7 5g                              XL037f05.5p                                                                                GTGCTGTTGCTGATTTCTTAGCTACCGCTGNNGCGTCTGAACGGNTTTAATCCACTCAACGTGCAGCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGTAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAAGAAACTCCACAGCAGAAGTATCAGCGATTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGA
  5   1   2       bld Emb4                   IMAGE:4682504-IMAGp.IMAGp                                                                                       TTCTTAGCTACCGCTGAGGCGTCTGAACGGATTTAATCCACTCAACGTGCAGCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGTTTGCACAAGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAACTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTACTGACTCAGTTGGATGCTGCCAAAACTAGAAAAGATCCAGAAGGAAAAAGCTCTGCAAAAGGTCCTGGGCCAGATAATGAGAACTTGGTGACATACGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCCCAGGCTGCAAAGATGGCTGAGCTAGAGAAACGCTTGGGGGA
  5   1   2       bld Emb4                            IMAGE:4682504.5p                                                                                        TCTTAGCTACCGCTGAGGCGTCTGAACGGATTTAATCCACTCAACGTGCAGCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGTTTGCACAAGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAACTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTACTGACTCAGTTGGATGCTGCCAAAACTAGAAAAGATCCAGAAGGAAAAAGCTCTGCAAAAGGTCCTGGGCCAGATAATGAGAACTTGGTGACATACGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCCCAGGCTGCAAAGATGGCTGAGCTAAAGAAACGCTTGGGGGGAGCTTGAGGGCTGCTGNGCGTTTGTGATCAGGACACTCAGAATCCCCT
  5   1   2       bld Ga12 5g3  in                         XL161b24.5p                                                                                          GTGATTTCTTAGCTACCGCTGNGGCGTCTGAACGGATTTAATCCACTCAACGTGCACCTGTCTGGCTCCTTCTGTCCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGA
  5   1   2      seed DMZ  5g3  in                         xl291l02.5p                                                                                                                                                                     CCCGCCTCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCAAGACATGGCCGACCCTAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCTGATCTCTATGAAACAAGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAACTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTACTGACTCAGTTGGATGCTGCCAAAACTAGAAAAGATCCAGAAGGAAAAAGCTCTGCAAAAGGTCCTGGGCCAGATAATGAGAACTTGGTGACATACGAGTTGCATTGTCGTCCTGAGCAAACA
  5   1   2       bld Ga12                                 XL185g11.5p                                                                                                                                                                                                                                                                                     GGGCGATTTGCCCGAGGATGATCAAGCCGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGATGTTTAGATTTTTCAGATCGGATTACCAAATCCAAGAGAACAGGCTACGAATCTGGGGAGTACGAAATACTCGGAGAAGGCTTAGGTATAAAAGAAACTCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAACTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTACTGACTCAGTTGGATGCTGCCAAAACTAGAAAAGATCCAGAAGGAAAAAGCTCTGCAAAAGGTCCTGGGCCAGATAATGAGAACTTGGTGACATACGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCCCAGGCTGCAAAGATGGCTGAGCTAGAGAAACGCTTGGGGGAGCTTGAGGCTGCTGTGCGTTGTGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCA
