Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6642099.5.5                    31 PI      80       1037     1341                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:8549014.5.5                    26 PI      78       1037     1341                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6956437.5                      16 PI      92          2     1153                novel kruppel-like factor family protein [Xenopus tropicalis]
     4   0.0    0Xl3.1-IMAGE:6956437.3                      13 PI      89       1236     1822                Kruppel-like factor 2a [Danio rerio]

 This cluster: approximate FL confidence score = 93%

 1012837969 Xl3.1-IMAGE:6861928.5.5 - 19 ESTs
                                                                       ..-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6861928.5.5             GAGACAACTGCTCGTGCTACTGCTGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGGAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCATAGTTATGTGGCGGAGCTGCTGACCCCCGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTTAAGGCTAGCATGCATAGTAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCACTGGCCATTTGTCATCGGACCACCTACAGCACCTGAGCCACAAGATTAAAAAGGAGCGACCTGAGCAGTCGTGTATGTTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATTATGGAGCAGAAGGCTGGTATCATGCAGATGCATGGCCAACTCCTTCCCAATCCAGCTTATTCTCAGCACAGGCTCAGCCCCCCAGTGCCCACAGAGGATATGCCCCCCAATGACTGCCCACATGNATCTCCCGAGCTGCACTTGCCCCTCATGTCAATGGCACAGCACTACCCAATGGCAAGCCCCTACCCCACTCATTTTAGACCGCCACCACCCGCGCAGTTCCCGGAGAGCGCTCGAGTTTACAGAGACCCCATGAAGGTTCACCCATCTATGCATGGAATGATTGTCACCCCTCCCTCCTCCCCCTTGCTTGAGTATTACCCTGCCATGAGTGCCACGGATGACTGCAAACCAAAGAGGGGTCGGAGATCGTGGGCCAGGAAAAGAACTGCCACTCACAGCTGCGAGTACCCGGGCTGCGGCAAAACCTACACCAAGAGCTCCCACCTGAAGGCTCATATGCGAACGCATACAGGAGAGAAACCATATCACTGTAATTGGGAAGGCTGCGGATGGAAGTTCGCAAGATCGGACGAACTGACGCGTCACTTTCGCAAGCACACGGGTCACCGACCCTTCCAGTGCCACCTGTGTGAGAGAGCCTTCTCCCGATCCGACCATCTGGCCCTGCATATGAAGAGGCACATGTAGAGATCAACTTGTATTGGCTCAAAGTAATATATTCAACTCGGAGACTATTTATACAGAAGAAGAAGAAATATTTTCTTATTGGGGGATTTGTATGTATATACAGCCTTGTATAAAATAGTATTTAAGAATCAAACCTGATCGCCAGGTGAATATGCGGTAACCAGAAATATAAATAAATTATTTAAAGAGAAAACAAGATCGCTATCTGTAAAGGGAGGGTTGGTTACTCTGCATTTGTACAATATTTGTAATTTTGCTTTCTTGCGTTTTGGTAAGGTGAATTGAAGTTCTTGGTTGACCTGGAATGTTACAGCTATTTTATTACAGATATTATTACAATTTTTTTGTTGTAAAGTTGAACTGAAATGTTCCAGAGAAGCCCCGTGCTCTTAATGAAAAGTGCAATTTTAATTCAGTTTGACAGGCACAATATTTTTACCATGAATTGGAAAGAAACAGCGACATCTAATGGACATTCGATGTTAGTTACTCCAAAGTACTTTCTATGTGTGTATAGCATTTAAAATGAATTGGCCGTTTTGCAGGGTCTGTTTGTTTTTATACTTTACAAAAACTTTGTATATATATTTTTTTAAATACATAAATTTCTGCTAGCATTGTTTTGATCCCTTCTGAAGGGATATAAAACGATTTGGTACTGCAA