  5   1   2       bld Tbd7      in                         XL059j07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACAGCAGNAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACACAAGAAGTGGAAAAGACACAGAGCACATTGAAAGAATCTGCCACTGAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAACTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTACTGACTCAGTTGGATGCTGCCAAAACTAGAAAAGATCCAGAAGGAAAAAGCTCTGCAAAAGGTCCTGGGCCAGATAATGAGAACTTGGTGACATACGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCCCAGGCTGCAAAGATGGCTGAGCTAGAGAAACGCTTGGGGGAGCTTGAGGCTGCTGTGCGTTGTGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACGGTTGAAATTCTACAGGCTAAAGTCAATCTGTTAGATGTGGCATCTCTGGACCAAGTCGAGGCCAGACTACAGAGTGTCTTGGGGAAAATGAATGAAATTGCC
  5   1   2       bld Tbd7      in                         XL105f05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGAAAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCCTTAAAACAGCAATTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAACTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTACTGACTCAGTTGGATGCTGCCAAAACTAGAAAAGATCCAGAAGGAAAAAGCTCTGCAAAAGGTCCTGGGCCAGATAATGAGAACTTGGTGACATACGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCCCAGGCTGCAAAGATGGCTGAGCTAGAGAAACGCTTGGGGGAGCTTGAGGCTGCTGTGCGTTGTGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACGGTTGAAATTCTACAGGCTAAAGTCAATCTGTTAGATGTGGCATCTCTGGACCAAGTCGAGGCCAGACTACAGAGTGTCTTGGGGAAAATGAATGAAATTGCCAAGCACAAAGCCACCATTGAGGATGCCGACACTGAAAGCAAGGTGCACCAACTCTATGAGACAGTGCAGAAGTGGGATTCTATGTCTATCACTCTTCCACAGGTTGTCCAGAGACTGCTAACGTTAAAGCAGCTTCATGAGCAAGCCATGCAGTTCGGGCAGCTCCTCACCCACTTGGACACAACACAGCAGATGATATCAAATTCTTTGAAG
  5   1   2       bld Gas3      in                      xlnga003i04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTCTGCAAAAGGTCCTGGGCCAGATAATGAGAACTTGGTGACATACGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCCCAGGCTGCAAAGATGGCTGAGCTAGAGAAACGCTTGGGGGAGCTTGAGGCTGCTGTGCGTTGTGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACGGTTGAAATTCTACAGGCTAAAGTCAATCTGTTAGATGTGGCATCTCTGGACCAACTCGAGGCCAGACTACAGAGTGTCTTGGGGAAAATGAATGAAATTGCCAAGCACAAAGCCACCATTGAGGATGCCGACACTGAAAGCAAGGTGCACCAACTCTATGAGACAGTGCAGAAGTGGGATTCTATGTCTATCACTCTTCCACAGGTTGTCCAGAGACTGCTAACGTTAAAGCAGCTTCATGAGCAAGCCATGCAGTTCGGC
  5   1   2       bld Gas5      in                    IMAGE:3747912.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGAGCTAGAGAAACGCTTGGGGGAGCTTGAGGCTGCTGTGCGTTGTGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACGGTTGAAATTCTACAGGCTAAAGTCAATCTGTTAGATGTGGCATCTCTGGACCAAGTCGAGGCCAGACTACAGAGTGTCTTGGGGAAAATGAATGAAATTGCCAAGCACAAAGCCACCATTGAGGATGCCGACACTGAAAGCAAGGTGCACCAACTCTATGAGACAGTGCAGAAGTGGGATTCTATGTCTATCACTCTTCCACAGGTTGTCCAGAGACTGCTAACGTTAAAGCAGCTTCATGAGCAAGCCATGCAGTTCGGGCAGCTCCTCACCCACTTGGACACGACACAGCAGATGATATCAAATTCTTTGAAGGACAATACGAATGCATTAGCCATGGTCCAGAAGGCCATGAAGGAGAACCTGGCTACTGTGGAAGACAATTTTTCCAGTATTGATGGCANGATAAAGAAACTAAGCAAA