                                                  Xl3.1-CHK-1012721431                   ACTGCTCGTGCTACTGCTGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGGAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCATAGTTATGTGGCGGAGCTGCTGACCCCCGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTTAAGGCTAGCATGCATAGTAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCACTGGCCATTTGTCATCGGACCACCTACAGCACCTGAGCCACAAGATTAAAAAGGAGCGACCTGAGCAGTCGTGTATGTTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATTATGGAGCAGAAGGCTGGTATCATGCAGATGCATGGCCAACTCCTTCCCAATCCAGCTTATTCTCAGCACAGGCTCAGCCCCCCAGTGCCCACAGAGGATATGCCCCCCAATGxxxxxCCACATGNATCTCCCGAGCTGCACTxGCCxxTCATGTCAATGGCACAGCACTACCCAATGGCAAGCCCCTACCCCACTCATTTTAxxxxxCCACCACCCxxxCAxxxxxCGGAGAxxxxTxGAGTTTACAGAGACCCCATGAAGGTTCACCCATCTATGCATGGAATGATTGTCACCCCTCCCTCCTCCCCCTTGCTTGAGTATTACCCTGCCATGAGTGCCACGGATGACTGCAAACCAAAGAGGGGTCGGAGATCGTGGGCCAGGAAAAGAACTGCCACTCACAGCTGCGAGTACCCGGGCTGCGGCAAAACCTACACCAAGAGCTCCCACCTGAAGGCTCATATGCGAACGCATACAGGAGAGAAACCATATCACTGTAATTGGGAAGGCTGCGGATGGAAGTTCGCAAGATCGGACGAACTGACGCGTCACTTTCGCAAGCACACGGGTCACCGACCCTTCCAGTGCCACCTGTGTGAGAGAGCCTTCTCCCGATCCGACCATCTGGCCCTGCATATGAAGAGGCACATGTAGAGATCAACTTGTATTGGCTCAAAGTAATATATTCAACTCGGAGACTATTTATACAGAAGAAGAAGAAATATTTTCTTATTGGGGGATTTGTATGTATATACAGCCTTGTATAAAATAGTATTTAAGAATCAAACCTGATCGCCAGGTGAATATGCGGTAACCAGAAATATAAATAAATTATTTAAAGAGAAAACAAGATCGCTATCTGTAAAGGGAGGGTTGGTTACTCTGCATTTGTACAATATTTGTAATTTTGCTTTCTTGCGTTTTGGTAAGGTGAATTGAAGTTCTTGGTTGACCTGGAATGTTACAGCTATTTTATTACAGATATTATTACAATTTTTTTGTTGTAAAGTTGAACTGAAATGTTCCAGAGAAGCCCCGTGCTCTTAATGAAAAGTGCAATTTTAATTCAGTTTGACAGGCACAATATTTTTACCATGAATTGGAAAGAAACAGCGACATCTAATGGACATTCGATGTTAGTTACTCCAAAGTACTTTCTATGTGTGTATAGCATTTAAAATGAATTGGCCGTTTTGCAGGGTCTGTTTGTTTTTATACTTTACAAAAACTTTGTATATATATTTTTTTAAATACATAAATTTCTGCTAGCATTGTTTTGATCCCTTCTGAAGGGATATAAAACGATTTGGTACTGCAAAAAAAT
                                                      consensus depths                  7    10     9    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10     9    10     8    10     8    10     7     9     7     9     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     2     6     2     6     2     5     1     4     1     4     1     4     1     3     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     1     1     1     1     1     1     1     1     1     1     2     2     1     1     2     2     1     1     2     2     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     3     3     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5
  5   1   2      ests                            Xl3.1-IMAGE:6861928.5             GAGACAACTGCTCGTGCTACTGCTGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGGAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCATAGTTATGTGGCGGAGCTGCTGACCCCCGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTTAAGGCTAGCATGCATAGTAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCACTGGCCATTTGTCATCGGACCACCTACAGCACCTGAGCCACAAGATTAAAAAGGAGCGACCTGAGCAGTCGTGTATGTTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATTATGGAGCAGAAGGCTGGTATCATGCAGATGCATGGCCAACTCCTTCCCAATCCAGCTTATTCTCAGCACAGGCTCAGCCCCCCAGTGCCCACAGAGGATATGCCCCCCAATGACTGCCCACATGNATCTCCCGAGCTGCACT