  5   1   2       bld Eye1      out                   IMAGE:4755623.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGACTACAGAGTGTCTTGGGGAAAATGAATGAAATTGCCAAGCACAAAGCAGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAACTGTATGAAACGGTGCAGAAGTGGGACTCTATGTCTGGCACCCTGCCGCAGGTTGTCCAGAGGCTGCTGACGTTGAAGCAGCTTCATGAGCAAGCCATGCAGTTCGGCCAGCTTCTCACCCACTTGGACACTACACAGCAGATGATTGCAAATTCTTTGAAGGACAATACGAATGCATTAGCCATGGTCCAGAAAGCCATGAAGGAGAACCTGGCTACCGTGGAAGACAATTTTTCCAATATTGATGGTAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACTACAAACCTCATTCCCTAATGTATCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCTATTCGCTCCCCTACAAA
  5   1   2       bld Brn3                            IMAGE:8540564.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAAGCCATGCAGTTCGGGCAGCTCCTCACCCACTTGGACACGACACAGCAGATGATATCAAATTCTTTGAAGGATAATACGAATGCATTAGCCATGGTCCAGAAGGCCATGAAGGAGAACCTGGCTACTGTGGAAGACAATTTTTCCAGTATTGATGGCAGAATAAAGAAACTAAGCAAATGAGCTGCACTTCTTCACTTCAAACCTCATTCCCTATAATATCAAGAAAAGAAGATTTTCTGCAGACTCTGCACTAAGAAATCTATTCCCTCCCCTACAAAAGAGAGGTTTTACCATTGTACATATGTCTTGTTACTccccccccccccGTGTCTCCTAAGAATGGTTTCTTCTGTACCCGCTCATGCATGGAAACTTACTGGGGGTTATTTATAAACACTGGGCAGTAACCTATGGCAACCAGTCAGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCGCTGATTGGTTGCTATGGGTTACTATCCAGGGGCATATTGCCCCGTGTTTATAAATGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTGCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCACCAATCAGAGGAGAACGTCCATAGACCTTTTATTATATATATATTGTTCTATCACCCTTCTTTGTGGCATCAGTGCTAGAGTAACTGTATGCCAGCGAGAACGTCATTACTAGTAATTATATGCCTATCTACAGCACTGATATGCTCCCTAATAACTCTACTGCTACTTATGCTCTAGCTCTATAACTATCTCAAGaaaaaaaaaaaaaaaaaaaaaGCGCCAGG
  5   1   0       add Int2                            IMAGE:8530629.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAATGAGCTGCACTTCTTCACTTCAAACCTCATTCCCTATAATATCAAGAAAAGAAGATTTTCTGCAGACTCTGCACTAAGAAATCTATTCCCTCCCCTACAAAAGAGAGGTTTTACCATTGTACATATGTCTTGTTACTcccccccccccccGTGTCTCCTAAGAATGGTTTCTTCTGTACCCGCTCATGCATGGAAACTTACTGGGGGTTATTTATAAACACTGGGCAGTAACCTATGGCAACCAATCGGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAGGCTGATCGCTGATTGGTTGCTATGGGTTACTATCCAGGGGCATATTGCCCCGTGTTTATAGATGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTTCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCACCAATCAGAGGAGAACGTCCATAGACCTTTTATTtatatatatatatatatTGTTCTTATCACCTTTCTTTTGTGGCCATCAGTGCATAGAGTAAACTGTAATGCCCAGCCGAGAGACGTTCATTAACCTAGTTAATTAATAATGCCTTACTCTAACCAGCCACCTGATCATTGCTCTCACTAATTATACTTCTTAACCTGCCTACACTTTATAGCCTCTTACTGCTTCTATATAAACTGATCTTCaaaaaaaaaaaaaa
  5   1   0       add Ga15                               XL442j03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAGAAGATTTTCTGCAGACTCTGCACTAAGAAATCTATTCCCTCCCCTACAAAAGAGAGGTTTTACCATTGTACATATGTCTTGTTACTcccccccccccGGTCTCCTAANAATGGTTTCTTCTGTACCCGCTCATGCATGGAAACTTACTGGGGGTTATTTATAAACACTGGGCAGNGACCTATGGCAACCAATCANATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCNCTGATTGGTTGCTATGGGTTACTATTCAGGGGCATAGNGTTTATAAAGGAGCCCCACCGTCCCTTCATTTCAGGGGCTCATTCNCATCTGATTTCTTAGGAAACCTGCGNGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCAACAATCANAGGANAACGTCCATANACCTTTTATTTATATATATATTGNTCTTATCACCTTTCTTTTGNGGCCATCAGNGCATANAGTAAACTGTA