  5   1   2      ests                                 Xl3.1-xl306m13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCCAGTGCCACCTGTGTGAGAGAGCCTTCTCCCGATCCGACCATCTGGCCCTGCATATGAAGAGGCACATGTAGAGATCAACTTGTATTGGCTCAAAGTAATATATTCAACTCGGAGACTATTTATACAGAAGAAGAAGAAATATTTTCTTATTGGGGGATTTGTATGTATATACAGCCTTGTATAAAATAGTATTTAAGAATCAAACCTGATCGCCAGGTGAATATGCGGTAACCAGAAATATAAATAAATTATTTAAAGAGAAAACAAGATCGCTATCTGTAAAGGGAGGGTTGGTTACTCTGCATTTGTACAATATTTGTAATTTTGCTTTCTTGCGTTTTGGTAAGGTGAATTGAAGTTCTTGGTTGACCTGGAATGTTACAGCTATTTTATTACAGATATTATTACAATTTTTTTGTTGTAAAGTTGAACTGAAATGTTCCAGAGAAGCCCCGTGCTCTTAATGAAAAGTGCAATTTTAATTCAGTTTGACAGGCACAATATTTTTACCATGAATTGGAAAGAAACAGCGACATCTAATGGACATTCGATGTTAGTTACTCCAAAGTACTTTCTATGTGTGTATAGCATTTAAAATGAATTGGCCGTTTTGCAGGGTCTGTTTGTTTTTATACTTTACAAAAACTTTGTATATATATTTTTTTAAATACATAAATTTCTGCTAGCATTGTTTTGATCCCTTCTGAAGGGATATAAAACGATTTGGTACTGCAAAAAAA
                                               BLH ATG      98     641             
                                               BLH MIN      98     132             
                                               BLH OVR      98      66             
                                               EST CLI      -8      70             
                                               ORF LNG      98       4             
  5   1   2      ests                            Xl3.1-IMAGE:6861928.5             GAGACAACTGCTCGTGCTACTGCTGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGGAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCATAGTTATGTGGCGGAGCTGCTGACCCCCGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTTAAGGCTAGCATGCATAGTAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCACTGGCCATTTGTCATCGGACCACCTACAGCACCTGAGCCACAAGATTAAAAAGGAGCGACCTGAGCAGTCGTGTATGTTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATTATGGAGCAGAAGGCTGGTATCATGCAGATGCATGGCCAACTCCTTCCCAATCCAGCTTATTCTCAGCACAGGCTCAGCCCCCCAGTGCCCACAGAGGATATGCCCCCCAATGACTGCCCACATGNATCTCCCGAGCTGCACT
                                                  Xl3.1-CHK-1012693331                   ACTGCTCGTGCTACTGCTGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGGAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCATAGTTATGTGGCGGAGCTGCTGACCCCCGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTTAAGGCTAGCATGCATAGTAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCACTGGCCATTTGTCATCGGACCACCTACAGCACCTGAGCCACAAGATTAAAAAGGAGCGACCTGAGCAGTCGTGTATGTTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATTATGGAGCAGAAGGCTGGTATCATGCAGATGCATGGCCAACTCCTTCCCAATCCAGCTTATTCTCAGCACAGGCTCAGCCCCCCAGTGCCCACAGAGGATATGCCCCCCAATGxxxxxCCACATGNATCTCCCGAGCTGCACTGGCCTG
  5   1   2       bld Em10 5g                         IMAGE:8318851.5p GAAAAGTTTCAAGAGACAACTGCTCGTGCTACTGCTGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGGAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCATAGTTATGTGGCGGAGCTGCTGACCCCCGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTTAAGGCTAGCATGCATAGTAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCACTGGCCATTTGTCATCGGACCACCTACAGCACCTGAGCCACAAGATTAAAAAGGAGCGACCTGAGCAGTCGTGTATGTTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATTATGGAG
  5   1   2       bld DMZ  5g3  in                         xl306m13.5p GAAAGTTTCAAGAGACAACTGCTCGTGCTACTGCTGGAGTTCTATAGATCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGGAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCATAGTTATGTGGCGGAGCTGCTGACCCCCGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTTAAGGCTAGCATGCATAGTAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCACTGGCCATTTGTCATCGGACCACCTACAGCACCTGAGCCACAAGATTAAAAAGGAGCGACCTGAGCAGTCGTGTATGTTGGGTGCCGGCTCCCCTACTTCCCCAG
  5   1   2       bld Lu1  5g3  in                    IMAGE:4057860.5p    AAGTTTCAAGAGACAACTGCTCGTGCTACTGCTGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTG
  5   1   2       bld Brn1 5g                         IMAGE:6953815.5p     AAGTTTCAGAGACAACTGCTCGTGCTACTGCTGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGGAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCATAGTTATGTGGCGGAGCTGCTGACCCCCGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTTAAGGCAAGCATGCATAGTAGGAAGTACACTGAGCTCAAAGGATCTGCCATGGACACCACTGGCCATTTGTCATCGGACCACCTACAGCACCTGAGCCACAATATTAAAAAAGGAGCGACCCTGAGCAGTCCATGTATGTTGGGGGGCCGGGTTCCCCCAACTTCCCCCAAATGGTTTAATCCCCCCTTTTGGGAACAAAAAGGGTGGGTTACCCTGCATAAAGCCTGGGACCAAATCCCCTCCCGCTATCCGGGTTTTAATTCGCCTATCCCCCGGGTTTCGTATCCCCCTCATAAGGccccccccTAAGGGTAATGGCCCACCCCCCAACGGACTTGGACATCCTTGCAATCGATTTCTAACATTTTAATACTGGCAATACGACCGCCACCACCCAGTCATCATACGGAGAGCGCTCCCACTN
  5   1   2       bld Emb1 5g                         IMAGE:6632968.5p      AAGTTTCAGAGAAACTGCTCGTGCTACTGCTGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGGAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCATAGTTATGTGGCGGAGCTGCTGACCCCCGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTTAAGGCTAGCATGCATAGTAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCACTGGCCATTTGTCATCGGACCACCTACAGCACCTGAGCCACAAGATTAAAAAGGAGCGACCTGAGCAGTCGTGTATGTTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATTATGGAGCAGAAGGCTGGTATCATGCAGATGCATGGCCAACTCCTTCCCAATCCAGCTTATTCTCAGCACAGGCTCAGCCCCCCAGTGCCCACAGAAGATATGCCCCCCAAATGACTGCCACATGNATCTCCCGAGCTGCACTTGCCTGG