  5   1   2      ests                                 Xl3.1-XL212i18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGTCTCCTAAGAATGGTTTCTTCTGTACCCGCTCATGCATGGAAACTTACTGGGGGATATTTATAAACACTGGGCAGTAACCTATGGCAACCAATCAGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCGCTGATTGGTTGCTATGGGTTACTATTCAGGGGCATAGTGTTTATAAAGGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTTCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCACCAATCAGAGGAGAACGTCCATAGACCTTTTATTTATATATATATTGTTCTTATCACCTTTCTTTTGTGGCCATCAGTGCATAGAGTAAACTGTAATGCCCAGCCGAGAGACGTTCATTAACCTAGTTAATTAATAATGCCTTACTCTAACCAGCCACCTGATCATTGCTCTCACTAAATTATACTTCTTAACCTGCCTACACTTTATAGCCTCTTACTGCTTCTTATAAAACTG
                                                  Xl3.1-CHK-1012698579                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCTAAGAATGGTTTCTTCTGTACCCGCTCATGCATGGAAACTTACTGGGGGATATTTATAAACACTGGGCAGTAACCTATGGCAACCAATCAGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCGCTGATTGGTTGCTATGGGTTACTATTCAGGGGCATAGTGTTTATAAAGGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTTCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCACCAATCAGAGGAGAACGTCCATAGACCTTTTATTTATATATATATTGTTCTTATCACCTTTCTTTTGTGGCCATCAGTGCATAGAGTAAACTGTAATGCCCAGCCGAGAGACGTTCATTAACCTAGTTAATTAATAATGCCTTACTCTAACCAGCCACCTGATCATTGCTCTCACTAAATTATACTTCTTAACCTGCCTACACTTTATAGCCTCTTACTGCTTCTTATAAAACTGATCTTC
  3   1   2       bld Neu7                                 XL038f05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTACTCCCCCCCCCCCGGTCTCCTAAGAATGGTTTCTTCTGTACCCGCTCATGCATGGAAACTTACTGGGGGTTATTTATAAACACTGGGCAGTAACCTATGGCAACCAATCAGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCGCTGATTGGTTGCTATGGGTTACTATTCAGGGGCATAGTGTTTATAAAGGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTGCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCAACAATCAGAGGAGAACGTCCATAGACCTTTTATTTATATATATATTGTTCTTATCACCTTTCTTTTGTGGCCATCAGTGCATAGAGTAAACTGTAATGCCCAGCCGAGAGACGTTCATTAACCTAGTTAATTAATAATGCCTTACTCTAACCAGCCACCTGATCATTGCCCTCACTAAATTATACTNCTTAACCTGCCTA
  3   1   2       bld Ga12 5g3  in                         XL212i18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCCCCCCCCCCCCGGTCTCCTAAGAATGGTTTCTTCTGTACCCGCTCATGCATGGAAACTTACTGGGGGATATTTATAGACACTGGGCAGTAACCTATGGCAACCAATCAGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCGCTGATTGGTTGCTATGGGTTACTATTCAGGGGCATAGTGTTTATAAAGGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTTCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCACCAATCAGAGGAGAACGTCCATAGACCTTTTATTTATATATATATTGTTCTTATCACCTTTCTTTTGTGGCCATCAGTGCATAGAGTAAACTGTAATGCCCAGCCGAGAGACGTTCATTAACCTAGTTAATTAATAATGCCTTACTCTAACCAGCCACCTGATCATTGCTCTCACTAAATTATACTTCTTAACCTGCCTACACTTTATAGCCTCTTACTGCTTCTTATAAAACTGATCTTCAAAAAAACAAAAAAGAA
  3   1   2      seed DMZ  5g3  in                         xl291l02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCCCCCCCCCCGGTCTCCTAAGAATGGTTTCTTCTGTACCCGCTCATGCATGGAAACTTACTGGGGGATATTTATAGACACTGGGCAGTAACCTATGGCAACCAATCAGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCGCTGATTGGTTGCTATGGGTTACTATTCAGGGGCATAGTGTTTATAAAGGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTTCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCACCAATCAGAGGAGAACGTCCATAGACCTTTTATTTATATATATATTGTTCTTATCACCTTTCTTTTGTGGCCATCAGTGCATAGAGTAAACTGTAATGCCCAGCCGAGAGACGTTCATTAACCTAGTTAATTAATAATGCCTTACTCTAACCAGCCACCTGATCATTGCTCTCACTAAATTATACTTCTTAACCTGCC