  5   1   2       bld Emb1 5g                         IMAGE:6633502.5p      AAGTTTCAGAGAAACTGCTCGTGCTACTGCTGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGGAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCATAGTTATGTGGCGGAGCTGCTGACCCCCGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTTAAGGCTAGCATGCATAGTAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCACTGGCCATTTGTCATCGGACCACCTACAGCACCTGAGCCACAAGATTAAAAAGGAGCGACCTGAGCAGTCGTGTATGTTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATTATGGAGCAGAAGGCTGGTATCATGCAGATGCATGGCCAACTCCTTCCCAATCCAGCTTATTCTCAGCACAGGCTCAGCCCCCCAGTGCCCACAGAGGATATGccccccccATGACTGCCACATGNATCTCCCGAGCTGCACTGGCCTGGCCCCTCATGTCCATGGGCACAGCCACTACCCCAAGGGGCAAGC
  5   1   2       bld Oo1  5g                         IMAGE:6861928.5p      AATTTCAGAGACAACTGCTCGTGCTACTGCTGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGGAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCATAGTTATGTGGCGGAGCTGCTGACCCCCGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTTAAGGCTAGCATGCATAGTAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCACTGGCCATTTGTCATCGGACCACCTACAGCACCTGAGCCACAAGATTAAAAAGGAGCGACCTGAGCAGTCGTGTATGTTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATTATGGAGCAGAAGGCTGGTATCATGCAGATGCATGGCCAACTCCTTCCCAATCCAGCTTATTCTCAGCACAGGCTCAGCCCCCCAGTGCCCACAGAGGATATGCCCCCCAATGACTGCCACATGNATCTCCG
  5   1   2       chi Emb1                            IMAGE:6635977.5p       GTTTCAGAGACAACTGCTCGTGCTACTGCTGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGGAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCATAGTTATGTGGCGGAGCTGCTGACCCCCGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTTAAGGCTAGCATGCATAGTAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCACTGGCCATTTGTCATCGGACCACCTACAGCACCTGAGCCACAAGATTAAAAAGGAGCGACCTGAGCAGTCCCNNGGGGGNNGCCCNCCCNNNCGGGGgcgccccggcgccggcccgcgcccgccccgcccgcgccgcccccccccccnccccccccccccgccccccccgcgnccgccgcccgccccccccccccccgcgcccccccccccccggcnngcccgccccgcccgcgcggccccgccgcgggcgccccccggccccccnngcnggcgncgggggggccgcgccccggcccccccc
  5   1   2       bld Emb3 5g                         IMAGE:3400148.5p        TTCAAGAGACAACTGCTCGTGCTACTGCTGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGNGGAAATTCGTTGACTTGGACTTTAAATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCA
  5   1   2      seed DMZ  5g3  in                         xl258j13.5p             GAGACAACTGCTCGTGCTACTGCTGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGGAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCATAGTTATGTGGCGGAGCTGCTGACCCCCGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTTAAGGCTAGCATGCATAGTAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCACTGGCCATTTGTCATCGGACCACCTACAGCACCTGAGCCACAAGATTAAAAAGGAGCGACCTGAGCAGTCGTGTATGTTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATTATGGA
  5   1   2       bld Emb1 5g                IMAGE:6635977-IMAGp.IMAGp                            TACTGGCTCGGAGTTCTATAGTCGGGCTCCCTGCTTATAAGTCACCTGCAAGCCTGGTGCTGCTGCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTTCAACCGCTGGAAGACAAGCAGCTTGGCATGGTGTCGGACATGACTATGGAGGAGCTGAGACCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGGAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGTACCCCGGTGGGACATGGCGGCCCCTACCCATTGCCCGAGACCCCTGAGAGCTGCAGTACCACCTATGATAGTGATGGATCCTACACTGCCAATCAGAAATATGGAGGGGGGAGCTTTGCCGGGAGTCCCCATCATAGTTATGTGGCGGAGCTGCTGACCCCCGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTTAAGGCTAGCATGCATAGTAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCACTGGCCATTTGTCATCGGACCACCTACAGCACCTGAGCCACAAGATTAAAAAGGAGCGACCTGAGCAGTCGTGTATGATGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATTATG
  5   1   2       bld Ga15      in                       XL518n21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAGGAGCGACCTGAGCAGTCGTGTATGTTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATTATGGAGCAGAAGGCTGGTATCATGCAGATGCATGGCCAACTCCTTCCCAATCCAGCTTATTCTCAGCACAGGCTCAGCCCCCCAGTGCCCACAGAGGATATGCCCCCCAATGACTGCCACATGATCTCCGAGCTGCACTGCCTGCCCCTCATGTCAATGGCACAGCACTACCCAATGGCAAGCCCCTACCCCACTCATTTTACCAGCCAANCCCCCGCGCAGTTCCNTGGACAATTTGGAGTTTACAGAGACCCCATGAAGGTTCACCCATCTATGCATGGAATGATTGTCACCCCTCCCTCCTCCCCCTTGCTTGAGTATTACCCTGCCATGAGTGCCACGGATGACTGCAAACCAAAGAGGGGTCGGAGATCGTGGGCCAGGAAAAGAACTGCCACTCACAGCTGCGAGTACCCGGGCTGCGGCAAAACCTACACCAAGAGCTCCCACCTGAAGGCTCATATGCGAACGCATACAGGAGAGAAACCATATCACTGTAATTGGGAAGGCTGCGGATGGAAGTTCGCAAGATCGGACGAACTGACGCGTCACTTTCGCAAGCACACGGGTCACCGACCCTTCCAGTGCCACCTGTGTGAGAGAGCCTTCTCCCGATCCGACCATCTGGCCCTGCATATGAAGAGGCACATGTAGAGATCAACTTGTATTAGCTCAAAGTAATATATTCAACTCGGAGACTATTTATA
  5   1   0       add Gas3                              xlnga003a24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGATGACTGCAAACCAAAGAGGGGTCGGAGATCTTGGACCATGAAAAGAACTGCCACTCACAGTTGCCAGTTCCCGGTCTGCGGAAAAACCTACACCAAGAGCTTCCACCTGAAGGCTCATATGCGAACACATACAGGAGAGAAACCATATCACTGTAACTGTGAGGGCTGCGGATGGAAATTCGCAAGATCTGACGAACTCACCCGTCACTTTCGCAAGCACACGGGGGACCGACCCTTTCAGTGCCATTTGTGTGAGAGAGCCTTCTCCCGATCCGATCACATGGCCCTGCATATGAAGAGACACATGTAG
  5   1   2      ests                                 Xl3.1-xl306m13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCCAGTGCCACCTGTGTGAGAGAGCCTTCTCCCGATCCGACCATCTGGCCCTGCATATGAAGAGGCACATGTAGAGATCAACTTGTATTGGCTCAAAGTAATATATTCAACTCGGAGACTATTTATACAGAAGAAGAAGAAATATTTTCTTATTGGGGGATTTGTATGTATATACAGCCTTGTATAAAATAGTATTTAAGAATCAAACCTGATCGCCAGGTGAATATGCGGTAACCAGAAATATAAATAAATTATTTAAAGAGAAAACAAGATCGCTATCTGTAAAGGGAGGGTTGGTTACTCTGCATTTGTACAATATTTGTAATTTTGCTTTCTTGCGTTTTGGTAAGGTGAATTGAAGTTCTTGGTTGACCTGGAATGTTACAGCTATTTTATTACAGATATTATTACAATTTTTTTGTTGTAAAGTTGAACTGAAATGTTCCAGAGAAGCCCCGTGCTCTTAATGAAAAGTGCAATTTTAATTCAGTTTGACAGGCACAATATTTTTACCATGAATTGGAAAGAAACAGCGACATCTAATGGACATTCGATGTTAGTTACTCCAAAGTACTTTCTATGTGTGTATAGCATTTAAAATGAATTGGCCGTTTTGCAGGGTCTGTTTGTTTTTATACTTTACAAAAACTTTGTATATATATTTTTTTAAATACATAAATTTCTGCTAGCATTGTTTTGATCCCTTCTGAAGGGATATAAAACGATTTGGTACTGCAAAAAAA