  3   1   2       bld Tbd7      in                         XL059j07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCCCCCCCACGGTCTCCTAAGAATGGTTTCTTCTGTACCCGCTCATGCATGGAAACTTACTGGGGGATATTTATAAACACTGGGCAGTAACCTATGGCAACCAGTCAGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCGCTGATTGGTTGCTATGGGTTACTATTCAGGGGCATAGTGTTTATAAAGGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTTCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCACCAATCAGAGGAGAACGTCCATAGACCTTTTATTTATATATATATTGTTCTTATCACCTTTCTTTTGTGGCCATCAGTGCATAGAGTAAACTGTAATGCCCAGCCGAGAGACGTTCATTAACCTAATTAATTAATAATGCCTTACTCTAACCAGCCACCTNATCATTGCTCTCACTAAATTATACTTCTTAACCTGCCTACACTTTATAGCCTCTTACTGCTTCTTATAAAA
  3   1   2       bld Tbd7      in                         XL105f05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCCCCCCCACGGTCTCCTAAGAATGGTTTCTTCTGTACCCGCTCATGCATGGAAACTTACTGGGGGATATTTATAAACACTGGGCAGTAACCTATGGCAACCAATCAGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCGCTGATTGGTTGCTATGGGTTACTATTCAGGGGCATAGTGTTTATAAAGGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTTCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCACCAATCAGAGGAGAACGTCCATAGACCTTTTATTTATATATATATTGTTCTTATCACCTTTCTTTTGTGGCCATCAGTGCATAGAGTAAACTGTAATGCCCAGCCGAGAGACGTTCATTAACCTAATTAATTAATAATGCCTTACTCTAACCAGCCACCNATCATGCTCTCACTAAATTAACTTCT
  3   1   2       bld Ga12 5g3  in                         XL161b24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCCCCCCCCGGTCTCCTAAGAATGGTTTCTTCTGTACCCGCTCATGCATGGAAACTTACTGGGGGTTATTTATAAACACTGGGCAGTAACCTATGGCAACCAATCAGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCGCTGATTGGTTGCTATGGGTTACTATTCAGGGGCATAGTGTTTATAAAGGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTTCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCACCAATCAGAGGAGAACGTCCATAGACCTTTTATTTATATATATATTGTTCTTATCACCTTTCTTTTGTGGCCATCAGTGCATAGAGTAAACTGTAATGCCCAGCCGAGAGACGTTCATTAACCTAGTTAATTAATAATNCCTTACTCTAACCAGCCACCTGATCATTGNTCTCACTAAATTATACTTCTTAACCTGCCTACACTTTATAGCCTCTTACTGCTT
  3   1   2       bld Gas3      in                      xlnga003i04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCATGCATGGAAACTTACTGGGGGATATTTATAAACACTGGGCAGTAACCTATGGCAACCAGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCGCTGATTGGTTGCTATGGGTTACTATTCAGGGGCATAGTGTTTATAAAGGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTGCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCACCAATCAGAGGAGAACGTCCATAGACCTTTTATTTATATATATATTGTTCTTATCACCTTTCTTTTGTGGCCATCAGTGCATAGAGTAAACTGTAATGCCCAGCCGAGAGACGTTCATTAACCTAGTTAATTAATAATGCCTTACTCTAACCAGCCACCTGATCATTGCTCTCACTAAATTATACTTCTTAACCTGCCTACACTTTATAGCCTCTTACTGCTTCTTATAAAACTGATCTTTCAAAA
  3   1   2       bld Gas5      in                    IMAGE:3747912.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCAATCAGATGATTGCTTTCAATGTTCAACCTGCAGCTGGCTGAAAAAAGCTGATCGCTGATTGGTTGCTATGGGTTACTATTCAGGGGCATAGTGTTTATAAAGGAGCCCCACCGTCCCTTCATTTCAGGTGCTCATTCACATCTGATTTCTTAGGAAACCTTCGTGTATTTTTCAGGGTATTATGTTTGCATGCCGGTACATGCGATGCACCAATCAGAGGAGAACGTCCATAGACCTTTTATTTATATATATATTGTTCTTATCACCTTTCTTTTGTGGCCATCAGTGCATACAGTAAACTGTAATGCCCAGCCGAGAGACGTTCATTAACCTAGTTAATTAATAATGCCTTACTCTAACCAGCCACCTGATCATTGCTCTCANTAACTTATCCTTCTTCACCCCCNTACACTCTCCAGCCTNTTANTGNTTCTCCTAAAACTGATCTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)