                                                  Xl3.1-CHK-1012702597                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCCACCTGTGTGAGAGAGCCTTCTCCCGATCCGACCATCTGGCCCTGCATATGAAGAGGCACATGTAGAGATCAACTTGTATTGGCTCAAAGTAATATATTCAACTCGGAGACTATTTATACAGAAGAAGAAGAAATATTTTCTTATTGGGGGATTTGTATGTATATACAGCCTTGTATAAAATAGTATTTAAGAATCAAACCTGATCGCCAGGTGAATATGCGGTAACCAGAAATATAAATAAATTATTTAAAGAGAAAACAAGATCGCTATCTGTAAAGGGAGGGTTGGTTACTCTGCATTTGTACAATATTTGTAATTTTGCTTTCTTGCGTTTTGGTAAGGTGAATTGAAGTTCTTGGTTGACCTGGAATGTTACAGCTATTTTATTACAGATATTATTACAATTTTTTTGTTGTAAAGTTGAACTGAAATGTTCCAGAGAAGCCCCGTGCTCTTAATGAAAAGTGCAATTTTAATTCAGTTTGACAGGCACAATATTTTTACCATGAATTGGAAAGAAACAGCGACATCTAATGGACATTCGATGTTAGTTACTCCAAAGTACTTTCTATGTGTGTATAGCATTTAAAATGAATTGGCCGTTTTGCAGGGTCTGTTTGTTTTTATACTTTACAAAAACTTTGTATATATATTTTTTTAAATACATAAATTTCTGCTAGCATTGTTTTGATCCCTTCTGAAGGGATATAAAACGATTTGGTACTGCA
  3   1   2       bld DMZ  5g3  in                         xl306m13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCACACGGGTCACCGACCCTTCCAGTGCCACCTGTGTGAGAGAGCCTTCTCCCGATCCGACCATCTGGCCCTGCATATGAAGAGGCACATGTAGAGATCAACTTGTATTGGCTCAAAGTAATATATTCAACTCGGAGACTATTTATACAGAAGAAGAAGAAATATTTTCTTATTGGGGGATTTGTATGTATATACAGCCTTGTATAAAATAGTATTTAAGAATCAAACCTGATCGCCAGGTGAATATGCGGTAACCAGAAATATAAATAAATTATTTAAAGAGAAAACAAGATCGCTATCTGTAAAGGGAGGGTTGGTTACTCTGCATTTGTACAATATTTGTAATTTTGCTTTCTTGCGTTTTGGTAAGGTGAATTGAAGTTCTTGGTTGACCTGGAATGTTACAGCTATTTTATTACAGATATTATTACAATTTTTTTGTTGTAAAGTTGAACTGAAATGTTCCAGAGAAGCCCCGTGCTCTTAATGAAAAGTGCAATTTTAATTCAGTTTGACAGGCACAATATTTTTACCATGAATTGGAAAGAAACAGCGACATCTAATGGACATTCGATGTTAGTTACTCCAAAGTACTTTCTATGTGTGTATAGCATTTAAAATGAATTGGCCGTTTTGCAGGGTCTGTTTGTTTTTATACTTTACAAAAACTTTGTATATATATTTTTTTAAATACATAAATTTCTGCTAGCATTGTTTNGATCCCTTCTGAAGGGATATAAAACGATTTGGTACTGCAAAAAAAT
  3   1   2      seed DMZ  5g3  in                         xl258j13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCCAGTGCCACCTGTGTGAGAGAGCCTTCTCCCGATCCGACCATCTGGCCCTGCATATGAAGAGGCACATGTAGAGATCAACTTGTATTGGCTCAAAGTAATATATTCAACTCGGAGACTATTTATACAGAAGAAGAAGAAATATTTTCTTATTGGGGGATTTGTATGTATATACAGCCTTGTATAAAATAGTATTTAAGAATCAAACCTGATCGCCAGGTGAATATGCGGTAACCAGAAATATAAATAAATTATTTAAAGAGAAAACAAGATCGCTATCTGTAAAGGGAGGGTTGGTTACTCTGCATTTGTACAATATTTGTAATTTTGCTTTCTTGCGTTTTGGTAAGGTGAATTGAAGTTCTTGGTTGACCTGGAATGTTACAGCTATTTTATTACAGATATTATTACAATTTTTTTGTTGTAAAGTTGAACTGAAATGTTCCAGAGAAGCCCCGTGCTCTTAATGAAAAGTGCAATTTTAATTCAGTTTGACAGGCACAATATTTTTACCATGAATTGGAAAGAAACAGCGACATCTAATGGACATTCGATGTTAGTTACTCCAAAGTACTTTCTATGTGTGTATAGCATTTAAAATGAATTGGCCGTTTTGCAGGGTCTGTTTGTTTTTATACTTTACAAAAACTTTGTATATATATTTTTTTAAATACATAAATTTCTGCTAGCATTGTTTTGATCCCTTCTGAAGGGATATAAAACGATTTGGTACTGCAAAAAAATG
  3   1   2       bld Ga15      in                       XL518n21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAGAGAGCCTTCTCCCGATCCGACCATCTGGCCCTGCATATGAAGAGGCACATGTAGAGATCAACTTGTATTAGCTCAAAGTAATATATTCAACTCGGAGACTATTTATACAGAAGAAGAAGAAATATTTTCTTATTGGGGGATTTGTATGTATATACAGCCTTGTATAAAATAGTATTTAAGAATCAAACCTGATCGCCAGGTGAATATGCGGTAACCAGAAATATAAATAAATTATTTAAAGAGAAAACAAGATCGCTATCTGTAAAGGGAGGGTTGGTTACTCTGCATTTGTACAATATTTGTAATTTTGCTTTCTTGCGTTTTGGTAAGGTGAATTGAAGTTCTTGGTTGACCTGGAATGTTACAGCTATTTTATTACAGATATTATTACAATTTTTTTGTTGTAAAGTTGAACTGAAATGTTCCAGAGAAGCCCCGTGCTCTTAATGAAAAGTGCAATTTTAATTCAGTTTGACAGGCACAATATTTTTACCATGAATTGGAAAGAAACAGCGACATCTAATGGACATTCGATGTTAGTTACTCCAAAGTACTTTCTATGTGTGTATAGCATTTAAAATGAATTGGCCGTTTTGCAGGGTCTGTTTGTTTTTATACTTTACAAAAACTTTGTATATATATTTTTTTAAATACATAAATTTCTGCTAGCATTGTTTTGATCCCTTCTGAAGGGATATAAAACGATTTGGTACTGCAAAAAAATG
  5   1   2       bld Ga15                               XL499e01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTTCTTATTGGGGGATTTGTATGTATATACAGCCTTGTATAAAATAGTATTTAAGAATCAAACCTGATCGCCAGGTGAATATGCGGTAACCAGAAATATAAATAAATTATTTAAAGAGAAAACAAGATCGCTATCTGTAAAGGGAGGGTTGGTTACTCTGCATTTGTACAATATTTGTAATTTTGCTTTCTTGCGTTTTGGTAAGGTGAATTGAAGTTCTTGGTTGACCTGGAATGTTACAGCTATTTTATTACAGATATTATTACAATTTTTTTGTTGTAAAGTTGAACTGAAATGTTCCANANAANCCCCGTGCTCTTAATGAAAAGTGCAATTTTAATTCANTTTGACAGGCACAATATTTTTACCATGAATT
  3   1   2       bld Emb1                            IMAGE:3403241.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGGTTGGTTACTCTGCATTTGTACAATATTTGTAATTTTGCTTTCTTGCGTTTTGGTAAGGTGAATTGAAGTTCTTGGTTGACCTGGAATGTTACAGCTATTTTATTACAGATATTATTACAATTTTTTTGTTGTAAAGTTGAACTGAAATGTTCCAGAGAAGCCCCGTGCTCTTAATGAAAAGTGCAATTTTAATTCAGTTTGACAGGCACAATATTTTTACCATGAATTGGAAAGAAACAGCGACATCTAATGGACATTCGATGTTAGTTACTCCAAAGTACTTTCTATGTGTGTATAGCATTTAAAATGAATTGGCCGTTTTGCAGGGTCTGTTTGTTTTTATACTTTACAAAAACTTTGTATATATATTTTTTTAAATACATAAATTTCTGCTAGCATTGTTTTGATCCCTTCTGAAGGGATATAAAACGATTTGGTACTTGCAAAAANAATTGTAAATAGTTGTATAATAAAAATCATTATTTGCCAAAAAA
  3   1   2       bld Lu1  5g3  in                    IMAGE:4057860.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATGTTACAGCTATTTTATTACAGATATTATTACAATTTTTTTTGTTGTAAAGTTGAACTGAAATGTTCCAGAGAAGCCCCGTGCTCTTAATGAAAAGTGCAATTTTAATTCAGTTTGACAGACACAATATTTTTACCATGAATTGGAAAGAAACAGCGACATTTAATGGACATTCGATGTTAGTTACTCCAACGTACTTTCTATGTGTGTATAGCATTTAAAATGAATTGGCCGTTTTGCAGGGTCTGTTTGTTTTTATACTTTACAAAAACTTTGTATATATATTTTTTTAAATACATAAATTTCTGCTAGCATTGTTTTGATCCCTTCTGAAGGGAATATAAAACGNATTTGGTACTTGCAAAAAAATNTGTAAATAGTTGTATAATAAAAATCATTATTTGCCAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)